A method for detecting multiple sample methylation modification m6a

Abstract

This invention discloses a method for detecting m6A methylation modifications in multiple samples, belonging to the field of biotechnology. The method includes: A1) fragmenting the nucleic acids of multiple samples to obtain fragments; A2) adding barcodes to the fragments of each sample and mixing them to obtain a mixed sample; A3) performing immunoprecipitation on the resulting mixed sample using a 6mA antibody to obtain an m6A library; A4) sequencing the resulting m6A library to achieve the detection of m6A methylation modifications in multiple samples. This method can detect 6mA in large-scale samples; the experimental process is simple, the DNA remains intact throughout, and the library has high purity and quality. This method avoids poor sample reproducibility, saves experimental costs and time, and improves experimental reproducibility by mixing multiple samples for 6mA-IP.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and is a method for detecting m6A methylation modification in multiple samples. Background Technology

[0002] Methods for determining 6mA levels include LC-MS / MS and Dot blot. The difference between LC-MS / MS and Dot blot is that LC-MS / MS can accurately quantify 6mA, while Dot blot can only roughly assess 6mA levels. In high-throughput sequencing technologies, the most common methods are 6mA-IP-seq (m6A-IP-seq) and SMRT (Single-molecule real-time sequencing). 6mA-IP-seq (DNA N6-methyladenine Immunoprecipitation Sequencing) utilizes specific antibodies to enrich 6mA (m6A) fragments, amplifies them, and then performs high-throughput sequencing and methylation analysis to rapidly map the whole-genome DNA (RNA) methylation level with a relatively small amount of data. SMRT (Single-molecule real-time sequencing), also known as single-molecule real-time sequencing technology, uses real-time monitoring of the working state of DNA polymerase. The polymerase synthesizes each base within a specific timeframe. When a template base is modified, the polymerase slows down, causing the ratio between the distance between two adjacent pulse peaks of the modified base and the distance to the reference sequence to be greater than 1. This indicates a modification at that position. The disadvantages of these methods are poor sample reproducibility, high cost, and high requirements for the initial sample size. Currently, there is a lack of methods for pooling multiple samples for 6mA-IP-seq. Pooling multiple samples offers better reproducibility for the same sample, reliable comparison results between different samples, lower requirements for the initial sample size, and reduced antibody usage, significantly reducing experimental costs. Summary of the Invention

[0003] The technical problem to be solved by this invention is how to detect methylated m6A in multiple samples.

[0004] To address the aforementioned technical problems, this invention first provides a method for detecting m6A methylation modification in multiple samples, the method comprising: A1) The nucleic acids of multiple samples are broken down separately to obtain fragments from multiple samples; A2) Add barcodes to the fragments of the multiple samples respectively and then mix them to obtain a mixed sample; A3) The resulting mixed sample was subjected to immunoprecipitation using a 6mA antibody to obtain the m6A library; A4) Sequencing the obtained m6A library enables the detection of methylated m6A in multiple samples.

[0005] In the above-mentioned multi-sample methylation modification m6A detection method, the sample can be a DNA sample or an RNA sample.

[0006] In one embodiment of the present invention, the interruption in step A1) is performed using an ultrasonic method.

[0007] In the above-mentioned multi-sample methylation modification m6A detection method, the sample can be a DNA sample, and the method may further include the steps of end-padding and adding A tails to fragments of multiple samples before adding barcodes.

[0008] In one embodiment of the present invention, the Barcode is selected from the following sequences: AACACCTA, ACTAACTG, ATCGCCAG, CATTCCAA, CGCATTAA, CTTCGCGC, ACGTAGCT, ATCCTATT, CAGGAGGC, and CGACTGGG.

[0009] In one embodiment of the present invention, the 6mA antibody in step A3) is anti-N6-methyladenine (Synaptic Systems, catalog number 202003).

[0010] The above-mentioned multi-sample methylation modification m6A detection method may also include steps such as end-completion, addition of A tail, and purification.

[0011] The above-mentioned multi-sample methylation modification m6A detection method may also include a step of adding barcodes to fragments of multiple samples and then purifying them.

[0012] The above-mentioned multi-sample methylation modification m6A detection method may further include a step of denaturing the mixed sample before immunoprecipitation.

[0013] The denaturation can be carried out at 95°C. The denaturation time can be 5 minutes.

[0014] The above-described multi-sample methylation modification m6A detection method may further include a step of amplifying the m6A library.

[0015] In the above multi-sample methylation modification m6A detection method, the multiple samples can be at least two samples.

[0016] Specifically, the plurality of samples may be no more than 30 samples, such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 samples. In one embodiment of the present invention, the plurality of samples is 10 samples.

[0017] This invention also provides a method for constructing a multi-sample methylation-modified m6A detection library, the method comprising: B1) The nucleic acids of multiple samples are broken down separately to obtain fragments from multiple samples; B2) Add barcodes to the fragments of the multiple samples respectively and then mix them to obtain a mixed sample; B3) The resulting mixed sample was subjected to immunoprecipitation using a 6mA antibody to obtain the m6A detection library.

[0018] In the above method for constructing a multi-sample methylation-modified m6A detection library, the sample can be a DNA sample or an RNA sample.

[0019] In one embodiment of the present invention, the interruption in step A1) is performed using an ultrasonic method.

[0020] In the above method for constructing a multi-sample methylation-modified m6A detection library, the sample can be a DNA sample, and the method may further include the steps of end-padding and adding A tails to fragments of multiple samples before adding barcodes.

[0021] In one embodiment of the present invention, the Barcode is selected from the following sequences: AACACCTA, ACTAACTG, ATCGCCAG, CATTCCAA, CGCATTAA, CTTCGCGC, ACGTAGCT, ATCCTATT, CAGGAGGC, and CGACTGGG.

[0022] In one embodiment of the present invention, the 6mA antibody in step A3) is anti-N6-methyladenine (Synaptic Systems, catalog number 202003).

[0023] The above-mentioned method for constructing a multi-sample methylation-modified m6A detection library may also include steps such as end-completion, addition of an A tail, and purification.

[0024] The method for constructing the multi-sample methylation-modified m6A detection library may further include a purification step after adding barcodes to fragments from multiple samples. The purification may be performed using 0.7 volumes of VAHTS DNA Clean Beads.

[0025] The method for constructing the multi-sample methylation-modified m6A detection library may further include a step of denaturing the mixed sample before immunoprecipitation.

[0026] The denaturation can be carried out at 95°C. The denaturation time can be 5 minutes.

[0027] The method for constructing the multi-sample methylation-modified m6A detection library may further include the step of amplifying the m6A library.

[0028] In the above method for constructing a multi-sample methylation-modified m6A detection library, the multiple samples can be at least two samples.

[0029] Specifically, any number of samples sufficient to achieve 6mA detection for each sample falls within the scope of this invention. Examples include 2, 3, 4, 5, 6, 7, 8, 9, and 10 samples. In one embodiment of this invention, the plurality of samples is 10 samples.

[0030] The method of this invention can be used for large-scale 6mA detection of samples; the experimental process is simple, the DNA remains intact throughout, and the library purity and quality are high. It is particularly suitable for situations with large sample volumes, achieving efficient ligation and ultimately obtaining a library with sufficiently high concentration for sequencing and subsequent sequencing-related applications. This method avoids poor sample reproducibility, saves experimental costs and time, and allows for higher reproducibility when multiple samples are mixed for 6mA-IP.

[0031] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way. Attached Figure Description

[0032] Figure 1 This is a flowchart for multi-sample 6mA methylation detection.

[0033] Figure 2 For agarose gel electrophoresis to detect fragment distribution, the left lane shows the fragment distribution of genomic DNA after sonication, with the main bands ranging from 750-500 bp, and the right lane is the DNA molecular weight standard.

[0034] Figure 3 The quality control chart for the library shows that the distribution of library fragments is 200-700bp, which is consistent with the distribution of a typical library.

[0035] Figure 4The first image shows the distribution of 6mA modifications in the gene region within 3kb upstream and downstream of a single sample split from a mixed library, consistent with the 6mA library distribution map. The second image also includes a heatmap of 6mA modifications in the gene region of a single sample split from a mixed library, consistent with the 6mA library distribution pattern.

[0036] Figure 5 This is a distribution map of the 6mA modified gene region. Detailed Implementation

[0037] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials, reagents, instruments, etc., used in the following examples are commercially available.

[0038] Example 1: Multi-sample 6mA methylation detection method Samples to be tested: Rice seedlings subjected to low-temperature stress (CS) at three weeks of age, with stress time points of 0h (CK), 6h, 24h, 48h, and 72h. Two samples were taken from each time point to extract genomic DNA from the aboveground parts. The sample names were designated as: 6mA_IP_CSNIP_CK-1, 6mA_IP_CSNIP_CK-2, 6mA_IP_CSNIP_6h-1, 6mA_IP_CSNIP_6h-2, 6mA_IP_CSNIP_24h-1, 6mA_IP_CSNIP_24h-2, 6mA_IP_CSNIP_48h-1, 6mA_IP_CSNIP_48h-2, 6mA_IP_CSNIP_72h-1, and 6mA_IP_CSNIP_72h-2, for a total of 10 samples. The initial amount per sample was 500 ng. The multi-sample 6mA methylation detection procedure is as follows: Figure 1 As shown, the specific steps are as follows: 1. Sample fragment breaking The obtained DNA was fragmented using sonication (30s working, 60s rest, 10 cycles), and the fragment distribution was detected by 1% agarose gel electrophoresis. Figure 2 ).

[0039] 2. Fill in the end and add an A tail. The reaction system is as follows: 20 μl of the DNA fragment broken in step 1 10x NEB Buffer 2 3 μl dNTP mixture (prepared at Step C1)2 μl Klenow enzyme 5,000 U / ml 5μl.

[0040] Among them, 10x NEB Buffer 2 is a product of New England Biolabs, catalog number B7002S; dNTPmixture is a product of Thermo Fisher Scientific, catalog number 10297018; and Klenow enzyme is a product of New England Biolabs, catalog number M0212S.

[0041] The resulting reaction system was subjected to the following conditions: 30℃ for 20 min, 37℃ for 20 min, with the hot cap closed.

[0042] 3. Fragment purification and recovery 1) Vortex the VAHTS DNA Clean Beads (N411) until thoroughly mixed. Add 60 μl (2 times the volume) of VAHTS DNA Clean Beads to the reaction product obtained in step 2. Mix thoroughly with a pipette at least 10 times to ensure the entire system is homogeneous. Note: The magnetic beads are quite viscous; use a pipette to ensure a sufficient volume is obtained and dispense slowly.

[0043] 2) Incubate at room temperature for 5 min.

[0044] 3) Briefly centrifuge the reaction tube and place it on a magnetic rack to separate the magnetic beads and liquid.

[0045] 4) Keep the reaction tube on the magnetic rack and wait for the solution to become clear (about 5 minutes). Discard the supernatant, being careful not to disturb the magnetic beads.

[0046] 5) Keep the reaction tube on the magnetic rack, add 200 μl of freshly prepared 80% ethanol solution, without disturbing the magnetic beads when adding, and carefully remove the supernatant after incubation for 30 s.

[0047] 6) Repeat step 5), rinsing twice in total.

[0048] 7) Open the lid and dry for 5 minutes.

[0049] 8) After the magnetic beads have dried, remove the reaction tube from the magnetic rack, add 22 μl of double-distilled water to cover the magnetic beads, and use a pipette to mix the magnetic beads.

[0050] 9) Incubate at room temperature for 2 minutes. If the magnetic beads dry out and crack, extend the incubation time appropriately.

[0051] 10) Briefly centrifuge the reaction tube and collect the liquid in a magnetic rack to separate the magnetic beads. Continue until the solution is clear (about 5 minutes).

[0052] 11) Carefully aspirate 20 μl of the supernatant and transfer it to a new EP tube to obtain the recovered sample.

[0053] 4. Add barcodes to different samples This step adds different adapters to different samples, which facilitates subsequent 6mAIP-seq in the same tube, increases the reproducibility between samples, and greatly saves time and cost.

[0054] Barcodes were added to each sample, and the reaction systems were as follows: DNase / RNase free water 12μl T4 DNA ligase enzyme 10x buffer 5 μl Synthesized Barcode (10μM) 1 μl T4 DNA ligase (2,000,000 U / ml) 3μl 20 μl of DNA sample (i.e., the recovered sample obtained in step 3) 9 μl of sterile water.

[0055] T4 DNA ligase and T4 DNA ligase enzyme 10x buffer are products of New England Biolabs, catalog number M0202M.

[0056] The resulting reaction system was incubated at 20°C for 30 minutes, and then the hot cap was closed.

[0057] The barcode sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd. and purified by HPLC. One barcode was added to each sample, and the sequences of each barcode are shown in Table 1.

[0058] Table 1. Barcode Sequences

[0059] 5. Fragment purification and recovery This step optimizes the ratio of magnetic bead recovery and purification by adjusting the amount of magnetic beads added to 0.7 times the volume. This method can effectively remove excess barcode sequences from each sample and reduce contamination to downstream experiments.

[0060] 1) Vortex the VAHTS DNA Clean Beads (N411) to thoroughly mix them. Combine the reaction products from each sample obtained in step 4 to a total volume of 500 μl. Then add 350 μl (0.7 times the volume) of VAHTS DNAClean Beads to the mixture and mix thoroughly with a pipette at least 10 times to ensure homogeneity. Note: The magnetic beads are quite viscous; use a pipette to ensure a sufficient volume is obtained and dispense slowly.

[0061] 2) Incubate at room temperature for 5 min.

[0062] 3) Briefly centrifuge the reaction tube and place it on a magnetic rack to separate the magnetic beads and liquid.

[0063] 4) Keep the reaction tube on the magnetic rack and wait for the solution to become clear (about 5 minutes). Discard the supernatant, being careful not to disturb the magnetic beads.

[0064] 5) Keep the reaction tube on the magnetic rack, add 200 μl of freshly prepared 80% ethanol solution, without disturbing the magnetic beads when adding, and carefully remove the supernatant after incubation for 30 s.

[0065] 6) Repeat step 5), rinsing twice in total.

[0066] 7) Open the lid and dry for 5 minutes.

[0067] 8) After the magnetic beads have dried, remove the reaction tube from the magnetic rack, add 52 μl of double-distilled water to cover the magnetic beads, and use a pipette to mix the magnetic beads.

[0068] 9) Incubate at room temperature for 2 minutes. If the magnetic beads dry out and crack, extend the incubation time appropriately.

[0069] 10) Briefly centrifuge the reaction tube and collect the liquid in a magnetic rack to separate the magnetic beads. Continue until the solution is clear (about 5 minutes).

[0070] 11) Carefully aspirate 50 μl of the supernatant and transfer it to a new EP tube to obtain the recovered sample.

[0071] 6. Sample denaturation The sample recovered in step 5 was denatured at 95°C for 5 min, incubated on ice for 2 min, and then subjected to the next step of m6A-IP-seq.

[0072] Note: For measuring sample concentration, if the total concentration of the mixed sample is greater than 2 μg, m6A-IP-seq can be performed.

[0073] 7.m6A-IP-seq 1) Take an appropriate amount of 20 μl of Protein A beads (company: Invitrogen, catalog number: 10002D) and wash 3 times with 1xIP buffer (formulation: dilute 5xIP buffer 5 times to obtain 1xIP buffer); wherein, the formulation of 5xIP buffer is as follows: 0.5 ml 1 M Tris-HCl (pH 7.4) (Soleb, catalog number T1090), 1.5 ml 5 M NaCl (Soleb, catalog number S8214) and 0.5 ml (10% volume percentage) Igepal CA-630 (Sigma-Aldrich, 18896), and make up to 10 mL with sterile water; 2) Add 500 μL of 1xIP buffer, 20 μL of Protein A beads and 5 μL of anti-N6-methyladenine (Synaptic Systems, catalog number 202003) to a 1.5 mL centrifuge tube, and incubate at 4 °C for 3-4 h to obtain Protein A beads-antibody complex. 3) Wash the Protein A beads-antibody complex twice with 500 μL of 1xIP buffer; 4) Then add 100 μl of 5xIP buffer and 50 μl of the DNA sample obtained in step 6 to the Protein A beads-antibody complex, add water to make up to 500 μl, and then incubate at 4°C for 6 h on a rotary incubator. 5) Wash the reaction product obtained in step 4) three times with 500 μL of 1xIP buffer; 6) After washing in step 5), wash twice more with 100 μl of 6 mA Elution buffer; the 250 μl 6 mA Elution buffer is formulated as follows: 90 µl of 5X IP buffer, 150 µl of 20 mM N2O. 6 -Methyladenosine, 5′-monophosphate sodium salt (Sigma-Aldrich, catalog number M2780) and 210 µl of sterile water (Soleb, R1600); 7) Add 1 / 10 volume of 3M NaAC solution and 2.5 times the volume of anhydrous ethanol to 500 μl of the elution product obtained in step 6), and let it settle at -80℃ for 2 h. 8) After step 7), centrifuge the sample at 14,000 rpm at 4℃ for 30 min. Wash the precipitate twice with 75% ethanol aqueous solution, air dry at room temperature, and then add 20 μl of sterile water to obtain the DNA library.

[0074] 8. Library expansion Configure the following amplification system: 20 μl of the DNA library obtained in step 7 H2O 16 μl 5× Phusion HF Reaction buffer10 μl 10 μM PCR primer mix 2.5 μl 10 mM dNTP mix 1 μl Phusion DNA Polymerase0.5 μl.

[0075] The total volume was 50 μl. The 5× Phusion HF Reaction buffer and Phusion DNA Polymerase were both Thermo Scientific products, catalog number F530S; the 10 mM dNTP mix was a Thermo Fisher Scientific product, catalog number 10297018; the PCR primer mix consisted of equal volumes of primers F (20 μM) and R (20 μM), with the primer sequences as follows: F: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC (SEQ ID No. 1); R: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC (SEQ ID No. 2).

[0076] The obtained amplification system was amplified according to the following amplification program: 98℃ for 30 sec; 98℃ for 10 sec, 65℃ for 30 sec, 72℃ for 30 sec, 18 cycles; 72℃ for 5 min; incubation at 4℃.

[0077] 9. Document quality control and data analysis Library quality control: The library was tested using real-time quantitative PCR (QPCR), and the distribution of library fragments was found to be acceptable.

[0078] The results showed that the mixed library consisted of individual data from 10 split samples, and the data volume distribution was uniform. Figure 3 The library quality control map represents the distribution range of library fragments, conforming to the standard library, that is, the heatmap of 6mA modifications in the gene region of a single sample split from a mixed library, conforming to the distribution pattern of a 6mA library.

[0079] 10. Sequencing The library was sequenced using the Illumina HiSeq X-ten sequencing platform (Novogene), with a sequencing strategy of 150 bp reads at both ends. Sequencing data was obtained immediately after sequencing and the results were analyzed.

[0080] Figure 4 The distribution of 6mA modifications in the gene region within 3kb upstream and downstream of a single sample split from a mixed library is consistent with the distribution map of the 6mA library. Figure 5 Table 2 shows the distribution of the 6mA-modified gene region. Table 3 shows the data volume of individual libraries separated from the mixed library, indicating a uniform data volume distribution in each library, unlike the uneven distribution issues found in the mixed library. Table 3 shows the alignment rates of individual libraries separated from the mixed library, all reaching 88% or higher, indicating good data quality and integrity. The results show that this invention enables 6mA-IP with multiple samples mixed together, resulting in better uniformity of individual sample data, better reproducibility between samples, and significantly reduced experimental costs.

[0081] Table 2

[0082] Table 3

[0083] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A multi-sample method for detecting m6A methylation modification, including: A1) The nucleic acids of multiple samples are broken down separately to obtain fragments from multiple samples; A2) Add barcodes to the fragments of the multiple samples respectively and then mix them to obtain a mixed sample; A3) The resulting mixed sample was subjected to immunoprecipitation using a 6mA antibody to obtain the m6A library; A4) Sequencing the obtained m6A library enables the detection of methylated m6A in multiple samples.

2. The method according to claim 1, characterized in that: The sample is a DNA sample or an RNA sample.

3. The method according to claim 2, characterized in that: The sample is a DNA sample, and the method further includes the steps of end-padding and adding A tails to fragments of multiple samples before adding barcodes.

4. The method according to claim 3, characterized in that: The method also includes the steps of purifying after end-completion and addition of an A tail.

5. The method according to any one of claims 1-4, characterized in that: The method also includes a step of purifying fragments from multiple samples after adding barcodes to them.

6. The method according to any one of claims 1-5, characterized in that: The method further includes a step of denaturing the mixed sample prior to immunoprecipitation.

7. The method according to any one of claims 1-6, characterized in that: The method further includes the step of amplifying the m6A library.

8. The method according to any one of claims 1-7, characterized in that: The multiple samples refer to at least two samples.

9. A method for constructing a multi-sample methylation-modified m6A detection library, including: B1) The nucleic acids of multiple samples are broken down separately to obtain fragments from multiple samples; B2) Add barcodes to the fragments of the multiple samples respectively and then mix them to obtain a mixed sample; B3) The resulting mixed sample was subjected to immunoprecipitation using a 6mA antibody to obtain the m6A detection library.

10. The method according to claim 9, characterized in that: The multiple samples refer to at least two samples.

Images