A method for improving the enzyme activity and specific activity of FAD-GDH expressed in Pichia pastoris

Abstract

This invention discloses a method for improving the enzyme activity and specific enzyme activity of FAD-GDH expressed in Pichia pastoris, comprising the following steps: (1) using CRISPR-Cas9 technology to construct a recombinant plasmid containing an optimized Pichia pastoris FAD synthesis expression cassette and a recombinant plasmid containing the Cas9 gene; (2) co-transforming the recombinant plasmid containing the Pichia pastoris FAD synthesis expression cassette and the recombinant plasmid containing the Cas9 gene into recombinant Pichia pastoris producing FAD-GDH to obtain recombinant Pichia pastoris engineered strains capable of overexpressing the prosthetic group FAD; (3) after fermentation culture and isolation purification, the total enzyme activity and specific enzyme activity of FAD-GDH in the recombinant Pichia pastoris engineered strains are significantly improved.

Description

Technical Field

[0001] This invention relates to the field of enzyme engineering technology, and in particular to a method for increasing the activity and specific activity of FAD-GDH enzyme expressed in Pichia pastoris. Background Technology

[0002] Glucose dehydrogenase (GDH) is a class of oxidoreductases that catalyze the oxidation of β-D-glucose to D-gluconic acid-1,5-lactone. Due to its unique catalytic properties, GDH has important applications in clinical diagnostics, industrial biocatalysis, and bioenergy.

[0003] Based on their cofactor dependence, glucose oxidases (GDHs) are mainly classified into nicotinamide adenine dinucleotide-dependent (NAD-GDH), pyrroloquinoline quinone-dependent (PQQ-GDH), and flavin adenine dinucleotide-dependent (FAD-GDH). Among these, FAD-GDH has gained widespread attention in electrochemical biosensors, particularly in blood glucose monitoring, due to its independence from oxygen as an electron acceptor and its high substrate specificity and thermal stability. Compared to glucose oxidase (GOD), FAD-GDH does not use molecular oxygen as an electron acceptor during catalysis, effectively avoiding interference from dissolved oxygen fluctuations on the detection signal. Furthermore, its specificity for glucose is superior to PQQ-GDH, demonstrating higher accuracy in clinical blood glucose monitoring. Although FAD-GDH and GOD share some structural similarities in their active sites, both producing gluconolactone, FAD-GDH differs significantly in its cofactor binding mechanism and electron transport pathway. Its prosthetic group FAD binds to the enzyme protein non-covalently, conferring higher catalytic efficiency.

[0004] Previous studies have reported that FAD-GDH derived from Aspergillus terreus exhibits high expression levels in recombinant expression systems, with fermentation broth enzyme activity reaching 260,000 U / mL. However, there is still room for improvement in the specific activity per unit protein (i.e., the catalytic activity per unit mass of protein). A lower specific activity implies that the enzyme preparation contains more inactive or apoenzyme proteins, which not only increases downstream purification costs but also limits its sensitivity in high-end biosensors.

[0005] In research on FAD-GDH, existing technologies mostly focus on increasing the total protein expression by increasing the copy number of the FAD-GDH structural gene or using strong promoters. Essentially, these methods only increase the total amount of FAD-GDH polypeptide chains synthesized by the host cell, thus manifesting as an increase in total enzyme activity in the fermentation broth. However, these methods are insufficient to effectively improve specific enzyme activity and cannot meet the demands of industrial production for high-purity, high-catalytic-efficiency enzyme preparations.

[0006] Currently, there are no reports on enhancing FAD-GDH enzyme activity and specific enzyme activity through overexpression of cofactor synthesis. If the ability of host cells to synthesize FAD cofactors can be enhanced, thereby increasing the effective binding efficiency of FAD with recombinantly expressed apoenzyme proteins, it is hoped that the limitations of existing expression systems can be overcome, achieving a dual enhancement of FAD-GDH enzyme activity and specific enzyme activity. Summary of the Invention

[0007] The purpose of this invention is to provide a method for improving the specific activity of FAD-GDH enzyme expressed in Pichia pastoris. This method can significantly improve the specific activity of FAD-GDH in secretory expression in Pichia pastoris without the need for the addition of expensive FAD cofactors.

[0008] The technical solution adopted by this invention to solve its technical problem is: A method for increasing the activity and specific activity of expressed FAD-GDH enzyme in Pichia pastoris includes the following steps: (1) Construct a recombinant plasmid containing the promoter and the Pichia pastoris FAD synthase gene, and construct a recombinant plasmid containing the Cas9 gene; (2) The recombinant plasmid containing the promoter and the Pichia pastoris FAD synthase gene and the recombinant plasmid containing the Cas9 gene were co-transformed into the host strain Pichia pastoris to obtain recombinant Pichia pastoris engineered strains that can overexpress the prosthetic group FAD. (3) The recombinant Pichia pastoris engineered strain was fermented, isolated and purified to obtain enzyme activity and FAD-GDH with higher enzyme activity.

[0009] Conventional methods for enhancing enzyme activity in existing technologies involve increasing the FAD-GDH gene copy number, thereby increasing FAD-GDH expression. This only increases the total enzyme activity in the fermentation broth, not the specific enzyme activity. However, the FAD synthesis-enhanced strain of this invention overexpresses the synthesis of the FAD prosthetic group, increasing the FAD content in the enzyme and thus increasing the enzyme activity per unit mass—that is, the specific enzyme activity. Higher specific enzyme activity means less enzyme is needed during use. Furthermore, this method only overexpresses the synthesis of the FAD prosthetic group without any screening or modification of the FAD-GDH gene.

[0010] Recombinant plasmids containing the Cas9 gene are bleomycin resistant, while recombinant plasmids containing the promoter and the Pichia pastoris FAD synthase gene are not bleomycin resistant.

[0011] In step (1), the promoter is AOX1, 0547, GAP or 0472 promoter.

[0012] In step (1), constructing a recombinant plasmid containing the promoter and the Pichia pastoris FAD synthase gene involves ligating the promoter and the Pichia pastoris FAD synthase gene into the donor plasmid Int1 vector. Preferably, the promoter is 0547. The donor plasmid Int1 vector is only a name change from the previously applied Cas9-Int1 plasmid vector to better express its meaning.

[0013] The Pichia pastoris FAD synthase gene is derived from Pichia pastoris strain GS115.

[0014] In step (3), methanol is used to induce the expression of FAD-GDH during fermentation culture.

[0015] The nucleotide sequence of the Pichia pastoris FAD synthase gene is shown in SEQ ID No. 1.

[0016] The donor plasmid Int1 vector was constructed as follows: the homologous arm sequences 1000 bp upstream and 1000 bp downstream of the Int1 site in Pichia pastoris were cloned into the pUC19 plasmid vector using the Gibson assembly method; the homologous arm sequence 1000 bp upstream of the Int1 site is shown in SEQ ID No. 2, and the homologous arm sequence 1000 bp downstream of the Int1 site is shown in SEQ ID No. 3.

[0017] In step (1), the recombinant plasmid containing the Cas9 gene is constructed by inserting sgRNA into the CRISPi plasmid. The sequence of the sgRNA is: TATCTGAAGTATTTACTGGG. The resistance gene on the CRISPi plasmid is bleomycin resistance.

[0018] The beneficial effects of this invention are: This invention adopts a novel strategy to significantly improve the enzyme activity and specific enzyme activity of FAD-dependent glucose dehydrogenase by overexpressing the synthesis of cofactors, thereby improving the catalytic efficiency of FAD-GDH, which is of great significance for improving its performance in the field of blood glucose monitoring. Attached Figure Description

[0019] Figure 1 This is a diagram of the colony PCR verification results; Figure 2 This is a graph showing the detection results of FAD content in FAD-GDH expressed by WCG and WCG-0547-FAD strains. (Detailed implementation method) The present invention will be described below through specific embodiments to make the technical solution of the present invention easier to understand and master, but the present invention is not limited thereto. Methods, means, equipment, and steps well known to those skilled in the art are not described in detail in order to highlight the main points of the present invention. Molecular biology experimental methods not specifically described in the following embodiments are all performed according to the specific methods listed in J. Sambrook's *Molecular Cloning: A Laboratory Manual* (3rd Edition), or according to the kit and product instructions; the reagents and materials mentioned, unless otherwise specified, are commercially available.

[0020] Experimental materials and reagents: Strains and vectors Both Escherichia coli DH5α and Pichia pastoris GS115 (abbreviated as WCG) strain carrying the FAD-GDH gene derived from Aspergillus terreus (the FAD-GDH gene originates from the NIH2624 gene of Aspergillus terreus, NCBI: XM_001216916) were synthesized and constructed by Qingke Biotechnology Co., Ltd.

[0021] The recombinant plasmid containing the Cas9 gene is the Cas9-sgRNA recombinant plasmid, which was synthesized by Qingke Biotechnology Co., Ltd. (by inserting sgRNA into the CRISPi plasmid (Addgene, Kit #1000000136). The sgRNA sequence is: TATCTGAAGTATTTACTGGG (SEQ ID No. 8). The resistance gene on the CRISPi plasmid is bleomycin resistance. The construction method can be found in reference 2: Gassler, T., Heistinger, L., Mattanovich, D., Gasser, B., Prielhofer, R. (2019). CRISPR / Cas9-Mediated Homology-Directed Genome Editing in Pichia pastoris. In: Gasser, B., Mattanovich, D. (eds) Recombinant Protein Production in Yeast. Methods in Molecular Biology, vol1923. Humana Press, New York, NY.

[0022] The donor plasmid Int1 vector (carrying approximately 1000 bp above and below the Int1 site of the Pichia pastoris genome as homologous arms, and the corresponding name for the synthesis method is Int1-donor plasmid in reference 1) was synthesized by Qingke Biotechnology Co., Ltd. The construction of the donor plasmid Int1 vector involved cloning the homologous arm sequences of 1000 bp upstream (SEQ ID No. 2) and 1000 bp downstream (SEQ ID No. 3) of the Int1 site of Pichia pastoris into the pUC19 plasmid vector using the Gibson assembly method. At the same time, Ndel and Notl restriction sites were introduced between the two homologous arms, and Pmel restriction sites were introduced at the outer ends of the two homologous arms. The specific synthesis method is described in the Materials and Methods section of existing literature: Gao J, Xu J, Zuo Y, Ye C, Jiang L, Feng L, Huang L, Xu Z, Lian J. Synthetic Biology Toolkit for Marker-Less Integration of Multigene Pathways into Pichia pastoris via CRISPR / Cas9. ACS Synth Biol. 2022 Feb 18;11(2):623-633.

[0023] Enzymes and kits High-fidelity enzyme (2×KeyPo Master Mix), plasmid extraction kit, gel extraction kit, seamless cloning kit (ClonExpress II One Step Cloning Kit), PCR product purification kit, restriction endonucleases DpnI and Sac I, all of the above reagents were purchased from Takara.

[0024] culture medium LB medium: 5 g / L yeast extract, 10 g / L peptone, 10 g / L sodium chloride, pH 7.0. Add 20 g / L agar powder when preparing solid medium. Autoclave at 121 °C for 20 min.

[0025] YPD medium: 10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, with 20 g / L agar powder added when preparing the solid medium. Autoclave at 115 ℃ for 30 min.

[0026] BMGY medium: yeast extract 10 g / L, peptone 20 g / L, glycerol 10 g / L, K₂HPO₄ 3.7 g / L, KH₂PO₄ 11.8 g / L, YNB 3.4 g / L, ammonium sulfate 10 g / L. Sterilize at 115 ℃ for 30 min.

[0027] BMMY medium: yeast extract 10 g / L, peptone 20 g / L, K₂HPO₄ 3 g / L, KH₂PO₄ 11.8 g / L, YNB 3.4 g / L, ammonium sulfate 10 g / L. Sterilize at 115 ℃ for 30 min.

[0028] BSM medium: calcium sulfate 0.93 g / L, potassium sulfate 18.2 g / L, magnesium sulfate heptahydrate 14.9 g / L, potassium hydroxide 4.13 g / L, glycerol 40 g / L, 85% phosphate 26.7 mL / L.

[0029] PTM1: Copper sulfate 6 g / L, sodium iodide 0.08 g / L, manganese sulfate monohydrate 3 g / L, sodium molybdate dihydrate 0.2 g / L, boric acid 0.02 g / L, cobalt chloride 0.5 g / L, zinc chloride 20 g / L, ferrous sulfate heptahydrate 65 g / L, biotin 0.2 g / L, concentrated sulfuric acid 5 mL / L.

[0030] Example 1: Construction of a recombinant plasmid containing the Pichia pastoris FAD synthase gene Pichia pastoris strain GS115 was disrupted using a boil-freeze method (yeast was streaked on YPD plates at 37°C, colonies were collected and dissolved in 20 μL of 0.02 mol / L NaOH solution, then placed in a PCR instrument at 98°C for 10 min, followed by a freezer at -80°C for 10 min, repeated 5 times at 98°C and 4 times at -80°C). The whole genome was extracted, and the Pichia pastoris FAD synthase gene (SEQ ID No. 1, NCBI accession number XM_002489538.1), AOX1 promoter (sequence shown in SEQ ID No. 4), 0547 promoter (sequence shown in SEQ ID No. 5), GAP promoter (sequence shown in SEQ ID No. 6), and 0472 promoter (sequence shown in SEQ ID No. 7) were obtained by PCR.

[0031] Genomic information for promoters 0547 and 0472 can be found in reference 3: Xu N, Zhu J, Zhu Q, et al. Identification and characterization of novel promoters for recombinant protein production in yeast Pichia pastoris. Yeast. 2018;35:379–385. Table 1.

[0032] The Pichia pastoris FAD synthase gene was ligated to the donor plasmid Int1 vector via the AOX1, 0547, GAP, and 0472 promoters, respectively, and then transformed into E. coli DH5α competent cells. The E. coli cells were inoculated into LB broth containing kanamycin (final concentration 0.1%) resistance and incubated at 37°C for 12-16 h. Two mL of the bacterial culture was then collected, and recombinant plasmids containing the Pichia pastoris FAD synthase gene were extracted using a plasmid extraction kit according to the manufacturer's instructions. These plasmids were named Int1-FAD1, Int1-0547-FAD1, Int1-GAP-FAD1, and Int1-0472-FAD1, respectively. These plasmids did not contain bleomycin resistance.

[0033] Example 2: Construction of recombinant Pichia pastoris engineered strain The gene was integrated into the Int1 site. The WCG strain was streaked and activated on antibiotic-free YPD plates and incubated overnight at 30°C. This was used to create competent WCG cells. Linearized plasmids Int1-FAD1, Int1-0547-FAD1, Int1-GAP-FAD1, and Int1-0472-FAD1, along with the Cas9-sgRNA recombinant plasmid, were electroporated into WCG cells. The cells were plated on YPD plates containing bleomycin (final concentration 0.05%) and incubated at 30°C for 3-4 days. Single colonies were selected and colony PCR was performed to confirm successful integration of the FAD synthase, yielding the recombinant Pichia pastoris strain. Finally, using YPD medium, the selected single colonies were subcultured three times. The colonies were streaked onto YPD plates, and single colonies were selected and spotted onto both bleomycin-resistant (final concentration 0.05%) and non-resistant YPD plates. Colonies that could grow on the non-resistant plate but not on the resistant plate were selected for further colony PCR verification. Figure 1 After verification that the FAD synthase gene was not lost, they were named WCG-FAD, WCG-0547-FAD, WCG-GAP-FAD, and WCG-0472-FAD, respectively.

[0034] The function of the Cas9-sgRNA recombinant plasmid is to precisely guide the sgRNA-Cas9 protein complex to the desired genomic location through base complementarity pairing with the target DNA site. The Cas9 gene expresses the Cas9 protein, which, after being guided to the target site by the sgRNA, performs site-specific cleavage of the DNA double strand, resulting in a double-strand break (DSB). The donor plasmid Int1 vector linearizes the homologous arm sequences at both ends of the donor DNA molecule, enabling homologous recombination pairing with homologous sequences flanking the DSB site in the genomic DNA. It acts as a template for homologous recombination repair, guiding the exogenous gene to precisely integrate into the break at the genomic target site through homologous directed repair (HDR) mechanisms.

[0035] The Cas9-sgRNA recombinant plasmid does not integrate into the Pichia pastoris genome. Subculturing is the process of removing the Cas9-sgRNA recombinant plasmid. Finally, selection is performed using YPD plates containing bleomycin resistance and those without. The bleomycin-resistant plates are used to screen out strains that still carry the Cas9-sgRNA recombinant plasmid (resisting bleomycin). Strains carrying the Cas9-sgRNA recombinant plasmid (resisting bleomycin) can grow on the resistant plates. Finally, colonies that can grow on the non-resistant plates but not on the resistant plates are selected, thus excluding strains carrying the Cas9-sgRNA recombinant plasmid (resisting bleomycin). The goal is to screen for strains that are antibiotic-free and contain the promoter + FAD synthase gene.

[0036] Example 3: Expression of glucose dehydrogenase WCG-FAD, WCG-0547-FAD, WCG-GAP-FAD, WCG-0472-FAD and WCG strain were streaked onto YPD solid medium and cultured upside down at 30°C for 2-3 days.

[0037] Three single colonies of each strain were selected and placed into different 5 mL YPD liquid culture medium test tubes, and incubated overnight at 30°C and 200 rpm. Each group had three replicates.

[0038] All bacterial cultures from each test tube were inoculated into different 100 mL BMGY medium and cultured at 30°C and 200 rpm, with OD controlled for each group. 600Maintain a consistent concentration of around 12. Then, centrifuge at 3500 rpm in a 50 mL sterile centrifuge tube to collect all cells from the BMGY medium. Resuspend the cells in BMMY medium and transfer to 30 mL of BMMY medium. Add 0.39 mL of anhydrous methanol to the medium and incubate at 30°C and 250 rpm. Add anhydrous methanol every 24 hours until the final concentration reaches 1%. After 72 hours of methanol induction, centrifuge the fermentation broth at 8000 rpm for 10 minutes, collect the supernatant, and weigh the centrifuged cells.

[0039] The fermentation supernatant was microfiltered using a 0.22-micron hollow fiber microfiltration system, and the filtrate was collected.

[0040] Purification was performed using a Ni-IDA metal chelate ionogel column (commercially available, Hangzhou Newlong Biotechnology Co., Ltd.). The buffers used were: Buffer A: 20 mM Tris-HCl, 0.5 M NaCl, 0 mM imidazole, pH 8.0; Buffer B: 20 ​​mM Tris-HCl, 0.5 M NaCl, 500 mM imidazole, pH 8.0. The loading flow rate was 0.5 mL / min, and the reequilibration flow rate was 0.5 mL / min.

[0041] Adjust the imidazole concentration by adjusting the ratio of buffer B to buffer A. Elute sequentially with imidazole concentrations of 25, 50, 100, 150, 250, and 500 mM at a flow rate of 0.5 mL / min. Collect the eluent when an elution peak appears at UV280. Store the collected enzyme solution at 4°C until analysis.

[0042] Example 4: Production of glucose dehydrogenase by fermentation in a 5L tank WCG-0547-FAD and WCG strains were separately inoculated into fermentation broth using glycerol as the carbon source and cultured, including the following process steps: WCG-0547-FAD and WCG were inoculated into 5 mL of YPD liquid medium and cultured in a shaker at 30 °C and 220 rpm for 16 hours to produce primary seed culture.

[0043] glycerol batch culture stage of strain The inoculum size was 10%, and the fermentation medium used was BSM medium, containing 4.5 mL PTM1 per liter of fermentation broth. The culture was carried out at 30℃, with a stirring speed of 300-950 rpm, pH=5.0, and an aeration rate of 2.0 vvm for about 12-16 hours, maintaining dissolved oxygen above 20%. The pH was adjusted to 5.0 using concentrated ammonia. glycerol fed culture stage When glycerol is depleted during fermentation and dissolved oxygen rises significantly to over 50%, the cell density is approximately 100 g / L. A 50 wt% glycerol aqueous solution (containing 12 mL / L PTM1) is added at a rate of 15 mL / h / L for 3.5 hours. Dissolved oxygen is maintained at 20-30% by coupling the rotation speed, pH is maintained at 5.0 by concentrated ammonia, and the temperature is controlled at 30℃.

[0044] starvation feeding stage Stop adding glycerol when OD600≈180 and continue adding glycerol until the glycerol in the culture medium is depleted; Methanol-induced expression stage Lower the temperature to 29°C and add methanol containing 14 mL / L PTM1 (2 ml per liter of fermentation broth) to the tank to allow the yeast to quickly adapt to methanol. After 1.5 h, add methanol containing 14 mL / L PTM1 at a flow rate of 2.5 ml / L / h for 2 h. Then, gradually increase the methanol addition flow rate according to the principle of not adding too much methanol, control the pH to 5.0, and maintain dissolved oxygen at 20-30% by coupling the rotation speed. Take a sample every 12 hours to test the wet weight. Fermentation ends after 72 h. The subsequent enzyme separation method is the same as in Example 3.

[0045] Example 5: Comparison of the relative enzyme activities of two FAD-GDH enzymes for different substrates Enzyme activity is defined as the amount of enzyme that causes the reduction of one micromole of DCPIP per minute under the conditions described below, as follows: Prepare the colorimetric solution in a brown bottle and store it on ice. The colorimetric solution formulation is as follows: 1M D-glucose / D-xylose solution: 5.9 ml; PIPES-NaOH buffer (50 mM PIPES-NaOH, 0.1% Triton X-100, pH 6.5): 20.5 ml; 48.0 mM PMS (dimethyl phenazine sulfate) solution: 2.0 ml; 3.0 mM DCPIP solution: 1.0 ml.

[0046] The purified enzyme was diluted to 0.1-0.2 U / ml with cold PIPES-NaOH buffer. In a test tube (tube 1), 3 ml of chromogenic solution was added, followed by 0.1 ml of enzyme dilution solution, and the mixture was gently inverted to mix. The spectrophotometer was zeroed with deionized water, and the reaction was carried out at 37°C for 3 minutes. The change in absorbance at 600 nm was recorded, with the change per minute recorded as OD1. In another test tube (tube 2), 0.1 ml of chromogenic solution was added, and the tube was incubated at 37°C. After recording the values ​​for tube 1, the decrease in absorbance at 600 nm in tube 2 was immediately measured over 3 minutes, with the change per minute recorded as OD2. The enzyme activity was calculated using the formula: (OD2 - OD1) * 1.85 * dilution factor. The substrates were glucose and xylose; the enzyme activity with glucose as the substrate was defined as 100%, and the relative enzyme activities with different substrates were compared.

[0047] Detection of FAD prosthetic group: The FAD-GDH enzyme solutions of WCG and WCG-0547-FAD were scanned across the entire wavelength range of 300 nm to 500 nm using a spectrophotometer. Two characteristic absorption peaks were observed in the FAD-GDH solution at approximately 385 nm and 454 nm, which are attributed to the FAD cofactor of the enzyme. 3 ml of the enzyme solution purified in Example 4 was diluted to the same concentration (1.1 mg / ml), and the FAD in the enzyme solution was then scanned across the entire wavelength range of 300-500 nm using a spectrophotometer.

[0048] In Example 3, different promoters were selected for the synthesis of FAD overexpression. 0547 was chosen as the promoter with the highest expression efficiency, and was ultimately selected as the promoter. The enzyme activities of glucose dehydrogenase obtained from WCG-0547-FAD and WCG strains were measured, and the results are shown in Table 1. Table 1 Comparison of enzyme activity between WCG-0547-FAD and FAD-GDH produced by WCG .

[0049] After introducing the FAD synthase gene and inducing FAD overexpression with methanol, the enzyme activity of the product FAD-GDH was significantly increased, by 226.15%. Furthermore, FAD not only promotes the increase in FAD-GDH enzyme activity, but it is also an essential substance for cell growth and reproduction. It participates in core energy metabolism, maintains redox balance, drives substance transformation, and regulates specific metabolic pathways, providing indispensable energy, raw materials, and a stable internal environment for cell proliferation. Simultaneously, using 0547 as the promoter, at the same time period, with the same initial cell concentration and the same amount of methanol added, WCG-0547-FAD showed a higher cell concentration than WCG after methanol induction. This indicates that the overexpression of the FAD prosthetic group improved the utilization rate of methanol by the cells to a certain extent, promoting cell growth and reproduction.

[0050] The enzyme activity of the glucose dehydrogenase obtained in Example 5 was measured, and the protein expression level was also determined. The results are as follows: Table 2 Comparison of FAD-GDH after high-density culture and purification in WCG and WCG-0547-FAD 5L fermenters .

[0051] Under the premise of keeping the protein concentrations of FAD and GDH the same, the characteristic peak of FAD was detected. Figure 2 The results showed that the two characteristic absorption peaks of FAD in FAD-GDH expressed by strain WCG-0547-FAD1 were significantly higher, suggesting that, for the same mass of enzyme protein, FAD-GDH expressed by strain WCG-0547-FAD1 had a higher FAD content than FAD-GDH expressed by strain WCGT. The results indicate that the increased specific enzyme activity is due to the increased FAD content in the enzyme protein complex.

[0052] The results show that by introducing the Pichia pastoris FAD synthase gene, overexpression of the FAD prosthetic group significantly improved the enzyme activity and specific enzyme activity of the expressed FAD-GDH during protein expression in Pichia pastoris. Compared with the original strain, the maximum increase in enzyme activity and specific enzyme activity of FAD-GDH was 144.8%, from 413.16 U / ml to 1011.33 U / ml, and the specific enzyme activity increased from 375.60 U / mg to 877.59 U / mg, an increase of 133.7%. Compared with the original strain WCG, the relative enzyme activity of xylose to glucose in FAD-GDH expressed by strain WCG-0547-FAD decreased from 10.2% to 7.6%, which to some extent improved the specificity of FAD-GDH and reduced its activity to xylose.

[0053] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications are possible without departing from the technical solutions described in the claims.

[0054] SEQ ID No. 1: ATGGTAACTGTTCTCTCCAATAGTAGTAAGCAGACCACACAGATTCAGCACAATCACAATATGATAAAAGACTCATTTCTCTCAGTGTGTGAACACAGCTATAACCTTATCACTGATTTTTTGAATGAGTCAGATCCTGAAAACGAACTTTTGACATCGACCCAGGAACAGGTCAGAAAATCCTATGACATACTCTTTGAATCTTTGAACTTGTACAAATTAGATGAACTATCAATATCATATAACGGCGGAAAAGACTGTCTTGTACTGCTGATCATTTACTTAGCAGTCATTTACGATAAATATCAAAACGAGTCGATACCAAGGGATTACAAATTAAACGCACTATACATCAAAAATGAGTCAATGTTCCAAGAACAGGACGATTTCATAAAAAAATCGGCGGCAAAATACCAGCTAAATCTACAGCCATTTAGAGACACTATGAAGAGAGCTCTCCACAAATATTTGGTACAAAACCCATGCATAAAAGCCGTCATTATAGGCATCAGAAGATGTGATCCATATGGTAAGGATTTACATTATTTACAAGAAACAGATCCAAGCTGGCCCCGGCTAATGCGGGTCAATCCGATTCTGGAATGGGATTACCACCAAATTTGGTTCTTCCTCCGTCATTTAAAAATAGAATACTGCAAGCTCTATGATATGGGCTATACTTCTCTGGGTGGTACCAACAACACTATTAAGAACCCTGACCTGCAGGACGGTGATGGCTATCTTCCTGCGTACTTGCTGGATGATTCCGAAAAGGAAAGATCCAGTAGATTATGA; 1000 bp upstream of Int1: (SEQ ID No.2); 1000 bp downstream of Int1: AGAAGTATGGACTTGAAGCGATGGTAGTTTTGTTGCCACCAACCTCTAGTTAGAATTACTGACTCATCTAGTTCAATAACACGTTACACAACCTTACCTAATCAAAAAAAAAGTGGCAACCAAGGACAACATGGTTAAAATGAATTCAAAAAAAGAAACAAAAATTCAAAATAAGACGCCCAGCTTTGAGAAAGCTACTCCTTTATTATGTTTTTGGTTTCCTGGTTTACTAGGCAGGTCAATCTTACAGGCAGATAAATCGTAGGTTTGTAACGACAAATTGCGAAGTCTATTACTTCAAGGCAGGGTGGAAAAGAAAACAATAATATATTTGCCTTCAGTCCAGAGAAACAATTACTTCCAAAATTGTCGAGCGGTGGGCGAAGTTTTGTGTCGGGCCATAAATCCAAAGAGCTGCAGAAGCATGCAAGTTGTGCATCAAGTATTGGGTTACCAAAAGTGGCTATGACCGCCCTTCGAAAAAAGAAACTCAATTTAGGAATTTCATTCCGGAGTACTGGAACGATACAGGGAAAAAATTAACCGAACCAAAACAAATCCACATGCAACCAATTCACTACTGTCCAGACCCTGACGTTGTTTCATTTTTTTTTTAGCAACCAGCTAACGATATTGAAACTAGGTAGTCAAATCTTCGTGATTCAGAGGAGAAAACACCTAGAAGACTAAGCTAAGATTTTGTATGTCTTGGTTGTCAAAAGCTCGGCTCTATAAGTACTAATATTCCATGTAAGATGTAAATAGGCATATACGCATGCATAATATTCGTGAAGAAAAAAGACTGCAGAAAGTGTCACATTTGAGATTTGTCGATGCACGCCTATATTGCTGTCCAGAATTTTCTGGTTTGTCAGCAACAAAACAACAGAATCAGCGTATTTGGGCATCTGGAAAGGCGAAGCATGTAGCTGACACATATGGGTGGTTAGAATGTTC (SEQ ID No.3); AOX1 promoter: GATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTGCCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACCCACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTAACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCCGCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAAACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGAAATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGCCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGCTCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGGGAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCTAACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACCTTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACGACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAG (SEQ ID No.4); 0547 Promoter: ATGTCAAGAAATTTTCAAACTGTTAAGAGAGGAGATAGATTCCCAACCGATGCTACAATGTTCCACATTCCATCATCTGGGGGTGGGCCAGCTCCTTTCAATTTGAGAGAGACCGTGCAAGGCAAGAGATTTATTGTCGTTGCCGCTCCAGGTGCTTTCACGAGTACCTGTCACGAGGAACATCTCCCACCATACATCAAGAACTTGCCAACTTTCTTGAAGAAGGGAATTGACTTCATCCTGGTGATCACTGCCAACGATGCATTCGTATTGAACTCATGGAAGAAGGCTCTGGGAGCCGATTCCGACAAGATCATCTTCGCTTCTGACACCAACTTGGAGCTGGCCAACAAGTTGGGACTGACCCTCGATCTGTCAGTTGCTGGACTGGGTCAAAGAACCGGAAGATTTGCCTTAATCGTTGGAAAAGACGGTGTGGTGCAAAACGTGTTTGCAGAGAAGGGCCCTGAGGTCAAGCATTCCTCCGCCGACAGGGTTCTAGCAAAGTTGTAA (SEQ ID No. 5); GAP Promoter: TTTTTGTAGAAATGTCTTGGTGTCCTCGTCCAATCAGGTAGCCATCTCTGAAATATCTGGCTCCGTTGCAACTCCGAACGACCTGCTGGCAACGTAAAATTCTCCGGGGTAAAACTTAAATGTGGAGTAATGGAACCAGAAACGTCTCTTCCCTTCTCTCTCCTTCCACCGCCCGTTACCGTCCCTAGGAAATTTTACTCTGCTGGAGAGCTTCTTCTACGGCCCCCTTGCAGCAATGCTCTTCCCAGCATTACGTTGCGGGTAAAACGGAGGTCGTGTACCCGACCTAGCAGCCCAGGGATGGAAAAGTCCCGGCCGTCGCTGGCAATAATAGCGGGCGGACGCATGTCATGAGATTATTGGAAACCACCAGAATCGAATATAAAAGGCGAACACCTTTCCCAATTTTGGTTTCTCCTGACCCAAAGACTTTAAATTTAATTTATTTGTCCCTATTTCAATCAATTGAACAACTAT (SEQ ID No.6); 0472 promoter:

Claims

1. A method for increasing the activity and specific activity of expressed FAD-GDH enzyme in Pichia pastoris, characterized in that, Includes the following steps: (1) Construct a recombinant plasmid containing the promoter and the Pichia pastoris FAD synthase gene, and construct a recombinant plasmid containing the Cas9 gene; (2) The recombinant plasmid containing the promoter and the Pichia pastoris FAD synthase gene and the recombinant plasmid containing the Cas9 gene were co-transformed into the host strain Pichia pastoris to obtain recombinant Pichia pastoris engineered strains that can overexpress the prosthetic group FAD. (3) The recombinant Pichia pastoris engineered strain was fermented, isolated and purified to obtain enzyme activity and FAD-GDH with higher enzyme activity.

2. The method according to claim 1, characterized in that, In step (1), the promoter is AOX1, 0547, GAP or 0472 promoter.

3. The method according to claim 1, characterized in that, In step (1), the recombinant plasmid containing the promoter and the Pichia pastoris FAD synthase gene is formed by linking the promoter and the Pichia pastoris FAD synthase gene to the donor plasmid Int1 vector.

4. The method according to claim 1, characterized in that, The Pichia pastoris FAD synthase gene is derived from Pichia pastoris strain GS115.

5. The method according to claim 1, characterized in that, In step (3), methanol is used to induce the expression of FAD-GDH during fermentation culture.

6. The method according to claim 1, characterized in that, The nucleotide sequence of the Pichia pastoris FAD synthase gene is shown in SEQ ID No.

1.

7. The method according to claim 3, characterized in that, The donor plasmid Int1 vector was constructed as follows: the homologous arm sequences 1000 bp upstream and 1000 bp downstream of the Int1 site in Pichia pastoris were cloned into the pUC19 plasmid vector using the Gibson assembly method; the homologous arm sequence 1000 bp upstream of the Int1 site is shown in SEQ ID No. 2, and the homologous arm sequence 1000 bp downstream of the Int1 site is shown in SEQ ID No.

3.

8. The method according to claim 1, characterized in that, In step (1), the recombinant plasmid containing the Cas9 gene is constructed by inserting sgRNA into the CRISPi plasmid. The sequence of the sgRNA is: TATCTGAAGTATTTACTGGG. The resistance gene on the CRISPi plasmid is bleomycin resistance.

Images