Application of sox9 gene and sgRNA for targeting knockout of goat sox9 gene and application

Abstract

This invention belongs to the field of genetic engineering technology and provides... SOX9 Applications of genes and targeted knockout goats SOX9 Gene sgRNA and its applications. This invention utilizes CRISPR / Cas9 system-mediated knockout technology to provide a targeted knockout method for goat genes. SOX9 The sgRNA of the gene, which can specifically recognize and cleave goat genes. SOX9 Flanking sites of the gene enable the control of goats SOX9 Gene knockout. The research in this invention can be used to analyze... SOX9 Genes are involved in the molecular regulatory mechanisms of goat sex determination and gonadal development, and can also alleviate or even overcome the genetic defects of goat hornless intersex syndrome, creating superior dairy goat germplasm resources with hornless gonads and normal gonadal development. Therefore, this invention has extremely high scientific research value and industrial application prospects.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving SOX9 Applications of genes and targeted knockout goats SOX9 sgRNA of genes and their applications. Background Technology

[0002] Polled is a crucial economic trait in dairy goat breeding. In large-scale farming, horned goats are prone to fighting, leading to udder and body surface injuries, increasing veterinary costs and mortality. Furthermore, horned goats require greater spacing and specialized dehorning procedures, increasing management difficulty and labor intensity. Therefore, horned goats offer significant advantages in husbandry and management. For a long time, dairy goat breeders have focused on developing horned breeds to reduce the stress and management costs associated with dehorning. However, in goats, the horned trait is linked to the intersex trait, a condition known as Polled Intersex Syndrome (PIS). Intersex goats typically lack normal reproductive capacity. Traditional breeding relies on phenotypic selection, making it difficult to distinguish between normal horned individuals and those at risk of PIS in the early stages. The high proportion of intersex individuals leads to the elimination of a large number of breeding materials, hindering the breeding progress and population expansion of horned dairy goats.

[0003] In the conventional breeding of female hornless goats, intersex individuals are easily produced. In order to avoid the risk of genetic defects such as female hornless-intersex syndrome, it is urgent to develop a method that can mitigate or even overcome this genetic defect. Summary of the Invention

[0004] The purpose of this invention is to provide SOX9 Applications of genes and targeted knockout goats SOX9 sgRNA of the gene and its applications. Knockout of the described gene. SOX9 Genes can mitigate or even overcome the genetic defects of hornless-intersex syndrome in goats, thus accelerating the breeding process of hornless dairy goats.

[0005] This invention provides goats SOX9 Applications of genes, including any one or more of the following: (1) Application in breeding hornless female goat breeds with normal gonadal development; (2) Application in the preparation of drugs for treating genetic defects in interhormonal syndrome; The SOX9 The gene's Gene ID in NCBI is 106503295.

[0006] This invention also provides a set of targeted knockout goats. SOX9The sgRNA of the gene, wherein the sgRNA includes sgRNA-1 or sgRNA-5; The nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO:4; The nucleotide sequence of the sgRNA-5 is shown in SEQ ID NO:6; The SOX9 The gene's Gene ID in NCBI is 106503295.

[0007] This invention also provides a targeted knockout goat SOX9 Gene editing vectors, wherein the gene editing vectors include sgRNA and a base vector as described above.

[0008] As a preferred embodiment, the base carrier includes a pX330 carrier.

[0009] This invention also provides a targeted knockout goat SOX9 A recombinant cell line containing a gene editing vector as described above.

[0010] As a preferred embodiment, the basal cells of the recombinant cell line include interstitial goat embryonic fibroblasts.

[0011] This invention also provides applications of the sgRNA, the gene editing vector, or the recombinant cell line, wherein the applications include any one or more of the following: (1) Application in breeding hornless female goat breeds with normal gonadal development; (2) Application in the preparation of drugs for treating genetic defects in interhormonal syndrome; (3) In the analysis SOX9 Application of genes in the molecular regulatory mechanism of sex determination in goats; (4) In the analysis SOX9 Application of genes in the molecular regulatory mechanisms of gonadal development in goats.

[0012] This invention also provides a method for breeding a hornless female goat breed with normal gonadal development, comprising the following steps: knocking out the target female goat... SOX9 The SOX9 gene was used to obtain a hornless female goat breed with normal gonadal development; the SOX9 gene has a Gene ID of 106503295 in NCBI.

[0013] This invention also provides a goat cell model for overcoming the genetic defects of interhornless syndrome, wherein the goat cell model contains... SOX9 The gene was knocked out; SOX9 The gene's Gene ID in NCBI is 106503295.

[0014] This invention also provides a drug for treating the genetic defect of interhornless syndrome, including knockout goats. SOX9 Gene reagents; said reagents include knockout goats SOX9 The sgRNA of the gene; the knockout goat SOX9 The sgRNA of a gene includes sgRNA-1 or sgRNA-5; The nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO:4; The nucleotide sequence of the sgRNA-5 is shown in SEQ ID NO:6; The SOX9 The gene's Gene ID in NCBI is 106503295.

[0015] Beneficial effects: This invention provides goat SOX9 The application of the gene includes any one or more of the following: (1) its application in breeding female hornless goats with normal gonadal development; (2) its application in preparing a drug for treating genetic defects in hornless intersex syndrome; SOX9 The gene's Gene ID in NCBI is 106503295. Knockout, knockdown, suppression, or interference are described. SOX9 Genetic modification can mitigate or even overcome the genetic defects of hornless intersex syndrome in goats, creating superior dairy goat germplasm resources with hornless gonads and normal gonadal development, accelerating the breeding process of female hornless goat breeds with normal gonadal development, and reducing breeding costs. Simultaneously, knockout, knockdown, suppression, or interference... SOX9 The cell line of the gene can be analyzed SOX9 This invention explores the molecular regulatory mechanisms of genes in goat sex determination and gonadal development. Therefore, it provides crucial theoretical basis and technical support for the breeding of new hornless dairy goat breeds, the innovation of germplasm resources, and the construction of a molecular breeding system for goat sex regulation, possessing extremely high scientific research value and promising industrial application prospects. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 A schematic diagram illustrating the design results for sgRNA targets; Figure 2The image shows the agarose gel electrophoresis results for fetal sheep genotyping. M represents the 2000bp DNA marker. Lanes 1-4, 6-9, and 11-14 are the sample numbers for different genotypes of fetuses. Lanes 5, 10, and 15 are blank controls. Lanes 3, 8, and 13 are irrelevant samples and are not included in the analysis. Lanes 4, 9, and 14 are the target embryo samples from female hornless homozygous goats. Figure 3 The sequencing peak diagram of recombinant plasmid 1 shows a double peak near the target site. Figure 4 The sequencing peak diagram is for recombinant plasmid 3; Figure 5 The sequencing peak diagram of recombinant plasmid 5 shows a double peak near the target site. Figure 6 Nine groups of monoclonal cell PCR were performed, with M representing a 2000 bp DNA marker; lanes 1-9 represent four monoclonal clones (i.e., 1-1, 1-2, 1-3, 1-4) from recombinant plasmid 1 and five monoclonal clones (i.e., 5-1, 5-2, 5-3, 5-4, 5-5) from recombinant plasmid 5, respectively; lane 10 is the positive control for recombinant plasmid 1 DNA; lane 11 is the blank control; Figure 7 The image shows the PCR sequencing results of 1-1 monoclonal cells; the sequencing peak diagram shows that the 1-1 monoclonal cells derived from recombinant plasmid 1 exhibit a distinct double peak near the target site. Figure 8 The image shows the PCR sequencing results of 1-2 monoclonal cells; the sequencing peak diagram shows that 1-2 monoclonal cells derived from recombinant plasmid 1 exhibit a distinct double peak near the target site. Figure 9 Figure 1-3 shows the PCR sequencing results of monoclonal cells; Figure 10 The image shows the PCR sequencing results of monoclonal cells 1-4; the sequencing peak diagram shows that monoclonal cells 1-4 derived from recombinant plasmid 1 exhibit a distinct double peak near the target site. Figure 11 This is a diagram showing the PCR sequencing results of 5-1 monoclonal cells; Figure 12 The image shows the PCR sequencing results of 5-2 monoclonal cells; the sequencing peak diagram shows that the 5-2 monoclonal cells derived from recombinant plasmid 5 exhibit a distinct double peak near the target site. Figure 13 The image shows the PCR sequencing results of 5-3 monoclonal cells; Figure 14 The image shows the PCR sequencing results of 5-4 monoclonal cells; the sequencing peak diagram shows that the 5-4 monoclonal cells derived from recombinant plasmid 5 exhibit a distinct double peak near the target site. Figure 15 The image shows the PCR sequencing results of 5-5 monoclonal cells; Figure 16 The image shows the agarose gel electrophoresis results of 75 single colonies. Lanes 1-75 represent 75 single clonal colonies (i.e., lanes 1-15 are 15 single colonies selected from 1-1, labeled 1-1-1, 1-1-2, 1-1-3, and so on; lanes 16-30 are 15 single colonies selected from 1-2, labeled 1-2-1, 1-2-2, 1-2-3, and so on; lanes 31-45 are single colonies selected from 1-4, labeled 1-4-1, 1-4-2, 1-4-3 ... 4-2, 1-4-3, and so on; 46~60 are single colonies selected from 5-2, namely 5-2-1, 5-2-2, 5-2-3, and so on; 60~75 are single colonies selected from 5-4, namely 5-4-1, 5-4-2, 5-4-3, and so on. 1-1, 1-2, 1-4, 5-2, and 5-4 are the five groups of single clones in step 2 of Example 3; lane 76 is the recombinant plasmid 1 DNA positive control; lane 77 is the blank control. Detailed Implementation

[0018] This invention provides goats SOX9 The application of the gene includes any one or more of the following: (1) its application in breeding female hornless goats with normal gonadal development; (2) its application in preparing a drug for treating genetic defects in hornless intersex syndrome; as a specific implementation, the SOX9 The gene has a Gene ID of 106503295 in NCBI, referring to the goat. SOX9 The gene sequence is shown in Genbank (NC_030826.1) on NCBI. Knockout, knockdown, suppression, or interference were performed. SOX9 Genetic modification can mitigate or even overcome the genetic defects of hornless intersex syndrome in goats, creating superior dairy goat germplasm resources with hornless gonads and normal gonadal development, accelerating the breeding process of female hornless goat breeds with normal gonadal development, and reducing breeding costs. Simultaneously, knockout, knockdown, suppression, or interference... SOX9 The cell line of the gene can be analyzed SOX9 Molecular regulatory mechanisms of genes in sex determination and gonadal development in goats.

[0019] This invention also provides a set of targeted knockout goats. SOX9 The sgRNA of the gene, wherein the sgRNA includes sgRNA-1 or sgRNA-5.

[0020] In one specific embodiment, the nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO:4: 5'-GCGTACTGCGCGCGCGTGATGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCA-3'; in one specific embodiment, the sgRNA-1 targets goats SOX9 The third exon region of the gene. In one specific implementation, the sgRNA-1 consists of 101 nucleotides, of which the 20-nt RNA fragment at the 5' end can recognize a specific DNA sequence on the chromosome, and the remaining 81 nt is called the backbone RNA fragment. In one specific implementation, the specific DNA sequence is target 1, and the nucleotide sequence of target 1 is shown in SEQ ID NO:1: 5'-TCGTACTGCGCGCGCGTGATGGG-3'. In one specific implementation, the sgRNA-1 can guide the Cas9 protein to create a DNA double-strand break at the target site. The cell utilizes its own repair function to introduce random base insertions or deletions at the break site, thereby leading to… SOX9 A frameshift mutation occurs in the gene coding frame, achieving SOX9 Gene knockout.

[0021] In one specific embodiment, the nucleotide sequence of the sgRNA-5 is shown in SEQ ID NO:6: 5'-GTTGATGTGCGTTCGCTGCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGTTCA-3'. In another specific embodiment, the sgRNA-5 targets goats. SOX9 The third exon region of the gene. In one specific implementation, sgRNA-5 consists of 101 nucleotides, of which the 20-nt RNA fragment at the 5' end can recognize a specific DNA sequence on the chromosome, and the remaining 81 nt is called the backbone RNA fragment. In one specific implementation, the specific DNA sequence is target 5, and the nucleotide sequence of target 5 is shown in SEQ ID NO:3: 5'-CTTGATGTGCGTTCGCTGCGCGG-3'. In one specific implementation, sgRNA-5 can guide the Cas9 protein to create a DNA double-strand break at the target site. The cell utilizes its own repair function to introduce random base insertions or deletions at the break site, thereby leading to... SOX9 A frameshift mutation occurs in the gene coding frame, achieving SOX9Gene knockout.

[0022] The sgRNA provided by this invention, combined with the genome-targeting modification technology of the CRISPR-Cas9 system, can efficiently and specifically mediate the modification of goat genomes. SOX9 Gene deletion is performed. This invention does not specifically limit the CRISPR-Cas9 system; any commonly used CRISPR-Cas9 system in the art can be used. CRISPR-Cas9 is a functional molecular system composed of Cas9 protein and sgRNA. In this invention, the pX330 vector carries the Cas9 expression element. After sgRNA is linked to the pX330 vector, transfection of host cells results in the expression of Cas9 protein and sgRNA, thereby constructing an active CRISPR-Cas9 editing system. Examples of this invention show that the knockout efficiency of sgRNA-1 can reach 92%, and the knockout efficiency of sgRNA-5 can reach 100%. This indicates that the sgRNA provided by this invention, combined with the genome-targeting modification technology of the CRISPR-Cas9 system, can efficiently and specifically mediate gene deletion in goats. SOX9 Gene deletion. It is well known in the art that different gene regulation methods have varying effects on gene expression levels. Even with CRISPR technology, sgRNAs designed for different target sequences have different interference capabilities and effects on cell viability. Not just any sgRNA can effectively knock out gene expression in host cells without affecting normal cell characteristics. SOX9 Gene.

[0023] This invention also provides a targeted knockout goat SOX9 A gene editing vector, comprising sgRNA and a base vector as described above. In one specific embodiment, the base vector includes the pX330 vector. In a specific embodiment of the present invention, the gene editing vector includes the pX330-sgRNA-1 gene editing vector or the pX330-sgRNA-5 gene editing vector.

[0024] This invention does not specifically limit the construction method of the gene editing vector; any commonly used construction method in the art can be used. In a specific embodiment of this invention, the gene editing vector is constructed using a double enzyme digestion-ligation method. As a specific implementation, the double enzyme digestion-ligation method includes the following steps: digesting the pX330 vector with AscI and AarI to obtain a pX330 linearized vector; ligating the sgRNA to the pX330 linearized vector using T4 DNA ligase to obtain the gene editing vector. When the sgRNA is sgRNA-1, the obtained gene editing vector is pX330-sgRNA-1; when the sgRNA is sgRNA-5, the obtained gene editing vector is pX330-sgRNA-5.

[0025] This invention also provides a targeted knockout goat SOX9 A recombinant cell line containing the gene editing vector as described above. In one specific embodiment, the basal cells of the recombinant cell line include interstitial goat embryonic fibroblasts. In a specific embodiment of the present invention, the recombinant cell line includes interstitial goat embryonic fibroblasts containing the pX330-sgRNA-1 gene editing vector or interstitial goat embryonic fibroblasts containing the pX330-sgRNA-5 gene editing vector.

[0026] This invention does not specifically limit the construction method of the recombinant cell line; any construction method commonly used in the art can be used. In a specific embodiment of this invention, the gene editing vector is transfected into interstitial goat embryonic fibroblasts by electroporation to obtain the recombinant cell line. As a specific implementation method, the electroporation can be performed using a mammalian fibroblast transfection kit, and the specific operation is performed according to the kit's instructions. In a specific embodiment of this invention, the mammalian fibroblast transfection kit was purchased from Amaxa, catalog number VPI-1002.

[0027] This invention also provides applications of the sgRNA, the gene editing vector, or the recombinant cell line, wherein the applications include any one or more of the following: (1) Application in breeding hornless female goat breeds with normal gonadal development; (2) Application in the preparation of drugs for treating genetic defects in interhormonal syndrome; (3) In the analysis SOX9 Application of genes in the molecular regulatory mechanism of sex determination in goats; (4) In the analysis SOX9 Application of genes in the molecular regulatory mechanisms of gonadal development in goats.

[0028] This invention also provides a method for breeding a hornless female goat breed with normal gonadal development, comprising the following steps: knocking out the target female goat... SOX9 Genes were used to obtain a breed of hornless female goats with normal gonadal development; SOX9 The gene's Gene ID in NCBI is 106503295.

[0029] This invention does not specifically limit the knockout method; any method commonly used in the art can be employed. In a specific embodiment of this invention, CRISPR / Cas9 system-mediated knockout technology was used. SOX9 Gene knockout. This invention designs a group of targeted knockout goats. SOX9The gene contains sgRNA, including sgRNA-1 or sgRNA-5; the nucleotide sequence of sgRNA-1 is shown in SEQ ID NO:4; the nucleotide sequence of sgRNA-5 is shown in SEQ ID NO:6. After obtaining the sgRNA, this invention ligates sgRNA-1 to the pX330 vector using a double enzyme digestion-ligation method to obtain the pX330-sgRNA-1 gene editing vector; sgRNA-5 is ligated to the pX330 vector using the same method to obtain the pX330-sgRNA-5 gene editing vector. The specific steps of the double enzyme digestion-ligation method are as described above and will not be repeated here. After obtaining the gene editing vector, this invention transfects the gene editing vector into interstitial goat embryonic fibroblasts using electroporation to obtain the recombinant cell line. The specific steps of the electroporation are as described above and will not be repeated here. After obtaining the recombinant cell line, positive monoclonal cells are screened from the recombinant cell line. After in vitro embryo culture, qualified embryos are transferred into surrogate ewes. The ewes become pregnant and give birth, ultimately obtaining a female hornless goat breed with normal gonadal development. This invention does not specifically limit the specific operation method of knockout. The description of the knockout method is only intended to illustrate the technical concept and implementation path of this invention to ensure the clarity and completeness of the technical solution. For those skilled in the art, other commonly used knockout methods in the field can be used for conventional substitution.

[0030] This invention also provides a goat cell model for overcoming the genetic defects of interhornless syndrome, wherein the goat cell model contains... SOX9 The gene was knocked out; SOX9 The gene's Gene ID in NCBI is 106503295. As a specific implementation, the basal cells of the goat cell model include intercalary goat embryonic fibroblasts. This invention does not specifically limit the construction method of the goat cell model; any commonly used construction method in the art can be used. In a specific embodiment of this invention, the gene editing vector is transfected into intercalary goat embryonic fibroblasts by electroporation to obtain the goat cell model. As a specific implementation, the electroporation can be performed using a mammalian fibroblast transfection kit; specific operations are performed according to the kit's instructions. In a specific embodiment of this invention, the mammalian fibroblast transfection kit was purchased from Amaxa, catalog number VPI-1002. The cell model of this invention can target the goat genome... SOX9 Research on the functions of gene knockout, such as studying the regulatory mechanisms of goat sex determination and gonadal development, can provide a theoretical basis for mitigating or even overcoming the harm of hornless-intersex syndrome and obtaining hornless dairy goat germplasm with normal gonadal development, making an important contribution to related research.

[0031] This invention also provides a drug for treating the genetic defect of interhornless syndrome, including knockout goats. SOX9 Gene reagents; said reagents include knockout goats SOX9 The sgRNA of the gene; the knockout goat SOX9 The gene's sgRNA includes sgRNA-1 or sgRNA-5; the nucleotide sequence of sgRNA-1 is shown in SEQ ID NO:4; the nucleotide sequence of sgRNA-5 is shown in SEQ ID NO:6; SOX9 The gene's Gene ID in NCBI is 106503295.

[0032] To further illustrate the present invention, the following description, in conjunction with embodiments, explains the features provided by the present invention. SOX9 Applications of genes and targeted knockout goats SOX9 The sgRNA of the gene and its applications are described in detail, but they should not be construed as limiting the scope of protection of this invention.

[0033] Unless otherwise specified, the present invention does not have special requirements for the raw materials used in the preparation, and commercially available products well known to those skilled in the art can be used.

[0034] In the following embodiments of the present invention, unless otherwise specified, cells were cultured in DMEM / F12 medium containing 1% PS and 10% FBS. pX330-sgRNA-1, pX330-sgRNA-3, and pX330-sgRNA-5 were all synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0035] Unless otherwise specified, the test methods used in the following examples are conventional test methods; the materials and reagents used are commercially available unless otherwise specified.

[0036] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments thereof.

[0037] Example 1 1. sgRNA target design According to the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), Genbank: NC_030826.1 lists the goat. SOX9Gene sequences were sequenced, and sgRNA target sites were designed using online target design software (http: / / www.rgenome.net / cas-designer / ). Three target sites with high overall scores were selected from the screening results and named Target 1, Target 3, and Target 5, respectively. Their corresponding sgRNAs were named sgRNA-1, gRNA-3, and sgRNA-5, respectively. The target design diagram is shown below. Figure 1 As shown, the sequences of target 1, gRNA-3, and target 5 are as follows: Target 1: 5'-TCGTACTGCGCGCGCGTGATGGG-3' (SEQ ID NO: 1); Target 3: 5'-ACGTCGCGGAAGTCGATGGGGGG-3' (SEQ ID NO:2); Target 5: 5'-CTTGATGTGCGTTCGCTGCGCGG-3' (SEQ ID NO:3).

[0038] 2. Construction of sgRNA expression recombinant plasmid First, the designed sgRNAs (i.e., sgRNA-1, sgRNA-3, and sgRNA-5) were sent to Beijing Qingke Biotechnology Co., Ltd. for double digestion of the pX330 vector (Addgene, catalog number 42335) with AscI and AarI to obtain recombinant plasmids 1, 3, and 5, respectively. Recombinant plasmid 1 is pX330-sgRNA-1, recombinant plasmid 3 is pX330-sgRNA-3, and recombinant plasmid 5 is pX330-sgRNA-5. The sequences of sgRNA-1, sgRNA-3, and sgRNA-5 are shown in Table 1.

[0039] Table 1 Sequence information of sgRNA-1, sgRNA-3, and sgRNA-5

[0040] Example 2 1. Cell transfection and genomic DNA extraction Muscle tissue was collected from goat embryos (identified as interstitial goat embryos by Qingdao Laoyikang Ecological Agriculture Co., Ltd.) and DNA was extracted using a genomic DNA extraction kit (TIANGEN, catalog number: DP304). Specific procedures were performed according to the kit's instructions. PCR detection was then performed using the goat embryo muscle tissue DNA as a template.

[0041] The target genes for PCR detection were PIS var-2 (target band 680bp), PIS wt-2 (target band 214bp), and SRY (target band 379bp). The PCR primers are shown below: PIS var-2-F: 5'-ATTTGCTGGCGTATTGAGTG-3' (SEQ ID NO:7); PISvar-2-R: 5'-AAGACGGTAGGTTCTGTGGG-3' (SEQ ID NO: 8); PIS wt-2-F: 5'-CTTGTGCCTCTTAGTCCTG-3' (SEQ ID NO: 9); PIS wt-2-R: 5'-ACATAGAATGCCCTGGTG-3' (SEQ ID NO: 10); SRY-F: 5'-GGGGCAATCGTATGCTTCT-3' (SEQ ID NO: 11); SRY-R: 5'-CGGGTATTTGTCTCGGTGT-3' (SEQ ID NO: 12).

[0042] In the test results, if only a 214bp fragment is present, the fetal sheep is wild-type homozygous, with no structural variation and a horned phenotype; if only a 680bp fragment is present, the fetal sheep is mutant homozygous, with a hornless phenotype; if both 214bp and 680bp fragments are present, the fetal sheep is mutant heterozygous, and since hornlessness is dominant over horniness, the hornless phenotype is present; if a 379bp fragment is present, the fetal sheep is male; if the 379bp fragment is absent, the fetal sheep is female. The test results are as follows: Figure 2 As shown, M represents a 2000bp DNA Marker; lanes 1-4 represent bands amplified using PIS wt-2-F / R from fetal samples of different genotypes, lanes 6-9 represent bands amplified using PIS var-2-F / R from fetal samples of different genotypes, and lanes 11-14 represent bands amplified using SRY-F / R from fetal samples of different genotypes; lanes 5, 10, and 15 are blank controls; 214bp represents horned fetuses, and lane 4 without a band represents hornless fetuses. 680bp represents hornless fetuses, and lane 8 has a band, indicating homozygous hornless fetuses. 379bp represents male fetuses, and lane 14 without a band represents female fetuses. Therefore, the samples corresponding to lanes 4, 9, and 14 are the target embryo samples of this experiment: female homozygous hornless goat embryos, i.e., intersex goat embryos.

[0043] 2. Isolation and culture of interstitial goat embryonic fibroblasts (1) Under aseptic conditions, skin tissue (about the size of a little fingernail) of the interstitial goat embryos selected in step 1 was collected and immediately placed in DMEM / F12 medium containing 1% penicillin-streptomycin mixture (PS) and temporarily stored on ice. After being transferred to a clean bench, the tissue was rinsed three times with the above medium and residual blood clots and impurities were carefully removed with curved forceps.

[0044] (2) Cut the cleaned tissue into pieces about 5 mm in size, transfer them into a 1.5 mL sterile centrifuge tube, add 1 mL of 1 mg / mL collagenase I (GIBCO, catalog number: 25200072), and incubate in a 37 °C water bath for 30 min. During this period, remove the tube every 10 min and use scissors for mechanical separation.

[0045] (3) After digestion for 30 minutes, use a handheld centrifuge to centrifuge the tissue digested by collagenase I to the bottom of the tube, discard the collagenase I supernatant, then add 1 mL of 0.25% trypsin (GIBCO, catalog number: 25200072), and digest in a 37°C water bath for 30 minutes. During this period, take it out every 10 minutes and use scissors for mechanical separation.

[0046] (4) After 30 min of digestion, add complete culture medium (DMEM / F12 medium containing 1% PS and 10% FBS) to terminate the digestion. Filter the cell suspension using a 40 μm nylon cell filter (BioSharp, catalog number: BS-40-CS). Centrifuge at 1000×g for 5 min, discard the supernatant, and add 1 mL of complete culture medium (DMEM / F12 medium containing 1% PS and 10% FBS) to gently resuspend the cells. Transfer the cell suspension to a T25 cell culture flask and add complete culture medium (DMEM / F12 medium containing 1% PS and 10% FBS) to a final volume of 5 mL. Incubate statically at 37°C and 5% CO2. When the cell confluence reaches approximately 90%, freeze the cells for later use. Due to the higher risk of contamination with freshly isolated cells, the culture medium should be changed within 24 hours after cell attachment.

[0047] 3. Cell transfection and acquisition of polyclonal cells Two μg of each of the three plasmids obtained in Example 1 (pX330-sgRNA-1, pX330-sgRNA-3, and pX330-sgRNA-5) were transfected into 1×10⁻⁶ cells by electroporation. 6 Three groups of polyclonal cells were obtained from intergenic goat embryonic fibroblasts.

[0048] The specific steps for transfection are as follows: Transfection is performed using a nuclear transfection instrument (Amaxa, model: AAD-1001S) and the accompanying mammalian fibroblast transfection kit (Amaxa, catalog number: VPI-1002). Please refer to the kit's instruction manual for detailed procedures.

[0049] 4. Culture of monoclonal cells The three groups of transfected polyclonal cells obtained in step 3 of Example 2 were subjected to single-cell screening.

[0050] The specific steps for screening are as follows: Taking one group of polyclonal cells as an example, after counting a portion of the transfected polyclonal cells, the limiting dilution method is used in a 96-well plate to minimize the number of cells in each well. Single cells are aspirated and cultured in DMEM / F12 with 1% PS and 20% FBS at 37°C and 5% CO2 in an incubator to finally obtain monoclonal cells.

[0051] 5. Extraction of cellular genomic DNA The polyclonal cells obtained in step 3 were cultured in DMEM / F12 with 1% PS and 20% FBS in a 37°C, 5% CO2 incubator. After 3 days of culture, the cells were collected.

[0052] Specific steps: The selected polyclonal cells were first digested with 0.05% trypsin (Gibco, catalog number: 610-5300AG) to a final concentration. Then, the digestion was stopped with 1 mL of complete culture medium (DMEM / F12 medium with 1% PS and 10% FBS). The cells were then washed twice with phosphate buffer (Gibco, catalog number: 10010-023). Finally, DNA was extracted using a DNA extraction kit (TIANGEN, catalog number: DP304). The specific operation was performed according to the kit's instructions.

[0053] 6. Extraction of trace amounts of cellular DNA The monoclonal cells from step 4 of Example 2 were cultured in DMEM / F12 with 1% PS and 20% FBS in a 37°C, 5% CO2 incubator. After 15 days of culture, the cells were collected, and a small amount of cellular DNA was extracted from the obtained monoclonal cells.

[0054] Specific steps: First, digest the obtained monoclonal cells with 0.05% trypsin (Gibco, catalog number: 610-5300AG), then terminate the digestion with 1 mL of complete culture medium (DMEM / F12 medium with 1% PS and 10% FBS). Finally, lyse the cells using the EZ-editor™ High-Performance Monoclonal Genotyping Kit (extraction-free) (Yuanjing Biotechnology, catalog number: YK-MVH-50), following the instructions for the lysis procedure.

[0055] Example 3 1. Polyclonal cell PCR amplification and sequencing Using the genomic DNA extracted from the three groups of transfected polyclonal cells in step 5 of Example 2 as templates, nested PCR amplification of sgRNA-1 and sgRNA-5 DNA was performed using an outer primer composed of Delete-F1 (SEQ ID NO:13) and Delete-R1 (SEQ ID NO:14) and an inner primer composed of ER-Delete-F1 (SEQ ID NO:15) and ER-Delete-R1 (EQ ID NO:16). PCR amplification of sgRNA-3 DNA was performed using a primer composed of Delete-F2 (EQ ID NO:17) and Delete-R2 (EQ ID NO:18). The specific primer sequences are shown below: Delete-F1: 5'-GAGTTCGACCAGTACCTGCC-3' (SEQ ID NO: 13); Delete-R1: 5'-CTGTGTGTAGACCGGCTGTT-3' (SEQ ID NO: 14); ER-Delete-F1: 5'-ACGTTGTGGATGTCCAAGCAG-3' (SEQ ID NO: 15); ER-Delete-R1: 5'-GGCTCATGTAGCTGAAGGTGGA-3' (EQ ID NO: 16); Delete-F2: 5'-ATTCGACGCCTTATCCTGGG-3' (EQ ID NO: 17); Delete-R2: 5'-CTGCTTGGACATCCACACGT-3' (EQ ID NO: 18).

[0056] The three sets of PCR amplification products obtained above were sequenced. The results showed that the PCR products of recombinant plasmid 1, recombinant plasmid 3, and recombinant plasmid 5 were all consistent with those published by NCBI for goat... SOX9 The gene sequences (Genbank accession number NC_030826.1) are identical. The sequencing peak plots show a double peak near the target site in recombinant plasmids 1 and 5, indicating that gene editing was achieved by both plasmids. Figures 3-5 As shown. Figures 3-5 The relatively few bimodal peaks indicate that the signal from wild-type cells dominates in the polyclonal cell population, masking the few successfully edited mutation signals.

[0057] 2. Verification of gene knockout by single-clone cell PCR and TA cloning sequencing Using the DNA of nine single-clone cells obtained in step 6 of Example 2—four single clones (denoted as 1-1, 1-2, 1-3, 1-4) from recombinant plasmid 1 and five single clones (denoted as 5-1, 5-2, 5-3, 5-4, 5-5) from recombinant plasmid 5—as templates, nested PCR amplification of the DNA of sgRNA-1 and sgRNA-5 was performed using an outer primer composed of Delete-F1 (SEQ ID NO:13) and Delete-R1 (SEQ ID NO:14) and an inner primer composed of ER-Delete-F1 (SEQ ID NO:15) and ER-Delete-R1 (EQ ID NO:16).

[0058] Agarose gel electrophoresis results are as follows Figure 6 M represents a 2000 bp DNA Marker; lanes 1-11 represent four single clones from recombinant plasmid 1 (i.e., 1-1, 1-2, 1-3, 1-4) and five single clones from recombinant plasmid 5 (i.e., 5-1, 5-2, 5-3, 5-4, 5-5), respectively; lane 10 is the positive control for recombinant plasmid 1 DNA; lane 11 is the blank control.

[0059] The PCR amplification products obtained above in the nine groups (i.e., 1-1, 1-2, 1-3, 1-4, 5-1, 5-2, 5-3, 5-4, 5-5) were sequenced for detection. Figures 7-15 As shown, the sequencing peak diagram shows that the three single clones (i.e., 1-1, 1-2, 1-4) from recombinant plasmid 1 and the two single clones (i.e., 5-2, 5-4) from recombinant plasmid 5 exhibit distinct double peaks near the target site.

[0060] The PCR products of the five groups showing obvious bimodal peaks (1-1, 1-2, 1-4 (cells obtained by transfecting recombinant plasmid 1) and 5-2, 5-4 (cells obtained by transfecting recombinant plasmid 5) were purified by agarose gel electrophoresis and ligated into cloning vectors using the pClone007Versatile Simple Vector Mix kit (Qingke, catalog number: TSV-007VS). The ligation products were transformed into competent E. coli cells, plated on solid medium containing ampicillin, and incubated overnight at 37°C. The following day, 15 monoclonal colonies were picked from each group, for a total of 75 monoclonal colonies from the 5 groups. The specific numbering is as follows: Group 1-1: 1-1-1, 1-1-2, 1-1-3, 1-1-4, 1-1-5, 1-1-6, 1-1-7, 1-1-8, 1-1-9, 1-1-10, 1-1-11, 1-1-12, 1-1-13, 1-1-14, 1-1-15; Groups -2: 1-2-1, 1-2-2, 1-2-3, 1-2-4, 1-2-5, 1-2-6, 1-2-7, 1-2-8, 1-2-9, 1-2-10, 1-2-11, 1-2-12, 1-2-13, 1-2-14, 1-2-15; Groups 1-4: 1-4-1, 1-4-2, 1-4-3, 1-4-4, 1-4-5, 1- 4-6, 1-4-7, 1-4-8, 1-4-9, 1-4-10, 1-4-11, 1-4-12, 1-4-13, 1-4-14, 1-4-15; Group 5-2: 5-2-1, 5-2-2, 5-2-3, 5-2-4, 5-2-5, 5-2-6, 5-2-7, 5-2-8, 5-2-9, 5-2-10, 5-2-11. PCR identification was performed on samples 5-2-12, 5-2-13, 5-2-14, and 5-2-15; and samples 5-4: 5-4-1, 5-4-2, 5-4-3, 5-4-4, 5-4-5, 5-4-6, 5-4-7, 5-4-8, 5-4-9, 5-4-10, 5-4-11, 5-4-12, 5-4-13, 5-4-14, and 5-4-15.

[0061] TA clone PCR identification results are as follows Figure 16As shown, lanes 1-75 each contain 75 groups of monoclonal colonies (i.e., lanes 1-15 contain 15 single colonies selected from lane 1-1, namely 1-1-1, 1-1-2, 1-1-3, and so on; lanes 16-30 contain 15 single colonies selected from lane 1-2, namely 1-2-1, 1-2-2, 1-2-3, and so on; lanes 31-45 contain single colonies selected from lane 1-4, namely 1-4-1, 1-4-2, 1-4-...). 3. And so on; 46~60 are single colonies selected from 5-2, namely 5-2-1, 5-2-2, 5-2-3, and so on; 60~75 are single colonies selected from 5-4, namely 5-4-1, 5-4-2, 5-4-3, and so on); 1-1, 1-2, 1-4, 5-2, and 5-4 are the 5 groups of single clones in step 2 of Example 3; lane 76 is the recombinant plasmid 1 DNA positive control; lane 77 is the blank control.

[0062] Of the 75 gel electrophoresis images obtained, 60 groups of positive clones with clear and bright bands (i.e., 13 groups obtained from 1-1, 12 groups obtained from 1-2, 12 groups obtained from 1-4, 10 groups obtained from 5-2, and 13 groups obtained from 5-4) were sequenced. Groups 1-1, 1-2, 1-4, 5-2, and 5-4 refer to the 5 groups of single-clone cells in step 2 of Example 3. The results showed that 10 of the 13 single-colony sequencing results obtained from 1-1 matched the goat colony sequence published by NCBI. SOX9 The gene sequence (Genbank accession number NC_030826.1) was inconsistent, with a knockout efficiency of 77%. Of the 12 single-colony sequencing results obtained from steps 1-2, 10 groups differed from the goat gene sequence published by NCBI. SOX9 The gene sequence (Genbank accession number NC_030826.1) was inconsistent, with a knockout efficiency of 83%; 11 out of the 12 single colony sequencing results obtained from 1-4 contained the goat gene sequence published by NCBI. SOX9 The gene sequence (Genbank accession number NC_030826.1) was inconsistent, with a knockout efficiency of 92%; among the 10 single colony sequencing results obtained from 5-2, 5 groups were inconsistent with the goat gene sequence published by NCBI. SOX9 The gene sequence (Genbank accession number NC_030826.1) was inconsistent, with a knockout efficiency of 50%; among the 13 single colony sequencing results obtained from 5-4, 13 groups were inconsistent with the goat gene sequence published by NCBI. SOX9 The gene sequence (Genbank accession number NC_030826.1) was inconsistent, and the knockout efficiency was 100%. This indicates that the sgRNAs encoded by recombinant plasmid 1 and recombinant plasmid 5 (i.e., sgRNA-1 and sgRNA-5) successfully mediated goat... SOX9 Gene deletion. The remaining sequencing results matched the target sequence, indicating that no editing had occurred.

[0063] Therefore, the knockout efficiency of sgRNA-1 can reach 92%, and the knockout efficiency of sgRNA-5 can reach 100%. This indicates that the sgRNA provided by this invention, combined with the genome-targeting modification technology of the CRISPR-Cas9 system, can efficiently and specifically mediate the knockout of goats. SOX9 Gene deletion.

[0064] The obtained positive monoclonal cells were used as donors to construct [a new cell line] using somatic cell nuclear transfer technology. SOX9 A gene-knockout goat cloned embryo was successfully transplanted into a recipient ewe to obtain a cloned lamb.

[0065] Phenotypic analysis was performed on the cloned lambs: Dissection was conducted to observe the development of the lambs' reproductive organs, including the presence and morphology of structures such as the testes, ovaries, vas deferens, and uterus; tissue samples were taken for genotyping to confirm their morphology. SOX9 Gene knockout status. Expected experimental results: Genotyping results showed that the gene was detected in tissue samples from cloned lambs. SOX9 Editing signals at gene target sites confirm SOX9 The gene has been successfully knocked out. Compared to the control lambs, SOX9 Gene knockout cloned lambs exhibit partial or complete reversal of normalized intersexual characteristics in testicular or ovarian structures. These results indicate that gene knockout... SOX9 Genes may be able to effectively reverse the interspecific phenotype of goats. The sgRNA provided in this invention can efficiently and specifically mediate the effect on goats. SOX9 Functional knockout of genes, and successful interspecific reversal phenotypic verification at the individual level.

[0066] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Goat SOX9 The application of genes is characterized by, The applications include any one or more of the following: (1) Application in breeding hornless female goat breeds with normal gonadal development; (2) Application in the preparation of drugs for treating genetic defects in interhormonal syndrome; The SOX9 The gene's Gene ID in NCBI is 106503295.

2. A group of targeted knockout goats SOX9 The sgRNA of a gene is characterized by, The sgRNA includes sgRNA-1 or sgRNA-5; The nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO:4; The nucleotide sequence of the sgRNA-5 is shown in SEQ ID NO:6; The SOX9 The gene's Gene ID in NCBI is 106503295.

3. A targeted knockout goat SOX9 Gene editing vectors, characterized in that, The gene editing vector includes the sgRNA and the basic vector as described in claim 2.

4. The gene editing vector according to claim 3, characterized in that, The basic carrier includes the pX330 carrier.

5. A targeted knockout goat SOX9 Recombinant cell lines of genes, characterized by, The recombinant cell line contains the gene editing vector as described in claim 3 or 4.

6. The recombinant cell line according to claim 5, characterized in that, The recombinant cell line is based on interstitial goat embryonic fibroblasts.

7. The application of the sgRNA of claim 2, the gene editing vector of claim 3 or 4, or the recombinant cell line of claim 5 or 6, characterized in that, The applications include any one or more of the following: (1) Application in breeding hornless female goat breeds with normal gonadal development; (2) Application in the preparation of drugs for treating genetic defects in interhormonal syndrome; (3) In the analysis SOX9 Application of genes in the molecular regulatory mechanism of sex determination in goats; (4) In the analysis SOX9 Application of genes in the molecular regulatory mechanisms of gonadal development in goats.

8. A method for breeding a breed of hornless female goats with normal gonadal development, characterized in that, Includes the following steps: Knockout of target female goats SOX9 Genes were used to obtain a breed of hornless female goats with normal gonadal development; SOX9 The gene's Gene ID in NCBI is 106503295.

9. A goat cell model for overcoming the genetic defects of interhornless syndrome, characterized in that, The goat cell model SOX9 The gene was knocked out; SOX9 The gene's Gene ID in NCBI is 106503295.

10. A drug for treating the genetic defect of interhormonal syndrome, characterized in that, Including goat knockout SOX9 Gene reagents; said reagents include knockout goats SOX9 The sgRNA of the gene; the knockout goat SOX9 The sgRNA of a gene includes sgRNA-1 or sgRNA-5; The nucleotide sequence of the sgRNA-1 is shown in SEQ ID NO:4; The nucleotide sequence of the sgRNA-5 is shown in SEQ ID NO:6; The SOX9 The gene's Gene ID in NCBI is 106503295.

Images