A method for increasing the production of deoxynivalenol in fusarium graminearum and its application

Abstract

This invention belongs to the field of genetic engineering technology, specifically relating to a method for increasing the yield of deoxynivalenol (DON) in Fusarium graminearum and its application. This invention discovers... FgSFL1 Genes negatively regulate the biosynthesis of DON toxin in Fusarium graminearum, and a method for [transformation / manufacturing] is established. FgSFL1 A method for increasing DON toxin production through gene inactivation. This method increases the accumulation level of DON toxin without affecting the normal vegetative growth of the strain, resulting in a genetically stable, high-yielding engineered strain of DON. This provides a new technical solution for the large-scale preparation and related research of DON toxin.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a method for increasing the yield of deoxynivalenol toxin in Fusarium graminearum and its application. Background Technology

[0002] Fusarium graminearum ( Fusarium graminearum Fusarium graminearum (F. graminearum) is one of the main pathogenic fungi causing wheat scab. During infection of host plants, this fungus secretes various mycotoxins, among which deoxynivalenol (DON) is one of the most harmful, belonging to the trichothecene family of type B mycotoxins. DON, also known as vomitoxin, is one of the most important secondary metabolites of Fusarium graminearum. DON is chemically stable and widely present in grains such as wheat and corn, as well as their processed products. Recent detection results show that the detection rate of DON in grains and wheat products both domestically and internationally is high, with some samples even far exceeding national standard limits, seriously threatening food safety. This toxin can affect the function of eukaryotic ribosomes, interfere with protein synthesis, and thus damage the immune system of humans and animals, causing symptoms such as diarrhea, vomiting, and loss of appetite, and in severe cases, death. At the same time, DON is also an important virulence factor in the pathogenic process of Fusarium graminearum, promoting the spread of the pathogen in host tissues.

[0003] Because DON toxins have significant applications in various fields, including toxicological mechanism research, rapid detection method development, screening of highly efficient degrading bacteria, and pathogenic mechanism research, it is necessary to establish stable and efficient methods for DON toxin preparation. Currently, commercially available DON toxins are mainly derived from the natural fermentation culture of *Fusarium graminearum*, followed by extraction and purification steps. However, naturally occurring toxin-producing strains generally suffer from low toxin yields and long production cycles, limiting the large-scale preparation and cost-effectiveness improvement of DON toxins. Summary of the Invention

[0004] The purpose of this invention is to provide a method for increasing the production of deoxynivalenol toxin in Fusarium graminearum and its application. This invention achieves this by inhibiting the production of deoxynivalenol toxin in Fusarium graminearum. FgSFL1 Gene expression enables FgSFL1 The gene was inactivated, and the resulting mutant strain had a significantly enhanced ability to produce deoxynivalenol toxin, providing technical support for the production of deoxynivalenol toxin.

[0005] This invention provides a method for increasing the production of deoxynivalenol toxin in Fusarium graminearum, comprising: inhibiting the production of deoxynivalenol toxin in Fusarium graminearum. FgSFL1 Gene expression enables FgSFL1 Genes become inactivated, resulting in FgSFL1 The gene loss-of-function mutant strain; FgSFL1 The loss-of-function mutant strain produced higher levels of deoxynivalenol toxins than the wild-type *Fusarium graminearum*. FgSFL1 The gene encodes protein FgSfl1, the amino acid sequence of which is shown in SEQ ID NO:2.

[0006] Preferably, the FgSFL1 The nucleotide sequence of the gene is shown in SEQ ID NO:1.

[0007] Preferably, the inhibition of Fusarium graminearum... FgSFL1 Methods of gene expression include: using genetic engineering methods to express genes... FgSFL1 Genes are knocked out or silenced.

[0008] Preferably, the pair FgSFL1 Methods for gene knockout include: using homologous recombination technology to knock out genes in Fusarium graminearum. FgSFL1 Gene deletion mutations occur.

[0009] Preferably, the primers used in the homologous recombination technology include amplification primers. FgSFL1 upstream homologous arm of gene, amplification FgSFL1 The downstream homologous arm of the gene and primers for amplifying the selection marker gene; the selection marker gene includes a hygromycin resistance gene. hp .

[0010] Preferably, the amplification FgSFL1 The nucleotide sequences of the upstream and downstream primers of the primers for the upstream homologous arm of the gene are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively; The amplification FgSFL1 The nucleotide sequences of the upstream and downstream primers of the primers for the downstream homologous arm of the gene are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; The amplified hygromycin resistance gene hp The primers include primers for amplifying the selection marker fragment HT1 and primers for amplifying the selection marker fragment HT2; the nucleotide sequences of the upstream and downstream primers of the primers for amplifying the selection marker fragment HT1 are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; the nucleotide sequences of the upstream and downstream primers of the primers for amplifying the selection marker fragment HT2 are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively.

[0011] Preferably, the Fusarium graminearum includes Fusarium graminearum strain PH-1.

[0012] The present invention also provides the method described in the above technical solutions or the method obtained by the above technical solutions. FgSFL1 Application of gene loss-of-function mutant strains in the production of deoxynivalenol toxins by Fusarium oxysporum.

[0013] Preferably, the application includes: FgSFL1 The gene loss-of-function mutant strain was inoculated into a toxin-inducing medium and cultured.

[0014] Preferably, the toxin-inducing culture medium contains putrescine.

[0015] Beneficial effects: This invention provides a method for increasing the yield of deoxynivalenol toxins in Fusarium graminearum. This invention discovers... FgSFL1 Genes negatively regulate the biosynthesis of DON toxin in Fusarium graminearum, and a method for [transformation / manufacturing] is established. FgSFL1 A method for increasing DON toxin production through gene inactivation. This method increases the accumulation level of DON toxin without affecting the normal vegetative growth of the strain, resulting in a genetically stable, high-yielding engineered strain of DON. This provides a new technical solution for the large-scale preparation and related research of DON toxin. Attached Figure Description

[0016] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.

[0017] Figure 1 In Example 1 ΔFgsfl1 A schematic diagram illustrating the construction of a knockout mutant.

[0018] Figure 2 In Example 2 ΔFgsfl1 Comparison of colony growth of mutant and wild-type PH-1 on PDA and CM media; Figure 3 The high-yield DON toxin in Example 3 ΔFgsfl1 The graph shows the results of toxin yield detection for the mutant, where " "Indicates significant difference" P <0.001; Figure 4 The high-producing DON toxin strain in Example 4 ΔFgsfl1 DON toxin synthesis gene TRI3 , TRI4 , TRI5 The transcription level detection results are shown in the figure, where " "Indicates significant difference" P <0.0001. Detailed Implementation

[0019] This invention provides a method for increasing the production of deoxynivalenol toxin in Fusarium graminearum, comprising: inhibiting the production of deoxynivalenol toxin in Fusarium graminearum. FgSFL1 Gene expression enables FgSFL1 Genes become inactivated, resulting in FgSFL1 The gene loss-of-function mutant strain; FgSFL1 The loss-of-function mutant strain produced higher levels of deoxynivalenol toxins than the wild-type *Fusarium graminearum*. FgSFL1 The gene encodes protein FgSfl1, the amino acid sequence of which is shown in SEQ ID NO:2.

[0020] In this invention, the amino acid sequence shown in SEQ ID NO:2 is:

[0021] As one implementation method, the present invention described FgSFL1The nucleotide sequence of the gene is shown in SEQ ID NO:1. In the present invention, the nucleotide sequence shown in SEQ ID NO:1 is: ATGGCTACAGCGCACATGGCCGTCAGGACTGACACCTTTCCGCACTCTACCTCCCGCTCTCACAGTCACAGCCACCAGTCAATGGGAGCTCGCATTATTCCCATACCTACACCTACGATCAAGATGTCTCCTCCCAGCAACGGCGACCCGATGGAGATAACGTCACCTGCGCCATCTTCTAACGGTAACCACAACTCCGACTCCGAAGCCAATGGCAACGGCCAATCCAACGATCGACCCAAGAACTCTCCCGCGCCCGATAGCAACACCGTTACGAGCAACAGTGTCAACAACTCTAACAGCATGCCCGCGCCGCCGCCAGCAGCAGCTGCTGTCCACCAGCCCAAGATCGTGCAGACGGCTTTTATCCACAAGCTCTACAA GTGAGAACGCGCTGCCAGAAAGAAAAAAACCACG GCGTCTTGCTAACAATACGCTAG TATGCTGGAAGACCCCAATATCCAACACTTGATTTCCTGGTCTGCGAGCGCTGAAAGCTTTGTTATGTCGCCCTCGGCCGATTTTTCAAAAGTTCTATC GTGCGTTTAAAGCAACTGCAACTGGTTGAT GAGTAGGCGACTAACGCCTTATAG GCAATACTTCAAGCACACCAACATATCATCGTTTGTCAGACAGCTAAACATGTACGGTTTCCATAAGG GTGAGTGCCAGAAAGATCCATATATCAAGATTCTCATGGTAACTAACATGGCATAGAGCGCGACGTTTTCCATACAGGAAACCCCGATACGACTCTGTGGGAATTCAAGCACGGCAATGGCAACTTCAAGCGCGGTGATCTAGTCGGCCTACGTGAGATCAAGCGTCGAGCCAGTAGGCATGCACTTGTGCACCGCGAGAGCAATTATACAAAGCCTGTGACATCGCAACCGGGCACTCCGGCTGAGCCAGTTCCTCTTCCGCCAGACAGTGCTGACGCCCGATTGCTCAACATTGAGCACACGCTCTTTGATTTGAGTAACCGACTGCAAAGGAGTGAAGAGAACGCTCACTATATGCACGTCAAGAACCAGGCGGCTATGGAGACCATGAACCGCCTTCTCCATTTTAATCAAGAGCTCTCTAGAACTATGTTATCCATTGTTCCTGCTGAGAGCCCAATTTCCCGTGATG GTATGTGTTATTCCCAGCAATATGTTGGTAGCATCTGACAATG ATCCAGThe black italicized portion contains bases that are FgSFL1 Intron sequences in genes.

[0022] As one implementation method, the present invention describes the inhibition of Fusarium graminearum in... FgSFL1 Gene expression can be achieved through genetic engineering. FgSFL1 Genes are knocked out or silenced. As another implementation method, the present invention describes... FgSFL1One method for gene knockout is to use homologous recombination technology to knock out genes in Fusarium graminearum. FgSFL1 Gene deletion mutations occur. As one implementation method, the primers used in the homologous recombination technology of this invention include amplification... FgSFL1 upstream homologous arm of gene, amplification FgSFL1 The downstream homologous arm of the gene and primers for amplifying the selection marker gene; the selection marker gene includes a hygromycin resistance gene. hp .

[0023] As another implementation method, the amplification described in this invention FgSFL1 The nucleotide sequences of the upstream and downstream primers of the primer for the upstream homologous arm of the gene are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively; the amplification FgSFL1 The nucleotide sequences of the upstream and downstream primers of the primers for the downstream homologous arm of the gene are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; the amplified hygromycin resistance gene... hp The primers include primers for amplifying the selection marker fragment HT1 and primers for amplifying the selection marker fragment HT2; the nucleotide sequences of the upstream and downstream primers of the primers for amplifying the selection marker fragment HT1 are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; the nucleotide sequences of the upstream and downstream primers of the primers for amplifying the selection marker fragment HT2 are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively.

[0024] As one embodiment, the Fusarium graminearum described in this invention can be the Fusarium graminearum PH-1 strain.

[0025] The biosynthesis of deoxynivalenol toxins is caused by TRI Gene clusters, their orderly expression, and the formation of toxin-producing bodies are key steps in the synthesis of deoxynivalenol toxins. FgSfl1 is an important negative regulator in the biosynthesis of deoxynivalenol toxins, inhibiting... TRI The expression of gene clusters negatively regulates the synthesis of deoxynivalenol toxins by Fusarium oxysporum.

[0026] The present invention also provides the method described in the above technical solutions or the method obtained by the above technical solutions. FgSFL1 Application of gene loss-of-function mutant strains in the production of deoxynivalenol toxins by Fusarium oxysporum.

[0027] As one implementation method, the application described in this invention can be to... FgSFL1 The gene loss-of-function mutant strain was inoculated into a toxin-inducing medium and cultured. As one embodiment, the toxin-inducing medium contains putrescine; the concentration of putrescine may be 1.6 μg / mL.

[0028] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0029] The culture media and their formulations used in the following examples are as follows: CM medium: 10 g glucose, 2 g tryptone, 1 g yeast extract, 1 g acid hydrolyzed casein, 6 g sodium nitrate, 0.5 g potassium chloride, 1.023 g magnesium sulfate heptahydrate, 0.5 g potassium dihydrogen phosphate, 15 g agar powder, add ddH2O to bring the volume to 1 L, and adjust the pH to 6.5.

[0030] TBI medium: 30 g sucrose, 1 g sodium nitrate, 1 g ammonium dihydrogen phosphate, 0.5 g magnesium sulfate heptahydrate, 0.5 g potassium chloride, 10 mg ferrous sulfate heptahydrate, 0.3 g plant gel, 200 μL trace element solution, add ddH2O to make up to 1 L, and adjust the pH to 5.6.

[0031] Trace element stock solution (without putrescine): 5 g citric acid, 5 g zinc sulfate heptahydrate, 0.25 g copper sulfate pentahydrate, 50 mg manganese sulfate monohydrate, 50 mg boric acid, 50 mg sodium molybdate dihydrate, add ddH2O to make up to 100 mL.

[0032] Trace element stock solution (containing putrescine): 5 g citric acid, 5 g zinc sulfate heptahydrate, 0.25 g copper sulfate pentahydrate, 50 mg manganese sulfate monohydrate, 50 mg boric acid, 50 mg sodium molybdate dihydrate, 800 mg putrescine, add ddH2O to make up to 100 mL.

[0033] Bottom medium: 3 g yeast extract, 3 g acidic hydrolyzed casein, 200 g sucrose, 10 g agar powder, add ddH2O to make up to 1 L.

[0034] Top medium: 3 g yeast extract, 3 g acid-hydrolyzed casein, 200 g sucrose, 15 g agar powder, and ddH2O to a final volume of 1 L.

[0035] All the above culture media were autoclaved at 121℃ for 20 min before use.

[0036] The wild-type strain of Fusarium graminearum used in the examples is PH-1. FgSFL1 The gene is represented in italics, while its encoded protein FgSfl1 is represented in upright font. FgSFL1 Gene deletion mutant strains are denoted as Δ Fgsfl1 .

[0037] Example 1 FgSFL1 Construction and identification of loss-of-function mutant strains To obtain FgSFL1 Gene function inactivation mutant strains were used to induce gene knockout in Fusarium graminearum strain PH-1 using a homologous recombination-mediated gene knockout strategy. FgSFL1 Gene knockout, as shown in the diagram. Figure 1 As shown in Table 1, the gene amplification primers used for knockout are as follows: Using Fusarium graminearum PH-1 genomic DNA as a template, it was obtained by PCR amplification. FgSFL1 Upstream and downstream homologous arm fragments A and B of the gene; containing the hygromycin resistance gene hp vector plasmids hph-tk (Disclosed in the following literature [Ding M, Cao S, Xu D, Xia A, Wang Z, Wang W, Duan K, Wu C, Wang Q, Liang J, Wang D, Liu H, XuJR, Jiang C. A non-pheromone GPCR is essential for meiosis and ascosporogenesis in the wheat scab fungus. Proc Natl Acad Sci USA . 2023 Oct17;120(42):e2313034120. doi: 10.1073 / pnas.2313034120. Epub 2023 Oct 9. PMID:37812726; PMCID: PMC10589705.】) as template, the selection marker fragments HT1 and HT2 were amplified. The obtained PCR products were purified by gel extraction after detection by 1% agarose gel electrophoresis. Subsequently, the homologous arm fragment and the selection marker fragment were ligated separately using overlap extension PCR (SOE-PCR) technology to obtain the selection marker fragments for use in PCR. FgSFL1 Recombinant fragments A-HT1 and HT2-B with gene substitution.

[0038] The recombinant fragments (approximately 3 μg each) were introduced into protoplasts of strain PH-1. After incubation at room temperature, the transformation system was treated with PTC solution, followed by TB3 medium, and cultured at 25°C and 90 rpm for 16 h for recovery. The recovered cells were mixed with Bottom medium cooled to 60°C, and hygromycin was added to a final concentration of 150 μg / mL. After mixing, plates were poured and covered with a layer of Top medium containing 300 μg / mL hygromycin. After 3 days of culture, single colonies were picked from the selection plates, genomic DNA was extracted, and PCR identification was performed using the primers shown in Table 1 to screen for... FgSFL1Gene deletion mutant Δ Fgsfl1 , for use in subsequent experiments.

[0039] Table 1 Primers for gene amplification and mutant detection

[0040] Example 2 FgSFL1 Effects of functional loss on the vegetative growth of Fusarium graminearum For testing FgSFL1 Whether gene loss of function affects the growth characteristics of Fusarium graminearum was investigated by comparing wild-type strain PH-1 and... FgSFL1 Gene deletion mutant Δ Fgsfl1 The samples were inoculated onto PDA, CM, and 5×YEG medium plates, respectively, and incubated at 25°C for 3 days. Results are as follows: Figure 2 As shown. It can be seen that, compared to the wild-type strain PH-1, Δ Fgsfl1 The mutants showed no significant differences in colony morphology and growth rate on the three culture media. These results indicate that... FgSFL1 Gene deletion does not affect the colony growth of Fusarium graminearum.

[0041] Example 3 FgSFL1 DON yield detection of loss-of-function mutant strains For evaluation FgSFL1 The effect of loss of function on DON toxin synthesis was investigated by culturing different strains in TBI toxin-inducing culture systems containing and without putrescine, and detecting the DON toxin content in the culture systems. The specific methods are as follows: Add 2 mL of TBI medium to a 24-well plate and inoculate with wild-type PH-1 strain and Δ strain respectively. Fgsfl1 The mutant strain produced conidia, resulting in a spore concentration of 1×10⁻⁶. 4 The concentration of DON was measured at 1 / mL, with three replicates for each treatment. After incubation at 25°C in the dark for 7 days, the bacterial film was collected and its dry weight determined. 400 μL of the culture solution was mixed with 1600 μL of methanol, and the mixture was extracted using a C18 solid-phase extraction column, followed by collection of the eluent. The obtained sample was concentrated, silanized, and derivatized. The DON toxin content was determined by gas chromatography-mass spectrometry (GC-MS), and the toxin yield per unit mass of bacterial cells was calculated based on the dry weight of the bacterial film.

[0042] The results are as follows Figure 3 As shown, putrescine, as a DON toxin inducer, significantly promotes the synthesis of DON toxin in Fusarium graminearum. In TBI medium, regardless of the addition of putrescine, Δ Fgsfl1The DON toxin production of the mutant strains was significantly higher than that of the wild-type strain PH-1. Specifically, under putrescine-induced conditions, Δ Fgsfl1 The mutant strain still produced more than twice the amount of DON toxin compared to the wild-type strain, indicating that even though putrescine had induced DON toxin synthesis to a high level, FgSFL1 Gene inactivation can further increase DON toxin production; under conditions without putrescine addition, Δ Fgsfl1 The mutant strain produced more than 100 times more DON toxin than the wild-type strain.

[0043] The above results indicate that FgSFL Inactivation of gene 1 significantly promotes the synthesis of DON toxin in Fusarium graminearum, and has a synergistic effect with putrescine induction. Therefore, knockout, silencing, or inhibition of this gene can significantly promote DON toxin synthesis. FgSFL1 Gene expression can further increase the DON toxin production of Fusarium graminearum, providing a new molecular target for the construction of high-DON toxin-producing strains.

[0044] Example 4 Δ Fgsfl1 Transcriptional level analysis of DON toxin synthesis-related genes in mutants To further clarify FgSFL1 The regulatory effect of gene inactivation on the DON toxin biosynthesis pathway was investigated using real-time quantitative PCR (qRT-PCR) to detect DON synthesis-related genes. TRI3 , TRI4 and TRI5 The expression level, the detection TRI3 The nucleotide sequences of the primers for gene expression level detection are shown in SEQ ID NO:19 and SEQ ID NO:20, respectively; TRI4 The nucleotide sequences of the primers for gene expression level detection are shown in SEQ ID NO:21 and SEQ ID NO:22, respectively; TRI5 The nucleotide sequences of the primers for gene expression level are shown in SEQ ID NO:23 and SEQ ID NO:24, respectively. The steps are as follows: Wild-type PH-1 strain and Δ Fgsfl1 The mutant strains were inoculated into Erlenmeyer flasks containing 30 mL of TBI medium to achieve a final conidial concentration of 1 × 10⁻⁶. 4 The mycelium was cultured at 25℃ and 90 rpm in the dark for 3 days at a concentration of [number] cells / mL. After culture, the mycelium was collected, total RNA was extracted, and cDNA was obtained by reverse transcription. The obtained cDNA was used as a template for qRT-PCR detection. The results are as follows: Figure 4 As shown, under the conditions of toxin induction, Δ Fgsfl1 In mutants TRI3 , TRI4 and TRI5The transcriptional level was significantly upregulated, reaching 40 to 130 times that of the wild type, consistent with the significant increase in DON toxin production.

[0045] The above results indicate that FgSfl1 It is an important negative regulator in the biosynthesis of DON toxin, which inhibits... TRI The expression of gene clusters negatively regulates the synthesis of DON toxin.

[0046] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for increasing the yield of deoxynivalenol toxin in Fusarium graminearum, characterized in that, include: Inhibit Fusarium graminearum FgSFL1 Gene expression enables FgSFL1 Genes become inactivated, resulting in FgSFL1 The gene loss-of-function mutant strain; FgSFL1 The loss-of-function mutant strain produced higher levels of deoxynivalenol toxins than the wild-type *Fusarium graminearum*. FgSFL1 The gene encodes protein FgSfl1, the amino acid sequence of which is shown in SEQ ID NO:

2.

2. The method according to claim 1, characterized in that, The FgSFL1 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

3. The method according to claim 1, characterized in that, The inhibition of Fusarium graminearum FgSFL1 Methods of gene expression include: using genetic engineering methods to express genes... FgSFL1 Genes are knocked out or silenced.

4. The method according to claim 1, characterized in that, The pair FgSFL1 Methods for gene knockout include: using homologous recombination technology to knock out genes in Fusarium graminearum. FgSFL1 Gene deletion mutations occur.

5. The method according to claim 4, characterized in that, The primers used in the homologous recombination technology include amplification... FgSFL1 upstream homologous arm of gene, amplification FgSFL1 Downstream homologous arms of genes and primers for amplifying selection marker genes; The screening marker genes include hygromycin resistance genes. hph .

6. The method according to claim 5, characterized in that, The amplification FgSFL1 The nucleotide sequences of the upstream and downstream primers of the primers for the upstream homologous arm of the gene are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively; The amplification FgSFL1 The nucleotide sequences of the upstream and downstream primers of the primers for the downstream homologous arm of the gene are shown in SEQ ID NO:5 and SEQ ID NO:6, respectively; The amplified hygromycin resistance gene hph The primers include primers for amplifying the selection marker fragment HT1 and primers for amplifying the selection marker fragment HT2; the nucleotide sequences of the upstream and downstream primers of the primers for amplifying the selection marker fragment HT1 are shown in SEQ ID NO:7 and SEQ ID NO:8, respectively; the nucleotide sequences of the upstream and downstream primers of the primers for amplifying the selection marker fragment HT2 are shown in SEQ ID NO:9 and SEQ ID NO:10, respectively.

7. The method according to any one of claims 1 to 6, characterized in that, The Fusarium graminearum includes the Fusarium graminearum PH-1 strain.

8. The method according to any one of claims 1 to 7, or the product obtained by the method according to any one of claims 1 to 7. FgSFL1 Application of gene loss-of-function mutant strains in the production of deoxynivalenol toxins by Fusarium oxysporum.

9. The application according to claim 8, characterized in that, The application includes: FgSFL1 The gene loss-of-function mutant strain was inoculated into a toxin-inducing medium and cultured.

10. The application according to claim 9, characterized in that, The toxin-inducing culture medium contains putrescine.

Images