Application of mulberry MYB transcription factor wer in regulating synthesis of taxifolin

Abstract

This invention belongs to the field of plant genetic engineering technology, specifically relating to a mulberry MYB transcription factor. WHO Applications in regulating taxine synthesis. Mulberry MYB family. WHO The application of genes in regulating the biosynthesis of mulberry piperidine, the aforementioned WHO The gene sequence is shown in SEQ ID NO.1, and the application is achieved by upregulating... WHO The expression level of the gene promotes the accumulation of taxone, or may be achieved by knocking out... WHO Genes inhibit the accumulation of piperidine in mulberry plants. This invention is the first to reveal the MYB family genes in mulberry. WHO The novel function of this transcription factor has been identified, clarifying it as a key regulatory transcription factor in the mulberry taxane synthesis pathway, thus filling a gap in the understanding of mulberry taxane synthesis. WHO This study filled a technological gap in gene function research and the regulatory mechanism of taxine synthesis. Through cross-validation of overexpression and gene editing experiments, the results were reliable and the conclusions rigorous, overcoming the limitations of traditional single-method biochemical verification and providing a comprehensive technical system for gene function verification.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a mulberry MYB transcription factor. WER Applications of regulating the synthesis of piperidine. Background Technology

[0002] Mulberry is an important characteristic economic forest tree in my country, possessing multiple values ​​including medicinal use, feed use, and ecological restoration. Taxifolin is a high-value flavonoid bioactive secondary metabolite of mulberry, exhibiting extremely strong antioxidant, anti-inflammatory, hypoglycemic, and anti-tumor pharmacological activities. Mulberry trees with high taxifolin content are core materials for the breeding of medicinal mulberry varieties and the development of functional mulberry medicinal products. Therefore, identifying the key regulatory genes for taxifolin synthesis in mulberry and elucidating its molecular regulatory mechanism has significant application value for improving mulberry quality and innovating specialty mulberry germplasm.

[0003] MYB transcription factors are one of the largest transcription factor families in plants, and are widely involved in biological processes such as secondary metabolism synthesis, growth and development regulation, and stress response. Several members of the MYB family have been confirmed as core regulators of the plant flavonoid synthesis pathway. WER It is an important member of the MYB family. While some studies have shown its involvement in plant cell differentiation and root development regulation in model plants such as Arabidopsis thaliana, its biological functions in mulberry remain unclear, especially regarding mulberry. WER There are no reports or studies on the function and mechanism of gene regulation in the biosynthesis of the flavonoid taxine.

[0004] Existing research on mulberry secondary metabolism focuses only on structural genes of the flavonoid pathway, with a severe lack of key transcription factors regulating the upstream synthesis of taxine. This lack of target genes that can be directly used to directionally increase the taxine content of mulberry trees severely restricts the molecular breeding process for medicinal mulberries with high taxine content. To address this technical deficiency, this invention employs a two-way validation system of gene overexpression and CRISPR / Cas9 gene editing, and for the first time clearly identifies the target genes for mulberry trees with high taxine content. WER The gene positively regulates the synthesis of piperidine, filling a gap in existing technology. Summary of the Invention

[0005] To address the problems existing in the prior art, the purpose of this invention is to design and provide a mulberry MYB transcription factor. WER Technical solutions for regulating the synthesis of taxine.

[0006] The present invention is implemented using the following technical solutions: The first aspect of this invention provides the MYB family of mulberry trees. WER The application of genes in regulating the biosynthesis of mulberry piperidine, the aforementioned WER The gene sequence is shown in SEQ ID NO.1, and the application is achieved by upregulating... WERGene expression levels promote the accumulation of taxine.

[0007] The second aspect of the present invention provides a method comprising the above. WER Gene overexpression vectors.

[0008] A third aspect of the present invention provides engineered bacteria comprising the above-described overexpression vector.

[0009] The fourth aspect of the present invention provides a knockout WER The gene's sgRNA CRISPR vector contains two specific sgRNAs, the sequences of which are shown in SEQ ID NO.4-5.

[0010] The fifth aspect of this invention provides the application of overexpression vectors, engineered bacteria, or sgRNA CRISPR vectors in regulating the biosynthesis of mulberry fighin.

[0011] The sixth aspect of this invention provides a method for cultivating mulberry germplasm with high piperidine content, comprising the following steps: S.1 Cloned Mulberry Tree WER Genes, the ones mentioned WER The nucleotide sequence of the gene is shown in SEQ ID NO.1; S.2 construction includes WER Gene overexpression vectors; S.3 will include WER Transforming mulberry trees with gene overexpression vectors, identifying transgenic plants, and cultivating them yields transgenic mulberry germplasm with high levels of piperidine.

[0012] Furthermore, the overexpression vector in S.2 is... pCAMBIA1300 .

[0013] Furthermore, S.3 will include WER The overexpression vector transformation of mulberry trees specifically involves: converting mulberry trees containing... WER Gene overexpression vectors were transformed into Agrobacterium K599 competent cells, and Agrobacterium infection was used to transform the roots of sterile mulberry seedlings.

[0014] The seventh aspect of this invention provides a method for increasing the accumulation of piquicin in mulberry trees by overexpressing it in mulberry trees. WER Genes, the ones mentioned WER The gene sequence is shown in SEQ ID NO.1.

[0015] The eighth aspect of the present invention provides a method for reducing the accumulation of tuftine in mulberry trees by knocking out tuftine in mulberry trees. WER Genes, the ones mentioned WER The gene sequence is shown in SEQ ID NO.1.

[0016] The present invention has the following beneficial effects: (1) This invention reveals for the first time the MYB family genes of mulberry. WER The novel function of this transcription factor has been identified, clarifying it as a key regulatory transcription factor in the mulberry taxane synthesis pathway, thus filling a gap in the understanding of mulberry taxane synthesis. WER There is a technological gap in gene function research and the regulatory mechanism of taxine synthesis.

[0017] (2) This invention uses overexpression and gene editing bidirectional genetic experiments to verify each other. The experimental results are reliable and the conclusions are rigorous, breaking through the limitations of traditional single biochemical verification and providing a complete technical system for gene function verification.

[0018] (3) The present invention provides WER The gene can serve as a core target gene for improving the trait of mulberry taxane synthesis. It can be directly applied to the molecular breeding of new varieties of medicinal mulberry with high flavonoid content and functional mulberry, which can significantly increase the taxane content of mulberry and enhance the medicinal and economic value of mulberry.

[0019] (4) The regulatory mechanism of taxonomic pine resin synthesis elucidated in this invention provides a new theoretical basis for the study of the regulatory network of taxonomic pine resin secondary metabolism in plants and provides a reference for the quality improvement of other forest crops. Attached Figure Description

[0020] Figure 1 Mulberry tree WER Identification results of roots with positive gene overexpression.

[0021] Figure 2 for WER Comparison of piperidine content between overexpressing mulberry plants and control group plants.

[0022] Figure 3 for WER CRISPR / Cas9 gene editing status.

[0023] Figure 4 for WER Comparison of piperidine content between gene knockout mutants and wild-type mulberry plants. Detailed Implementation

[0024] The following specific embodiments illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that, unless otherwise specified, the following embodiments and features can be combined with each other. Unless otherwise specified, the methods used in the embodiments of the present invention are conventional methods, and the reagents used are commercially available.

[0025] Regarding the existing technology of mulberry trees WER To address the technical deficiencies of unknown gene function, lack of upstream regulatory genes for flavonoid synthesis, and missing molecular breeding targets for high-flavonoid mulberry trees, this invention provides MYB family genes for mulberry trees. WER A novel application of piperidin, a flavonoid compound in mulberry, was explored. Its function was verified through two-way genetic modification, providing core gene resources and technical solutions for the targeted improvement of mulberry flavonoid traits and the breeding of new varieties.

[0026] Example 1: Mulberry tree WER Construction of gene overexpression vectors and acquisition of positive root plants (1) Mulberry tree WER Gene cloning: Total RNA was extracted from wild-type mulberry roots, and cDNA was obtained through reverse transcription. Using the cDNA as a template, gene cloning was performed based on the mulberry tree... WER Specific amplification primers were designed based on the conserved gene sequence, as shown in SEQ ID NO.2-3 (F: ATGGAAGAGATTATATCTT; R: CGTCTACCAAAAAGTCGTTTGAGA). PCR amplification yielded the complete gene sequence. WER The gene coding region sequence, the WER The gene is shown in SEQ ID NO.1.

[0027] (2) Construction of overexpression vector: The amplified vector was constructed... WER Gene fragments are ligated into plant universal overexpression vectors ( pCAMBIA1300 A 35S::WER overexpression recombinant vector was constructed, transformed into E. coli competent cells, positive clones were screened, and sequencing was used to verify the successful construction of the vector.

[0028] (3) Genetic transformation of mulberry roots: The recombinant overexpression vector was transformed into Agrobacterium K599 competent cells, and the roots of sterile mulberry seedlings were transformed by Agrobacterium infection method. After being cultured in the dark for 2-3 days, they were transferred to the screening medium for resistance screening.

[0029] (4) Identification of positive plants: A dual identification method was used, combining PCR molecular detection with rapid detection using transgenic CP4 EPSPS test strips, to screen plants. WER Gene overexpression in mulberry root systems was used to identify resistant mulberry plants. Genomic DNA was first extracted from the roots of resistant mulberry trees and molecularly identified by gene-specific PCR amplification (94℃, 2 min; 98℃, 10 s; 58℃, 30 s; 68℃, 30 s, 32 cycles; 68℃, 10 min; 4℃, hold). Simultaneously, rapid protein detection was performed on resistant plants using CP4 test strips. The appearance of a specific positive band on the test strip indicated a transgenic positive plant. This dual detection method corroborated the results, ensuring accurate and reliable screening. Further analysis of the plant roots was conducted using qRT-PCR. WER Gene transcription level (95 ℃, 5 min; 95 ℃, 10 s; 60 ℃, 20 s; 72 ℃, 20 s, 40 cycles; 95 ℃, 15 s; 60 ℃, 1 min; slowly increase temperature to 95 ℃ (0.3-0.5 ℃ / s, continuous fluorescence sampling); 4 ℃, hold).

[0030] The results showed that the roots of the successfully identified positive plants contained... WER Gene expression levels were significantly higher in mulberry trees than in the control group, confirming the acquisition of stable gene expression. WER Mulberry root plants with gene overexpression.

[0031] The results showed that the transgenic CP4 EPSPS rapid test strip was effective against wild-type WT and three strains. WER Initial screening was performed using overexpression in mulberry roots; only the control line was observed in WT, and 3 OE- WER All strains showed specific chromogenic bands, initially indicating transgene positivity. Genomic PCR results showed no amplification band in WT, while all three overexpression lines amplified bands similar to those observed in other strains. WER The presence of specific bands matching the expected fragment size confirmed the integration of the exogenous target gene into the plant genome. In the qRT-PCR quantitative experiment, using CP4 from mulberry roots transformed with an empty vector as a control indicated that... MaActin For internal reference, WT root system WER Extremely low background expression, 3 OE- WER The relative expression level of genes in the strain was significantly higher than that in the control group. Figure 1 The triple identification results corroborated each other, successfully achieving stable genome integration and efficient root overexpression. WER Transgenic mulberry lines.

[0032] Example 2: Mulberry tree WER Construction of CRISPR / Cas9 gene editing vectors and obtaining plants (1) sgRNA design: based on mulberry tree WER genomeTwo specific sgRNAs were designed from conserved regions of gene exons, as shown in SEQ ID NO.4-5 (sgRNA-1: CTCCAAAGAATTCATGACGATGG; sgRNA-2: AGAGAAGTGGTAAGAGTTGTAGG), to ensure the specificity and effectiveness of targeted editing.

[0033] (2) Construction of gene editing vector: The designed sgRNA sequence was integrated into the CRISPR / Cas9 plant editing vector (pYLCRISPR-Cas9P). 35S ), construct mulberry tree WER Gene-specific editing vector, sequencing verification confirmed the correctness of the vector sequence.

[0034] (3) The editing vector was transformed into the roots of sterile mulberry seedlings using Agrobacterium-mediated transformation, and transgenic roots were obtained through resistance screening. Genomic DNA was extracted from the roots, and the editing sites were amplified by PCR and sequenced (94℃, 2 min; 98℃, 10 s; 58℃, 30 s; 68℃, 30 s, 32 cycles; 68℃, 10 min; 4℃, hold), and transgenic roots were obtained through screening. WER Homozygous gene-edited plants.

[0035] For mulberry trees WER Two targeting sgRNAs were designed from the gene exon region to construct pYLCRISPR-Cas9P. 35S The -N dual-target editing vector carries U3b and U6-29 promoters to drive sgRNA expression, respectively. It is effective against wild-type WT and gene-edited strains. wer #1 wer #2 Target site sequencing verification: WT target sequence is complete and without mutation; wer #1 wer #2 are both homozygous bis-allelic mutants. wer #1 has a single base deletion. wer #2 contains base substitutions and deletions; sequencing peaks and sequence alignment confirm stable gene editing at the target site. Figure 3 This result demonstrates that the dual sgRNA CRISPR vector can be targeted for knockout. WER They successfully obtained homozygous knockout mutant mulberry root systems.

[0036] Example 3: WER Detection of Taxostatin Content in Genetically Modified Roots This embodiment uniformly addresses... WER overexpression of genes in mulberry positive roots WER Quantitative detection of piperidine in CRISPR / Cas9 knockout mutant mulberry roots was performed, with wild-type mulberry roots used as a blank control. WERThe regulatory role of gene expression levels in the biosynthesis of taxanein. Root samples from mulberry plants with uniform growth and culture conditions were selected for all experimental groups, with three biological replicates per group to ensure accurate and reliable experimental data.

[0037] The extraction and detection methods for flavonoids were based on previously reported literature and appropriately optimized. The specific steps are as follows: 1.00 g of fresh mulberry root sample was accurately weighed and ground into a fine powder using liquid nitrogen. The powder was placed in a centrifuge tube, and 5 mL of 70% (v / v) methanol aqueous solution was added and thoroughly mixed. The mixture was ultrasonically extracted at room temperature for 30 min, then allowed to stand for 2 h. This extraction was repeated twice to ensure complete dissolution of metabolites. The extract was centrifuged at 12000 rpm for 5 min, and the supernatant was collected. After filtration through a 0.22 μm organic phase filter membrane, the extract was loaded into an LC-MS sample vial for analysis.

[0038] Quantitative analysis of flavonoids was performed using a SCIEX Triple Quad 5500+ triple quadrupole liquid chromatography-mass spectrometry (LC-MS / MS) system. An Agilent ZORBAX Eclipse Plus C18 reversed-phase column was used. Mobile phase A was 0.1% (v / v) formic acid aqueous solution, and mobile phase B was 0.1% (v / v) formic acid acetonitrile solution. The flow rate was constant at 0.35 mL / min. -1 Gradient elution program: 0–1.00 min, 90% A, 10% B; 1.00–9.00 min, linear gradient to 30% A, 70% B; 9.00–12.50 min, linear gradient to 5% A, 95% B; 12.50–13.50 min, maintain 5% A, 95% B; 13.50–13.60 min, rapidly recover to 90% A, 10% B; 13.60–15.00 min, maintain initial proportions to balance the column.

[0039] Mass spectrometry employs multiple reaction monitoring (MRM) mode to acquire signals, enhancing detection specificity and sensitivity. Quantification is performed using the external standard method, with a standard curve established by preparing gradient solutions of Aladdin flavonoid standards. The relative content of each component is calculated based on the chromatographic peak areas of the corresponding flavonoid components in the sample.

[0040] Experimental results show that WER Overexpression (OE-) WER The content of taxonomic acid in mulberry roots was significantly increased. In the control group (CP4), taxonomic acid levels in roots were low, indicating overexpression. WER The content of the aforementioned flavonoid metabolites in the hindroot system was significantly increased, and the trend was consistent among the strains within the group. Figure 2 The corresponding CRISPR / Cas9 gene-edited plants showed a decrease in piperidine content. Figure 4 The results showed that root overexpression WERIt can significantly activate the mulberry taxine synthesis pathway and greatly promote the accumulation of taxine substances, providing a basis for the creation of high-taxine mulberry germplasm.

Claims

1. Mulberry MYB family WER The application of genes in regulating the biosynthesis of mulberry piperidine is characterized by, The WER The gene sequence is shown in SEQ ID NO.1, and the application is achieved by upregulating... WER Gene expression levels promote the accumulation of taxine.

2. Containing the claims of claim 1 WER Gene overexpression vectors.

3. Engineered bacteria containing the overexpression vector as described in claim 2.

4. A knockout method WER The sgRNA CRISPR vector of the gene is characterized by, The sgRNA CRISPR vector contains two specific sgRNAs, the sequences of which are shown in SEQ ID NO.4-5.

5. The application of the overexpression vector as described in claim 2, the engineered bacteria as described in claim 3, or the sgRNA CRISPR vector as described in claim 4 in regulating the biosynthesis of mulberry tataric acid.

6. A method for cultivating mulberry germplasm with high piperidine content, characterized in that, Includes the following steps: S.1 Cloned Mulberry Tree WER Genes, the ones mentioned WER The nucleotide sequence of the gene is shown in SEQ ID NO.1; S.2 construction includes WER Gene overexpression vectors; S.3 will include WER Transforming mulberry trees with gene overexpression vectors, identifying transgenic plants, and cultivating them yields transgenic mulberry germplasm with high levels of piperidine.

7. The method as described in claim 6, characterized in that, The overexpression vector mentioned in S.2 is pCAMBIA1300 .

8. The method as described in claim 6, characterized in that, S.3 will include WER The overexpression vector transformation of mulberry trees specifically involves: converting mulberry trees containing... WER Gene overexpression vectors were transformed into Agrobacterium K599 competent cells, and Agrobacterium infection was used to transform the roots of sterile mulberry seedlings.

9. A method for increasing the accumulation of piperidine in mulberry trees, characterized in that, Overexpression in mulberry WER Genes, the ones mentioned WER The gene sequence is shown in SEQ ID NO.

1.

10. A method for reducing the accumulation of piperidine in mulberry trees, characterized in that, Knock out of the mulberry tree WER Genes, the ones mentioned WER The gene sequence is shown in SEQ ID NO.1.

Images