Methods, compositions, and apparatus for solid-state synthesis of scalable polymers for use in single molecule sequencing

Abstract

This invention relates to methods, compositions, and apparatus for solid-state synthesis of scalable polymers used in single-molecule sequencing. The invention provides methods, compositions, and apparatus for solid-state synthesis and processing of scalable polymers (e.g., Xpandomer) for single-molecule sequencing, particularly for such synthesis, as well as methods and compositions for generating novel scalable polymer constructs that provide more accurate sequence information when passed through nanopore sensors.

Description

[0001] This application is a divisional application of the international application PCT / US2020 / 019131, filed on February 20, 2020, and entered into China with application number 202080015860.6, entitled "Method, composition and apparatus for solid-state synthesis of scalable polymers used in single-molecule sequencing".

[0002] Declaration of sequence list The sequence list related to this application is provided in text format instead of a paper copy and is incorporated herein by reference. The text file containing the sequence list is named 870225_424WO_Sequence_Listing_ST25.txt. This text file is 5 KB in size, created on February 20, 2020, and is being submitted electronically via EFS-Web. Technical Field

[0003] The present invention generally relates to novel methods, compositions, and apparatuses for single-molecule sequencing, and more specifically, to improved methods and apparatuses for the solid-state synthesis and processing of scalable polymers (e.g., Xpandomer), and further to methods and compositions for generating novel scalable polymer constructs that provide more accurate sequence information when passed through nanopore sensors. Background Technology

[0004] The measurement of biomolecules is fundamental to modern medicine, widely used in medical research, more specifically in diagnosis and treatment, and drug development. Nucleic acids encode the information necessary for the activities and reproduction of living organisms, essentially serving as a blueprint for life. Determining such a blueprint is useful in both pure research and applied sciences. In medicine, sequencing can be used to diagnose and develop treatments for a wide range of conditions, including cancer, heart disease, autoimmune diseases, multiple sclerosis, and obesity. In industry, sequencing can be used to design improved enzymatic processes or synthetic biology. For example, in biology, this tool can be used to study the health of ecosystems, thus having a wide range of applications. Similarly, the measurement of proteins and other biomolecules provides biomarkers and insights into the spread of diseases and pathogens.

[0005] An individual's unique DNA sequence provides valuable information about their susceptibility to certain diseases. It also offers patients the opportunity to screen for early detection and / or receive preventative treatment. Furthermore, based on a patient's individual profile, clinicians will be able to administer personalized therapies to maximize drug efficacy and / or minimize the risk of adverse drug reactions. Similarly, identifying pathogen profiles can provide new treatments for infectious diseases and more robust pathogen surveillance. Low-cost whole-genome DNA sequencing will lay the foundation for modern medicine. To achieve this, sequencing technologies must continuously advance in throughput, accuracy, and read length.

[0006] Over the past decade, a plethora of next-generation DNA sequencing technologies have become commercially available, significantly reducing the cost of whole-genome sequencing. These include sequencing-by-synthesis ("SBS") platforms (Illumina, Inc., 454 LifeSciences, Ion Torrent, Pacific Biosciences) and similar connection-based platforms (CompleteGenomics, Life Technologies Corporation). Many other technologies are under development, utilizing a wide variety of sample handling and detection methods. For example, GnuBio (Cambridge, Mass.) uses picoliter reaction vessels to control millions of carefully selected probes in sequencing reactions, while Halcyon Molecular (Redwood City, Calif.) is exploring techniques for direct DNA measurement using transmission electron microscopy.

[0007] Nanopore-based nucleic acid sequencing is a compelling approach that has been extensively studied. Kasianowicz et al. (Proc. Natl. Acad. Sci. USA 93: 13770-13773, 1996) characterized single-stranded polynucleotides (SNPs) during electrical translocation through α-hemolysin nanopores embedded in a lipid bilayer. It has been demonstrated that partial blockage of the nanopore pore size can be measured as a measure of the reduction in ionic current during SNP translocation. However, SNP sequencing in nanopores suffers from small signal differences immersed in significant background noise due to the need to resolve closely spaced bases (0.34 nm). The challenge of achieving single-base resolution in nanopores is further exacerbated by the observed rapid translocation rate of SNPs, typically around one base per microsecond. The translocation rate can be reduced by adjusting operating parameters such as voltage, salt composition, pH, temperature, and viscosity. However, such adjustments cannot reduce the translocation rate to a level that allows for single-base resolution.

[0008] Stratos Genomics has developed a method called Extended Sequencing (“SBX”), which uses a biochemical process to transcribe DNA sequences onto a measurable polymer called “Xpandomer” (Kokoris et al., U.S. Patent No. 7,939,259, “High Throughput Nucleic Acid Sequencing by Expansion”). The transcribed sequence is encoded along the Xpandomer backbone in high signal-to-noise ratio reporters spaced approximately 10 nm apart, designed specifically for high signal-to-noise ratio, well-differentiated responses. These differences provide a significant performance enhancement in Xpandomer’s sequence read efficiency and accuracy relative to native DNA. Xpandomer enables a variety of next-generation DNA sequencing detection technologies and is well-suited for nanopore sequencing.

[0009] Xpandomer is produced from non-natural nucleotide analogues called XNTPs, characterized by long substituents that allow the Xpandomer backbone to extend post-synthesis (see Kokoris et al., published PCT application WO2016 / 081871, which is incorporated herein by reference in its entirety). Due to their atypical structure, the polymerization of XNTPs for nanopore sequencing into Xpandomer and the processing of Xpandomer into extended forms are inefficient processes, especially in solution.

[0010] Therefore, novel methods and apparatus for improving the synthesis and processing efficiency of Xpandomer copies of nucleic acid templates to produce a full-length product population enriched for nanopore sequencing, as well as strategies for improving the accuracy of sequence information, will find value in the prior art. This invention addresses these needs and provides further related advantages.

[0011] All topics discussed in the background section are not necessarily prior art and should not be assumed to be prior art simply because they are discussed in the background section. Following these lines of thought, unless explicitly stated to be prior art, any awareness of problems in prior art discussed in the background section or related to such topics should not be considered prior art. Instead, the discussion of any topic in the background section should be considered as part of the inventor's method for solving a particular problem, and may itself be inventive. Summary of the Invention

[0012] In summary, this disclosure provides novel methods, compositions, and apparatuses for single-molecule nanopore sequencing. In some embodiments, this disclosure provides improved methods, compositions, and apparatuses for the solid-state synthesis and processing of Xpandomer, as well as methods and compositions for synthesizing Xpandomer that provide more accurate sequence information.

[0013] On one hand, this disclosure provides a method for synthesizing a copy of a nucleic acid template on a solid matrix, the method comprising the steps of: a) immobilizing a linker on a solid support, wherein the linker includes a first end proximal to the solid support and a second end distal to the solid support, wherein the first end is coupled to a maleimide moiety, the second end is coupled to an alkyne moiety, and wherein the maleimide moiety is cross-linked with the solid support; b) ligating an oligonucleotide primer to the linker, wherein the oligonucleotide primer includes a nucleic acid sequence complementary to a portion of the 3' end of the nucleic acid template, wherein the 5' end of the oligonucleotide primer is coupled to an azide moiety, and wherein the azide moiety reacts with the alkyne moiety to form a triazole moiety; c) providing a reaction mixture comprising a nucleic acid template, a nucleic acid polymerase, a nucleotide substrate or an analogue thereof, a suitable buffer, and optionally one or more additives, wherein the nucleic acid template specifically hybridizes with the oligonucleotide primer; and d) performing a primer extension reaction to produce a copy of the nucleic acid template.

[0014] In some embodiments, the maleimide portion is crosslinked with a solid matrix via a photo-initiated deprotonation reaction. In other embodiments, the solid matrix is ​​composed of a polyolefin; in alternative embodiments, the polyolefin may be a cyclic olefin copolymer (COC) or polypropylene. In some embodiments, the nucleic acid template is a DNA template and a copy of the DNA template is a scalable polymer, wherein the scalable polymer comprises chains of non-natural nucleotide analogs, and wherein each of the non-natural nucleotide analogs is operatively linked to an adjacent non-natural nucleotide analog via an aminophosphate bond (e.g., Xpandomer). In other embodiments, the linker further comprises a spacer arm inserted between the first end and the second end, wherein the spacer arm comprises one or more monomers of ethylene glycol. In some embodiments, the linker further comprises a cleavable portion. In other embodiments, the solid support is selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

[0015] In another aspect, this disclosure provides a method for selectively modifying the 3' end of a copy of a nucleic acid target sequence, the method comprising the steps of: a) providing a first oligonucleotide sequence having a sequence complementary to a first sequence of a target nucleic acid and a second oligonucleotide having a sequence complementary to a second sequence of the nucleic acid target sequence, wherein the first sequence of the nucleic acid target sequence is at the 3' end of the second sequence of the nucleic acid target sequence, wherein the first oligonucleotide provides an extension primer for a nucleic acid polymerase, and the 5' end of the second oligonucleotide is operatively linked to dideoxynucleotide 5' triphosphate, wherein dideoxynucleotide 5' triphosphate provides a substrate for the nucleic acid polymerase; b) providing a reaction mixture comprising the first and second oligonucleotides, the nucleic acid target sequence, the nucleic acid polymerase, the nucleotide substrate or analogues thereof, a suitable buffer, and optionally one or more additives, wherein the first and second oligonucleotides specifically hybridize to the nucleic acid target sequence; c) performing a primer extension reaction to produce a copy of the target sequence, wherein the 5' end of the second oligonucleotide is operatively linked to the 3' end of the copy of the nucleic acid target sequence via the nucleic acid polymerase.

[0016] In some embodiments, the dideoxynucleotide 5' triphosphate is operatively linked to the 5' end of the second oligonucleotide via a flexible linker. In other embodiments, the flexible linker comprises one or more hexyl (C6) monomers. In other embodiments, the second oligonucleotide comprises one or more 2' methoxyribonucleic acid analogs. In other embodiments, the 3' end of the second oligonucleotide is immobilized on a first solid support, and in some embodiments, the method further comprises washing the first solid support to purify a copy of the nucleic acid target operatively linked to the second oligonucleotide. In another embodiment, the first oligonucleotide is immobilized on the first solid support, and in some embodiments, the method further comprises releasing a copy of the nucleic acid target sequence from the first solid support and contacting the copy of the nucleic acid target sequence with a third oligonucleotide, wherein the third oligonucleotide has a sequence complementary to the sequence of the second oligonucleotide, wherein the third oligonucleotide specifically hybridizes with the second oligonucleotide, and wherein the 5' end of the third oligonucleotide is immobilized on the second solid support, and in other embodiments, further comprises washing the second solid support to purify a copy of the nucleic acid target sequence operatively linked to the second oligonucleotide at its 3' end. In other embodiments, the second oligonucleotide comprises one or more nucleotide analogs that increase the binding affinity of the second oligonucleotide to the nucleic acid target sequence. In other embodiments, the second oligonucleotide is complementary to a heterologous nucleic acid sequence operatively linked to the 5' end of the nucleic acid target sequence. In some embodiments, the nucleic acid target sequence is single-stranded DNA, and a copy of the target sequence is a scalable polymer, wherein the scalable polymer comprises chains of non-natural nucleotide analogs, and wherein each of the non-natural nucleotide analogs is operatively linked to an adjacent non-natural nucleotide analog via an aminophosphate bond. In some embodiments, the first solid support and the second solid support are selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

[0017] In another aspect, this disclosure provides a method for generating a library of single-stranded DNA template constructs, wherein each template construct comprises two copies of the same strand of a DNA target sequence, the method comprising the steps of: a) providing a group of DNA Y-shaped adaptors, wherein each Y-shaped adaptor comprises a first oligonucleotide and a second oligonucleotide, wherein the 3' region of the first oligonucleotide and the 5' region of the second oligonucleotide form a double-stranded region through sequence complementarity, wherein the 5' region of the first oligonucleotide and the 3' region of the second oligonucleotide are single-stranded and include binding sites for oligonucleotide primers, and wherein the ends of the single-stranded regions of the first oligonucleotide and the second oligonucleotide are optionally fixed to a solid matrix; b) providing a group of double-stranded DNA molecules, wherein each double-stranded DNA molecule comprises a first strand and a second strand, wherein the first end of each double-stranded DNA molecule is compatible with the double-stranded ends of the Y-shaped adaptors; c) Provide a capped primer adapter group, wherein each capped primer adapter includes a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide is inserted between the first oligonucleotide and the third oligonucleotide, wherein the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide are operatively linked by chemical branching at the 5' end of the first oligonucleotide and the third oligonucleotide and at the 3' end of the second oligonucleotide, wherein a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, wherein a portion of the sequence of the second oligonucleotide is the reverse complementary sequence of portions of the sequences of the first oligonucleotide and the third oligonucleotide, and wherein the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region compatible with the second end of each of the double-stranded DNA molecules; d) ligating the second end of each double-stranded DNA molecule to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of a capped primer adapter; e) ligating the first end of each double-stranded DNA molecule to the double-stranded end of one of the DNA Y-shaped adapters; f) using DNA The polymerase extends from the 3' end of the first oligonucleotide of each of the connected cap primer adaptors, wherein the first strand of the connected double-stranded DNA molecule provides a template for the DNA polymerase, and wherein the DNA polymerase produces a third strand comprising the reverse complementary sequence of the sequence of the first strand of the double-stranded DNA molecule and the sequence of the first oligonucleotide of the Y-shaped adaptor.and g) digestion of the 5' end of the first oligonucleotide of each linked Y-shaped adaptor with an exonuclease, wherein digestion removes the first oligonucleotide, the first strand of the double-stranded DNA molecule, and the second oligonucleotide of the cap primer adaptor to produce a single-stranded template construct, wherein each single-stranded template construct comprises two template molecules, each template molecule comprising the sequence of the second strand of the double-stranded DNA molecule, and wherein the two template molecules are operatively linked by the first and third oligonucleotides of the cap primer adaptor.

[0018] In another aspect, this disclosure provides a single-stranded DNA template construct library, wherein each of the template constructs includes a first copy and a second copy of the same strand of a DNA target sequence, wherein the first copy and the second copy of the target sequence are operatively linked; and wherein the single-stranded DNA template construct library is generated by the method described above.

[0019] In another aspect, this disclosure provides a method for generating a mirror-image Xpandomer molecular library, wherein each of the Xpandomer molecules comprises two copies of the same strand of a DNA target sequence, the method comprising the steps of: a) providing a single-stranded DNA template construct library as described above; b) providing a first group of extended oligonucleotides complementary to a single-stranded portion of the first strand of the Y-shaped adaptor and a second group of extended oligonucleotides complementary to a single-stranded portion of the second strand of the Y-shaped adaptor, wherein the first or second extended oligonucleotide is optionally immobilized on a solid matrix; c) specifically hybridizing the single-stranded DNA template construct library with the first and second extended oligonucleotide groups; d) providing a cap-branch construct group, wherein the cap-branch construct comprises a first oligonucleotide operatively linked to the second oligonucleotide, wherein the first and second oligonucleotides contain sequences complementary to a portion of the sequences of the first and third oligonucleotides of the cap primer adaptor construct, and wherein the first and second oligonucleotides of the cap-branch construct provide a free 5' nucleoside triphosphate moiety; e) f) Perform primer extension reaction to generate a first and a second Xpandomer copy of the DNA target sequence, wherein the Xpandomer copy is operatively linked via the cap branch construct.

[0020] In another aspect, this disclosure provides a method for generating a tagged double-stranded DNA amplicon library on a solid support, the method comprising the steps of: a) providing a population of double-stranded DNA molecules, wherein each of the double-stranded DNA molecules includes a first strand that specifically hybridizes to a second strand; b) providing forward PCR primers and reverse PCR primers, wherein the forward PCR primers include a first 5' heterotag sequence, the first 5' heterotag sequence being operatively ligated to a 3' sequence complementary to a portion of the 3' end of the second strand of the double-stranded DNA molecule, and wherein the reverse PCR primers include a second 5' heterotag sequence, the second 5' heterotag sequence being operatively ligated to a 3' sequence complementary to a portion of the 3' end of the first strand of the double-stranded DNA molecule; c) performing a first PCR reaction, wherein the population of double-stranded DNA molecules is amplified to generate a first population of DNA amplicon products, wherein the first DNA amplicon products include a first heteroque sequence tag at a first end and a second heteroque sequence tag at a second end; d) A capture oligonucleotide structure immobilized on a solid support is provided, wherein the capture oligonucleotide structure includes a first end and a second end, wherein the first end is covalently linked to the solid support, wherein the second end includes a capture oligonucleotide, the capture oligonucleotide including a sequence complementary to a portion of a second heterologous sequence tag of a first DNA amplicon product group, and wherein the capture oligonucleotide structure further includes a cleavable element inserted between the first end and the capture oligonucleotide; and e) performing a second PCR reaction, the second PCR reaction including a first DNA amplicon product group, a forward primer including a sequence complementary to a sequence of one strand of the first heterologous sequence tag, and a reverse primer including a sequence complementary to a sequence of one strand of the second heterologous sequence tag, wherein a first strand of the first DNA amplicon product group specifically hybridizes to the capture oligonucleotide, and wherein the second PCR reaction produces an immobilized DNA amplicon product group, wherein a second strand of the immobilized DNA amplicon product is operatively linked to the solid support.

[0021] On the other hand, this disclosure provides a method for preparing a single-stranded DNA template construct library, wherein each template construct comprises two copies of the same strand of a DNA target sequence, the method comprising the following steps: a) providing a DNA amplicon product library immobilized on a solid support as described in the previous paragraph; b) providing a cap primer adaptor group, wherein each cap primer adaptor comprises a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide is inserted between the first oligonucleotide and the third oligonucleotide, wherein the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide are operatively linked by chemical branching at the 5' end of the first oligonucleotide and the 3' end of the second oligonucleotide, wherein a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, wherein a portion of the sequence of the second oligonucleotide is the reverse complementary sequence of portions of the sequences of the first oligonucleotide and the third oligonucleotide, and wherein the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region compatible with the free ends of each tagged immobilized DNA amplicon product; c) attaching each immobilized DNA... The free ends of the amplicon product are attached to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of the cap primer adapter; d) extending from the 3' end of each first oligonucleotide of the cap primer adapter with a DNA polymerase, wherein the second strand of the immobilized DNA amplicon product provides a template for the DNA polymerase, and wherein the DNA polymerase produces a third strand, wherein the third strand is a copy of the second strand; e) cleaving a cleavable element of each of the captured oligonucleotide structures, wherein the cleavage releases the DNA amplicon product from the solid support and produces a free 5' end on the second strand of each of the DNA amplicon products; and f) digesting from the free 5' end of the cleaved second strand of each of the DNA amplicon products with an exonuclease, wherein the digestion removes the second strand of the DNA amplicon product and the second oligonucleotide of the cap primer adapter to produce a single-stranded template construct library, wherein each single-stranded template construct comprises two copies of the first strand of the DNA amplicon product operatively linked by the first and third oligonucleotides of the cap primer adapter.

[0022] In another aspect, this disclosure provides a single-stranded DNA template construct library, wherein each of the template constructs includes a first copy and a second copy of the same strand of a DNA target sequence, wherein the first copy and the second copy of the DNA target sequence are operatively linked; and wherein the single-stranded DNA template construct library is generated by the method described in the preceding paragraph.

[0023] In another aspect, this disclosure provides a method for generating a mirror-image Xpandomer molecular library, wherein each of the Xpandomer molecules comprises two copies of the same strand of a DNA target sequence, the method comprising the steps of: a) providing a single-stranded DNA template construct library as described above; b) providing an extension oligonucleotide group complementary to a second tag of the DNA amplicon product, wherein the extension oligonucleotides are immobilized on a solid matrix; c) specifically hybridizing the single-stranded DNA template construct with the extension oligonucleotides; d) providing a cap-branch construct group, wherein the cap-branch construct includes a first oligonucleotide operatively linked to the second oligonucleotide, wherein the first and second oligonucleotides contain sequences complementary to a portion of the sequences of the first and third oligonucleotides of the cap primer adapter construct, and wherein the first and second oligonucleotides of the cap-branch construct provide a free 5' nucleoside triphosphate moiety; e) specifically hybridizing the cap-branch construct group with the DNA template construct group; and f) performing a primer extension reaction to generate Xpandomer copies of the first and second copies of the DNA target sequence, wherein the Xpandomer Copy the operable link to the hat branch construct.

[0024] In some embodiments, the capturing oligonucleotide structure and the extending oligonucleotide are immobilized on the same solid support, wherein the extending oligonucleotide includes a cleavable hairpin structure, and wherein the cleavable hairpin structure is cleaved in a cleavage step to provide a binding site for the DNA amplicon product. In other embodiments, the capturing oligonucleotide structure is immobilized on a first matrix of a first chamber of a microfluidic card, and the extending oligonucleotide is immobilized on a second matrix of a second chamber of the microfluidic card, wherein the first chamber is configured to generate the single-stranded DNA template construct population, and the second chamber is configured to generate the Xpandomer copy population of the single-stranded DNA template construct. In other embodiments, the capturing oligonucleotide structure is immobilized on a bead support, and the extending oligonucleotide is immobilized on a COC chip support, wherein the bead support is configured to generate the single-stranded DNA template construct population, and the COC chip support is configured to generate the Xpandomer copy population of the DNA template construct. In other embodiments, the capturing oligonucleotide structure and the extending oligonucleotide are immobilized on a bead support configured to generate a single-stranded DNA template construct population and an Xpandomer copy population of the DNA template construct. In another embodiment, the extending oligonucleotide is provided by a branched oligonucleotide structure comprising a first extending oligonucleotide operatively linked to a second extending oligonucleotide via a chemical branch, wherein the first extending oligonucleotide comprises a leader sequence, a concentrator sequence, and a first cleavable portion inserted between the chemical branch and the leader and concentrator sequences, and wherein the second extending oligonucleotide comprises a second cleavable portion.

[0025] The above and additional features of the invention, and the ways in which they are obtained, will become apparent, and the invention will be best understood by reference to the following more detailed description. All references disclosed herein are incorporated herein by reference in their entirety as if each reference were individually incorporated.

[0026] This brief overview is provided to introduce certain concepts in a simplified form, which will be described in further detail below. Unless otherwise expressly stated, this brief overview is not intended to identify key or essential features of the claimed subject matter, nor is it intended to limit the scope of the claimed subject matter.

[0027] Details of one or more embodiments are set forth in the following description. Features shown or described in conjunction with an exemplary embodiment may be combined with features of other embodiments. Therefore, any of the various embodiments described herein may be combined to provide further embodiments. Modifications may be made to various aspects of the embodiments, employing concepts from various patents, applications, and disclosures as identified herein, to provide other further embodiments, if necessary. Other features, objects, and advantages will be apparent from the description, drawings, and claims. Attached Figure Description

[0028] Exemplary features, their nature, and various advantages of this disclosure will become apparent from the following detailed description of the accompanying drawings and various embodiments. Non-limiting and non-exhaustive embodiments are described with reference to the accompanying drawings, wherein, unless otherwise stated, the same labels or reference numerals refer to the same parts in the various views. The dimensions and relative positions of the elements in the drawings are not necessarily drawn to scale. For example, the shapes of various elements are selected, enlarged, and positioned to improve the readability of the drawings. Specific shapes of the drawn elements have been selected for ease of identification in the drawings.

[0029] Figures 1A, 1B, 1C, and 1D are simplified diagrams illustrating the key features of generalized XNTPs and their use in extended sequencing (SBX).

[0030] Figure 2 is a schematic diagram illustrating more details of one embodiment of XNTP.

[0031] Figure 3 is a schematic diagram illustrating one embodiment of Xpandomer passing through a biological nanopore.

[0032] Figures 4A, 4B, 4C, 4D and 4E are schematic diagrams illustrating exemplary embodiments of surface chemistry used for solid-phase Xpandomer synthesis.

[0033] Figure 5 is a schematic diagram illustrating a general example of providing acid-resistant beads functionalized and immobilizing an extended oligonucleotide / DNA template complex thereon.

[0034] Figure 6A is a schematic diagram providing a general description of the end-capping method.

[0035] Figure 6B shows the gel containing the primer extension product.

[0036] Figures 7A-7D are schematic diagrams illustrating the general features of an exemplary embodiment of the end cap.

[0037] Figures 8A-8F are schematic diagrams illustrating the steps of an embodiment of solid-phase Xpandomer synthesis.

[0038] Figures 9A-9D are schematic diagrams illustrating the steps of another embodiment of solid-phase Xpandomer synthesis.

[0039] Figures 10A and 10B are schematic diagrams illustrating alternative strategies to prevent polymerase “short-circuiting” during the capping process.

[0040] Figures 11A, 11B, and 11C are schematic diagrams outlining the steps of one embodiment of mirror library construction and synthesis for Xpandomer.

[0041] Figure 12 is a schematic diagram of the general features of an embodiment of the cap connector construct.

[0042] Figure 13 summarizes an example of the workflow for generating an Xpandomer mirror library.

[0043] Figures 14A and 14B are schematic diagrams outlining the steps of one embodiment for generating an immobilized library of DNA amplicon.

[0044] Figures 15A and 15B are schematic diagrams outlining the steps of one embodiment of solid-state synthesis of a mirror template building block library generated by the Xpandomer mirror library.

[0045] Figures 16A and 16B are schematic diagrams illustrating the steps of another embodiment of solid-state synthesis of a construct library for Xpandomer mirror library synthesis.

[0046] Figure 17 summarizes an example of a workflow for generating Xpandomer mirror libraries using different solid supports.

[0047] Figure 18 is a schematic diagram of the general characteristics of branched-elongation oligonucleotide structures.

[0048] Figures 19A and 19B are schematic diagrams outlining the steps of one embodiment of solid-state synthesis of the Xpandomer mirror library using branched-extension oligonucleotides.

[0049] Figure 20 shows the gel containing the primer extension product.

[0050] Figure 21A shows a gel displaying the primer extension product.

[0051] Figure 21B shows the histogram alignment of sequencing reads from nanopores.

[0052] Figure 22 shows the gel containing the primer extension product with capped ends.

[0053] Figure 23 shows the gel containing the primer extension product with capped ends.

[0054] Figure 24A is a schematic diagram depicting one embodiment of a three-pronged connector that links to a library fragment.

[0055] Figure 24B shows the gel connecting the trifid linker to the library fragment.

[0056] Figure 25A is a schematic diagram depicting an embodiment of the extension and digestion reaction of the M1 mirror library construct to produce the M3 mirror library construct.

[0057] Figure 25B shows the gel containing the products of the extension and digestion reaction.

[0058] Figure 26A is a schematic diagram depicting an embodiment of solid-state synthesis of the M1 mirror library construct.

[0059] Figure 26B shows a gel of the solid synthesis product of the M1 mirror library construct.

[0060] Figure 27 is a schematic diagram depicting one embodiment of a template used for Xpandomer mirror library synthesis.

[0061] Figure 28 shows the gels containing the products of each stage of the mirror library construction.

[0062] Figure 29 shows nanopore traces representing a portion of the sequence of the mirror library Xpandomer.

[0063] Figure 30 shows the gel of the Xpandomer product synthesized on acid-resistant magnetic beads.

[0064] Figure 31 shows the synthesis of Xpandomer products and the gel processed on acid-resistant magnetic beads. Detailed Implementation

[0065] The invention can be more readily understood by referring to the following detailed description of preferred embodiments and examples included herein. Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0066] Unless otherwise indicated, the present invention will be practiced using conventional techniques such as molecular biology, microbiology, and recombinant DNA, which are within the scope of the art. Such techniques are well described in the literature. See, for example, Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory Manual, 2nd Edition (1989), Oligonucleotide Synthesis (MJ Gait Ed., 1984), Enzymatic Methods Series (Academic Press), Current Protocols in Molecular Biology (FM Ausubel, R. Brent, RE Kingston, DD Moore, JG Siedman, JASmith, and K. Struhl, eds., 1987). All patents, patent applications, and publications mentioned above and below are hereby incorporated by reference.

[0067] 1. Definition As used herein, a “nucleic acid,” also known as a polynucleotide, is a covalently linked chain of nucleotides in which the 3’ position of the pentose sugar of one nucleotide is linked to the 5’ position of the next nucleotide by a phosphodiester group. Nucleic acid molecules can be deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or a combination of both. DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are biologically existing polynucleotides in which nucleotide residues are linked in a specific sequence by phosphodiester bonds. As used herein, the terms “nucleic acid,” “polynucleotide,” or “oligonucleotide” include any polymeric compound having a linear backbone of nucleotides. Oligonucleotides, also known as oligomers, are typically shorter, chain-like polynucleotides. When targeted for sequencing, nucleic acids are often referred to as “target nucleic acids,” “target sequences,” “templates,” or “library fragments.”

[0068] The term "template" refers to the DNA strand that sets the genetic sequence for a new strand.

[0069] As used herein, the term “template-dependent mode” is intended to refer to a process involving template-dependent extension of primer molecules (e.g., DNA synthesis via DNA polymerase). The term “template-dependent mode” refers to the synthesis of polynucleotides in RNA or DNA, where the sequence of the newly synthesized polynucleotide chain is determined by well-known complementary base pairing rules (see, for example, Watson, JD et al., In: Molecular Biology of the Gene, 4th Ed., WABenjamin, Inc., Menlo Park, Calif. (1987)).

[0070] As used herein, the term "primer" refers to a short nucleic acid chain that is complementary to a sequence in another nucleic acid and serves as a starting point for DNA synthesis. Preferably, the primer has a length of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 18, at least 20, at least 25, at least 30 or more bases.

[0071] As used herein, the term "chain" refers to a nucleic acid composed of nucleotides covalently linked together by phosphodiester bonds. A chain of a nucleic acid does not include nucleotides that are bound solely by hydrogen bonds, i.e., by base pairing, although the chain can pair with complementary chain bases via hydrogen bonding. When the first and second chains pair with complementary bases, the first chain can be referred to as the "positive" chain, "sense" chain, or "5' to 3'" chain, and the second chain can be referred to as the "negative" chain, "antense" chain, or "3' to 5'" chain (and vice versa).

[0072] As used herein, the term "3' end" refers to the end of a nucleotide chain that has a hydroxyl group on the third carbon of the sugar ring of a deoxyribose at its end.

[0073] As used herein, the term "5' end" refers to the end of a nucleotide chain that has the fifth carbon in a sugar ring containing deoxyribose at its end.

[0074] The term "complementary" refers to base pairing that allows for the formation of a double helix between nucleotides or nucleic acids, such as between the two strands of a double-stranded DNA molecule, between an oligonucleotide primer and a primer-binding site on a single-stranded nucleic acid, or between an oligonucleotide probe and its complementary sequence in a DNA molecule. Complementary nucleotides are typically A and T (or A and U), or C and G. Two single-stranded DNA molecules are said to be substantially complementary when the nucleotides of one strand are optimally aligned and compared with appropriate nucleotide insertions or deletions, pairing with approximately 60%, at least 70%, at least 80%, at least 85%, typically at least about 90% to about 95%, or even about 98% to about 100% of the other strand. The degree of identity between two nucleotide regions is determined using algorithms implemented in a computer and methods known to those skilled in the art. The identity between two nucleotide sequences is preferably determined using the BLASTN algorithm (BLAST Manual, Altschul, S. et al., NCBI NLM NIHBethesda, Md. 20894, Altschul, S. et al., J., 1990, Mol. Biol. 215:403-410).

[0075] "Hybridization" refers to the non-covalent binding of two single-stranded polynucleotides to form a stable double-stranded polynucleotide. "Hybridization conditions" typically include a salt concentration of about 1 M or less, more typically less than about 500 mM, and can be less than about 200 mM. "Hybridization buffer" is a buffered salt solution, such as 5% SSPE, or other such buffers known in the art. Hybridization temperatures can be as low as 5 °C, but are typically above 22 °C, more typically above about 30 °C, and usually above 37 °C. Hybridization is typically performed under stringent conditions, i.e., conditions under which the primers will hybridize with their target sequence but not with other non-complementary sequences. Stringent conditions are sequence-dependent and vary under different conditions. For example, longer fragments may require higher hybridization temperatures for specific hybridization than shorter fragments. Because other factors can affect the stringency of hybridization, including the base composition and length of the complementary strand, the presence of organic solvents, and the degree of base mismatch, the combination of parameters is more important than the absolute measurement of any single parameter alone. Stringent conditions are typically chosen to be about 5 °C lower than the Tm of the specific sequence at defined ionic strengths and pH values. Exemplary stringent conditions include a salt concentration of at least 0.01 M to no more than 1 M sodium ion concentration (or other salt) at a pH of about 7.0 to about 8.3 and a temperature of at least 25°C.

[0076] When nucleic acids are in a functional relationship with each other, they are "operably linked." Generally, an "operably linked" connection means that the linked nucleic acid sequences are close to each other. Ligation can be enzymatically catalyzed, for example by nucleoside ligases or polymerases.

[0077] As used herein, the term "double-stranded DNA library" can refer to a library containing two strands (i.e., sense and antisense strands) of a DNA molecule, which can be physically linked at one of their ends to form part of the same molecule. A double-stranded DNA molecule library can be, but is not limited to, genomic DNA (nuclear DNA, mitochondrial DNA, chloroplast DNA, etc.), plasmid DNA, or double-stranded DNA molecules (e.g., DNA, cDNA, mRNA) obtained from single-stranded nucleic acid samples.

[0078] As used herein, "nucleic acid polymerase" is an enzyme commonly used to link 3'-OH 5'-triphosphate nucleotides, oligomers, and their analogues. Polymerases include, but are not limited to, DNA-dependent DNA polymerase, DNA-dependent RNA polymerase, RNA-dependent DNA polymerase, RNA-dependent RNA polymerase, T7 DNA polymerase, T3 DNA polymerase, T4 DNA polymerase, T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, DNA polymerase 1, and the Klenow fragment. thermophilic bacteria DNA polymerase, Tth DNA polymerase, VentR® DNA polymerase (New England Biolabs), Deep VentR® DNA polymerase (New England Biolabs), Bst DNA polymerase large fragment, Stoeffel fragment, 9° N DNA polymerase, 9° N DNA polymerase, Pfu DNA polymerase, Tfl DNA polymerase, Tth DNA polymerase, RepliPHI Phi29 polymerase, Tli DNA polymerase, eukaryotic DNA polymerase β, telomerase, Therminator™ polymerase (New England Biolabs), KOD HiFi™ DNA polymerase (Novagen), KOD1 DNA polymerase, Q-β replicase, terminal transferase, AMV reverse transcriptase, M-MLV reverse transcriptase, Phi6 reverse transcriptase, HIV-1 reverse transcriptase. The polymerases according to the present invention can be variants, mutants, or chimeric polymerases.

[0079] As used herein, “DPO4-type DNA polymerase” refers to a DNA polymerase or related Y-family DNA polymerase naturally expressed by archaea, sulfur-leaved fungi, or other fungi that typically functions in the replication of damaged DNA through a process called transdamage synthesis (TLS). Y-family DNA polymerases are homologous to DPO4 polymerases; examples include prokaryotic enzymes PolII, PolIV, PolV, archaea Dbh, and eukaryotic enzymes Rev3p, Rev1p, Polƞ, REV3, REV1, PolĮ, and Polĸ DNA polymerases, and their chimeras.

[0080] As used herein, a “DPO4 variant” is a modified recombinant DPO4-type DNA polymerase comprising one or more mutations relative to the naturally occurring wild-type DPO4-type DNA polymerase, such as one or more mutations that increase the ability to utilize macronucleotide analogs as substrates or other polymerase properties, and may include additional alterations or modifications to the wild-type DPO4-type DNA polymerase, such as one or more deletions, insertions, and / or fusions of additional peptide or protein sequences (e.g., for immobilizing the polymerase on a surface or otherwise labeling the polymerase). Examples of DPO4 variant polymerases according to the invention are variants of *D. sulfidea* DPO4 described in published PCT patent application WO2017 / 087281 A1 and PCT patent applications PCTUS2018 / 030972 and PCTUS2018 / 64794, which are incorporated herein by reference in their entirety.

[0081] As used herein, "nucleic acid polymerase reaction" refers to the template-dependent preparation of new nucleic acid chains or the extension of existing nucleic acids (e.g., DNA or RNA). in vitro Method. According to the present invention, the nucleic acid polymerase reaction includes a primer extension reaction, which results in the incorporation of a nucleotide or nucleotide analog into the 3' end of a primer, such that the incorporated nucleotide or nucleotide analog is complementary to the corresponding nucleotide of the target polynucleotide. The primer extension product of the nucleic acid polymerase reaction can be further used for single-molecule sequencing or as a template for the synthesis of additional nucleic acid molecules.

[0082] As used in this article, the term "multiple" means "at least two".

[0083] “XNTP” is a scalable, 5'-triphosphate-modified nucleotide substrate compatible with template-dependent enzymatic polymerization. XNTP has two distinct functional components: a nucleoside base 5'-triaminophosphate and a tandem chain linked in each nucleoside triaminophosphate, the position of which allows for controlled expansion via intranucleotide cleavage of the aminophosphate bond. As used herein, XNTP is an exemplary “non-natural, highly substituted nucleotide analog substrate.” Exemplary XNTPs and methods of their manufacture are described, for example, in PCT application WO2016 / 081871 published by the applicant, the entire contents of which are incorporated herein by reference.

[0084] The “Xpandomer intermediate” is an intermediate product assembled by XNTPs (also referred to herein as the “daughter strand”), and is formed by template-directed assembly mediated by XNTP polymerase using a target nucleic acid template. The newly synthesized Xpandomer intermediate is a constrained Xpandomer. In a process step where the aminophosphate bonds provided by XNTPs are cleaved, the constrained Xpandomer becomes unconstrained and extends as the chain lengthens.

[0085] "Xpandomer" or "Xpandomer product" is a synthetic molecular construct generated by constrained Xpandomer amplification, synthesized itself via template-directed assembly of an XNTP substrate. Xpandomer is elongated relative to the target template from which it originates. It consists of tandem subunits, each subunit being a motif, and each motif being a member of a library, including sequence information, tandem strands, and optionally some or all of the substrate, all derived from a formative substrate construct. Xpandomer is designed to extend longer than the target template, thereby reducing the linear density of the target template's sequence information along its length. Furthermore, Xpandomer optionally provides a platform for increasing the size and abundance of the reporter, thereby improving the signal-to-noise ratio of detection. The lower linear information density and stronger signal improve resolution and reduce the sensitivity requirements for detecting and decoding the template strand sequence.

[0086] A “chain” or “chain member” refers to a polymer or molecular construct having a generally linear size and a terminal portion at each of its two opposite ends. Chains form XNTPs by linking to nucleoside triphosphates at the terminal portions. Bonds are used to constrain the chain in a “constrained configuration.” Chains have both “constrained configurations” and “extended configurations.” Constrained configurations are found in XNTPs and daughter chains or Xpandomer intermediates. The constrained configuration of a chain is a precursor to the extended configuration, as seen in Xpandomer products. The transition from a constrained configuration to an extended configuration results in the cleavage of selectively cleavable aminophosphate bonds. A chain contains one or more reporter or reporter constructs along its length that can encode sequence information of the matrix. Chains provide a method for extending the length of Xpandomer, thereby reducing the linear density of sequence information.

[0087] A “tethering element” or “tethering segment” is a polymer with a generally linear size and two ends, wherein the ends form terminal bonds for connecting the tethering element. A tethering element is a segment of a tether. Such polymers may include, but are not limited to: polyethylene glycol, polyethylene glycol, polypyridine, polyisocyanate, polyisocyanate, poly(triarylmethyl)methacrylate, polyaldehyde, polypyrrolidone, polyurea, polyethylene glycol phosphate diester, polyacrylate, polymethacrylate, polyacrylamide, polyethylene ester, polystyrene, polyamide, polyurethane, polycarbonate, polybutyrate, polybutadiene, polybutyrolactone, polypyrrolidone, polyphosphonate, polyacetamide, polysaccharide, polyhyaluronic acid ester, polyamide, polyimide, polyester, polyethylene, polypropylene, polystyrene, polycarbonate, polyterephthalate, polysilane, polyurethane, polyether, polyamino acid, polyglycine, polyproline, N-substituted polylysine, peptide, N-substituted peptide with side chain, poly-N-substituted glycine, peptide-like peptide, carboxyl-substituted peptide with side chain, homopeptide, oligonucleotide, ribonucleic acid oligonucleotide, deoxynucleic acid oligonucleotide, modified to prevent Watson-Crick Oligonucleotides with base pairing, oligonucleotide analogs, polycytidylic acid, polyadenylic acid, polyuridine acid, polythymidine, polyphosphate, polynucleotides, polynucleotides, polyethylene glycol-phosphate diesters, peptide polynucleotide analogs, threonine-polynucleotide analogs, ethylene glycol-polynucleotide analogs, morpholine-polynucleotide analogs, locked nucleotide oligomer analogs, polypeptide analogs, branched polymers, comb polymers, star polymers, dendritic polymers, random polymers, gradient and block copolymers, anionic polymers, cationic polymers, stem-ring polymers, rigid segments and flexible segments.

[0088] A reporter consists of one or more reporter elements. Reporter elements are used to analyze the genetic information of a target nucleic acid.

[0089] A reporter construct contains one or more reporters that generate a detectable signal, which typically contains sequence information. This signal information is called the "reporter code," and is subsequently decoded into gene sequence data. The reporter construct may also contain chain segments or other structural components, including polymers, graft copolymers, block copolymers, affinity ligands, oligomers, haptens, aptamers, dendritic polymers, linker groups, or affinity-binding groups (e.g., biotin).

[0090] "Reporter codes" are genetic information derived from the measurement signals of reporter constructs. Reporter codes are decoded to provide sequence-specific genetic information data.

[0091] As used herein, the terms “solid support,” “solid,” “support,” and “matrix” are used interchangeably and refer to a material or group of materials having a rigid or semi-rigid surface. In many embodiments, at least one surface of the solid support is substantially flat, such as the surface of a polymeric microfluidic card or chip. In some embodiments, it may be necessary to physically separate regions of the card or chip for different reactions with, for example, etched channels, trenches, holes, raised regions, pins, etc. According to other embodiments, the solid support will take the form of insoluble beads, resins, gels, films, microspheres, or other geometries composed of, for example, controlled-pore glass (CPG) and / or polystyrene.

[0092] As used herein, the term "immobilization" refers to the association, connection, or binding between a molecule (e.g., a linker, adaptor, oligonucleotide) and a support in a manner that provides stable binding under conditions of extension, amplification, linkage, and other processes described herein. This binding can be covalent or non-covalent. Non-covalent binding includes electrostatic, hydrophilic, and hydrophobic interactions. Covalent binding is the formation of a covalent bond, characterized by the sharing of electron pairs between atoms. This covalent binding can be formed directly between the molecule and the support, or it can be formed by a crosslinking agent or by including specific reactive groups on the support or the molecule, or both. Covalent linkage of molecules can be achieved by using binding partners immobilized on a support, such as avidin or streptavidin, and by the non-covalent binding of biotinylated molecules to avidin or streptavidin. Immobilization may also involve combinations of covalent and non-covalent interactions.

[0093] As used herein, the term "click reaction" is generally accepted in the art to describe a collection of highly reliable and self-directed organic reactions, such as the most well-known copper-catalyzed azide-alkyne [3+2] cycloaddition. Non-limiting examples of click chemistry reactions can be found, for example, HC Kolb, MG Finn, KB Sharpless, Angew. Chem. Int. Ed. 2001, 40, 2004 and EM Sletten, CR Bertozzi, Angew. Chem. Int. Ed. 2009, 48, 6974, the disclosures of which are incorporated herein by reference in their entirety for all purposes.

[0094] An exemplary click chemistry reaction is the azide-alkyne Huisgen cycloaddition (e.g., using a copper (Cu) catalyst at room temperature). (Rostovtsev, et al. 2002 Angew. Chemie Int'l Ed. 41 (14): 2596-2599; Tornee, et al. 2002 J. Org. Chem. 67 (9): 3057-3064). Other examples of click chemistry include thiol-alkene click reactions, Diels-Alder reactions and reverse electron-demanding Diels-Alder reactions, and the [4+1] cycloaddition between isonitriles (isocyanates) and tetrazines. (See, for example, Hoyle et al. 2010 Angew. Chemie Int'lEd. 49 (9): 1540-1573; Blackman et al. 2008 J. Am. Chem. Soc. 130 (41): 13518-13519; Devaraj et al. 2008 Bioconjugate Chem. 19 (12): 2297-2299; Stockmann et al. 2011 Org. Biomol. Chem. 9, 7303-7305).

[0095] The term "alkyne" refers to a hydrocarbon having at least one carbon-carbon triple bond. As used herein, the term "terminal alkyne" refers to an alkyne in which at least one hydrogen atom is bonded to a triple-bonded carbon atom.

[0096] As used herein, the terms “azide” or “azido group” refer to a group of the formula (--N3).

[0097] The term "triazole" refers to any heterocyclic compound with the molecular formula C2H3N3 and a five-membered ring having two carbon atoms and three nitrogen atoms. The product of the chemical click reaction between the alkyne moiety and the azide moiety is the triazole moiety.

[0098] Extended sequencing One exemplary primer extension reaction that can be enhanced through solid-state synthesis is the polymerization of a non-natural nucleotide analogue called “XNTP,” which forms the basis of the “Extended Sequencing” (SBX) protocol developed by Stratos Genomics (see, for example, Kokoris et al., U.S. Patent No. 7,939,259, “High Throughput Nucleic Acid Sequencing by Expansion”). Generally, SBX uses this biochemical polymerization to transcribe the sequence of a DNA template onto a measurable polymer called “Xpandomer.” The transcribed sequence is encoded along the Xpandomer backbone in high signal-to-noise ratio reporters spaced approximately 10 nm apart, designed specifically for high signal-to-noise ratio, well-differentiated reactions. These differences provide a significant performance enhancement in terms of sequence read efficiency and accuracy of Xpandomer relative to native DNA. An overview of the SBX process is described in Figures 1A, 1B, 1C, and 1D.

[0099] XNTPs are scalable, 5'-triphosphate-modified nucleotide substrates compatible with template-dependent enzymatic polymerization. A highly simplified XNTP is shown in Figure 1A, highlighting the unique characteristics of these nucleotide analogs: XNTP 100 has two distinct functional regions: a selectively cleavable aminophosphate bond 110 linking a 5'-α-phosphate 115 to a nucleobase 105; and a linker 120 located at certain positions within the nucleoside triaminophosphate, allowing for controlled expansion via intranucleotide cleavage of the aminophosphate bond. The XNTP linker comprises linker arm portions 125A and 125B separated by the selectively cleavable aminophosphate bond. Each linker is connected to one end of a reporter 130 via a linker group (LG), as disclosed in U.S. Patent No. 8,324,360 to Kokoris et al., which is incorporated herein by reference in its entirety. XNTP 100 is described as having a “restricted configuration,” which is characteristic of both the XNTP matrix and the polymerized daughter chains. The restricted configuration of polymerized XNTP is a precursor to the extended configuration, as seen in Xpandomer products. The transition from the restricted to the extended configuration occurs when the PN bonds of the aminophosphate ester within the main chain of the daughter chain break.

[0100] The synthesis of Xpandomer is summarized in Figures 1B and 1C. During assembly, monomeric XNTP substrates 145 (XATP, XCTP, XGTP, and XTTP) are polymerized at the extendable ends of nascent daughter strands 150 using a template-guided polymerization process guided by a single-stranded template (SEQ ID NO:1) 140. Typically, the process begins with a primer and proceeds along the 5' to 3' direction. Typically, a DNA polymerase or other polymerase is used to form the daughter strand, and conditions are selected to obtain a complementary copy of the template strand. After the daughter strand is synthesized, the coupled ligand contains a constrained Xpandomer that further comprises the daughter strand. The ligand in the daughter strand has a “constrained configuration” of the XNTP substrate. The constrained configuration of the ligand is a precursor to the extended configuration, as seen in the Xpandomer product.

[0101] As shown in Figure 1C, the transition from the constrained configuration 160 to the extended configuration 165 is caused by the selective cleavage of phosphodies (represented by unshaded ellipses for simplicity) within the main chain of the sub-chain. In this embodiment, the tandem chain contains one or more reporter constructs, 130A, 130C, 130G, or 130T, that are specific to the nucleobases to which they are linked, thereby encoding the sequence information of the template. In this way, the tandem chain provides a means to extend the length of the Xpandomer and reduce the linear density of the parent chain sequence information.

[0102] Figure 1D illustrates Xpandomer 165 through nanopores 180 from Cis Reservoir 175 is transferred to trans reservoir 185. After passing through the nanopore, each reporter of the linearized Xpandomer (labeled "G", "C" and "T" in this illustration) generates a unique and repeatable electronic signal (represented by superimposed trace 190) that is specific to the nucleobase it is attached to.

[0103] Figure 2 illustrates the generalized structure of XNTP in more detail. XNTP 200 comprises a nucleobase triaminophosphate 210 with linker arms 220A and 220B, separated by selectively cleavable aminophosphate bonds 230. The chain is linked to the nucleoside triphosphate at linker groups 250A and 250B, wherein the first chain terminus is attached to a heterocycle 260 (represented here by cytosine, although the heterocycle may be any of the four standard nucleobases A, C, G, or T), and the second chain terminus is attached to an α-phosphate 270 of the nucleobase backbone. Those skilled in the art will understand that many suitable coupling chemistry known in the art can be used to form the final XNTP substrate product; for example, chain coupling can be accomplished via triazole bonds.

[0104] In this embodiment, tandem 275 comprises several functional elements, including enhancers 280A and 280B, reporter codes 285A and 285B, and translation control elements (TCEs) 290A and 290B. Each of these features performs a unique function during the translocation of Xpandomer through the nanopore and the generation of a unique and reproducible electronic signal. Tandem 275 is designed for translocation control via hybridization (TCH). As shown, the TCE provides a hybridization region that can form a doublet with the complementary oligomer (CO) and is located near the reporter codes. Different reporter code sizes can prevent ions from flowing through the nanopore at different measurable levels. Specific reporter codes can be synthesized efficiently using phosphoramide chemistry commonly used for oligonucleotide synthesis. Reporter codes can be designed by selecting sequences of specific phosphoramides from commercially available libraries. Such libraries include, but are not limited to, polyethylene glycol with a length of 1 to 12 or more ethylene glycol units, aliphatic compounds with a length of 1 to 12 or more carbon units, deoxyadenosine (A), deoxycytosine (C), deoxyguanosine (G), deoxythymidine (T), and baseless compounds (Q). The double-stranded TCE associated with the reporter code also contributes to ion flow blocking; therefore, the combination of the reporter code and the TCE can be referred to as a "reporter." Following the reporter code is the enhancer, which in one embodiment comprises a spermine polymer.

[0105] Figure 3 shows an example of Xpandomer cleaved during the transfer of α-hemolysin nanopores. The bio-nanopore is embedded within a lipid bilayer membrane that separates and electrically isolates two electrolyte reservoirs. A typical electrolyte is 1 molar KCl buffered to pH 7.0. When a small voltage (typically 100 mV) is applied across the bilayer, the nanopore restricts the flow of ion currents and is the dominant resistance in the circuit. The Xpandomer reporter is designed to provide a specific level of ion current blocking, and sequence information can be read by measuring the sequence of ion current levels as the reporter sequence translocates through the nanopore.

[0106] α-Hemolysin nanopores are typically oriented, thus translocation occurs by entering the vestibular side and exiting the styloid side. For example... Figure 3 As shown, the nanopores are oriented to capture Xpandomer primarily from the stem side. This orientation is advantageous when using the TCH method because it reduces occlusion artifacts that occur when the Xpandomer first enters the vestibule. Unless otherwise stated, the stem side is initially the assumed translocation orientation. As the Xpandomer translocates, the reporter enters the stem until its duplex, TCE, stops at the stem inlet. The duplex diameter is approximately 2.4 nm, while the stem inlet is approximately 2.2 nm, thus the reporter is retained in the stem until the complementary strand 395 of the duplex dissociates (releases), and then translocation proceeds to the next reporter. Free complementary strands are highly detrimental to entry into the nanopore because the Xpandomer is still transferring and diffusing out of the pore.

[0107] In one embodiment, each member of the reporter code (following the duplex) is formed by an ordered selection of phosphorus amides, selectable from a number of commercial libraries. The phosphorus amide of each component contributes to net ionic resistance based on its position within the nanopore (following the duplex termination), its displacement, its charge, its interaction with the nanopore, its chemical and thermal environment, and other factors. The charge portion on each phosphorus amide is attributed to phosphate ions with a nominal charge of -1, effectively reduced by counterion shielding. The force pulling the duplex is due to the local electric field acting on these effective charges along the reporter. Since each reporter molecule can have a different charge distribution, it can exert different forces on the duplex for a given applied voltage. The force transmitted along the reporter backbone also serves to elongate the reporter to provide a repeatable blocking response.

[0108] For sequencing, protein nanopores were prepared by inserting α-hemolysin into a DPhPE / hexadecane bilayer member in buffer B1, wherein buffer B1 contained 2 M NH4Cl and 100 mM HEPES at pH 7.4. CisThe pore was filled with buffer B2, which contained 0.4 M NH4Cl, 0.6 M GuCl and 100 mM HEPES, at pH 7.4. The Xpandomer sample was heated to 70°C for 2 minutes, completely cooled, and then 2 µL of sample was added... Cis In the hole. Then apply a voltage pulse of 90mV / 390mV / 10µs, and acquire the data using LabVIEW software.

[0109] Sequence data are analyzed using histograms of sequence read groups from a single SBX reaction. The analysis software aligns each sequence read with the template sequence and trims the sequence range at the ends of reads that are not aligned with the correct template sequence.

[0110] 2. Specific embodiments of the present invention The present invention can be implemented using the specific methods, apparatus and compositions described in the following exemplary embodiments.

[0111] Solid synthesis The extended sequencing (SBX) method developed by the inventors offers significant performance enhancements in the efficiency and accuracy of Xpandomer sequence reading relative to native DNA. However, samples enriched with high-quality, full-length Xpandomer copies of template DNA can be difficult to generate in solution. Advantageously, through repeated experimentation, the inventors have found that the synthesis and / or processing efficiency of full-length Xpandomer can be improved by adapting various steps of the workflow (e.g., primer extension reactions and / or post-synthesis processing steps) to a solid support. Solid-state platforms have been found to improve the optimization of various reaction conditions.

[0112] Solid-state synthesis of Xpandomer can be performed using any suitable support platform known in the art. In some embodiments, the solid support can be a conventional bead, tube, capillary, or microfluidic chip or card. As further discussed herein, in some embodiments of the invention, an oligonucleotide primer, i.e., an extension or “E-oligonucleotide,” binds to the support to initiate solid-state Xpandomer synthesis.

[0113] Surface Chemistry Various surface chemistry methods can be used to immobilize oligonucleotides or oligonucleotide / template complexes onto solid supports. Exemplary examples of suitable surface chemistry are shown in Figures 4A-4E. The embodiment depicted in Figure 4A employs conventional streptavidin / biotin interaction chemistry and shows the functionalization of a solid support 400 having a linker including a terminal biotin moiety 410A. In this embodiment, the 5' end of the oligonucleotide primer 420 binds to a second linker including a terminal biotin moiety 410B. The linker-template complex 425 (illustrated in this depiction as polymerase-mediated Xpandomer synthesis) is linked to the support by a streptavidin moiety 430. The linker moiety disclosed herein can be of sufficient length to link the oligonucleotide to the support such that the support does not significantly interfere with the overall binding and recognition of the oligonucleotide by the complementary oligonucleotide or nuclease replicase. Therefore, the linker can also include spacer units. Spacers, for example, separate the oligonucleotide from cleavage sites or tags.

[0114] Alternatively, the embodiment depicted in Figure 4B illustrates the immobilization of a primer-template complex 425 onto a solid support (i.e., the “matrix”) 400 by covalently linking primers to the matrix via a click reaction. In this embodiment, the covalent bond is mediated by a maleimide-PEG-alkynyl linker 423 crosslinked to the solid support. The alkynyl moiety 429, provided at the end of the linker remote from the substrate, is capable of reacting with an azide group 435 provided by the 5' end of the primer. The ability to immobilize nucleic acids onto a substrate using simple click chemistry offers advantages over conventional solid-state nucleic acid synthesis protocols. For example, nucleic acids can be pre-synthesized (e.g., chemically or enzymatically) and purified prior to click conjugation. Furthermore, combinations of different oligonucleotides can be immobilized on a single support. The present invention considers various configurations of oligonucleotide structures bound to solid supports. Figure 4C illustrates how dendritic polymers of primer-template complexes are formed on a support via click chemistry as discussed herein.

[0115] According to the present invention, any suitable linker providing a maleimide moiety at the first end and an alkyne moiety at the second end can be used. The chemical chain between the two reactive groups of the linker may be referred to herein as a “spacer arm.” The length of the spacer arm determines the flexibility of the conjugate and can be optimized for a specific application. Typically, the spacer arm comprises a hydrocarbon chain or a polyethylene glycol (PEG) chain. Figure 4D illustrates exemplary maleimide-PEG-alkyne linker 423, propargyl-PEG4-maleimide, which provides an alkyne moiety 429 and a maleimide moiety 427. Figure 4E illustrates how an extended oligonucleotide having a terminal azide moiety attached to the 5' end is immobilized on a solid support via a click reaction that generates covalent bonds. In this embodiment, the solid support has been functionalized by a crosslinking linker comprising a terminal maleimide moiety near the end of the support and a terminal alkyne group away from the end of the support.

[0116] According to the present invention, the maleimide moiety can be converted into a reactive group and subsequently crosslinked to a solid surface, such as a polyolefin surface, via a catalyst-free photochemical (e.g., photo-initiated) deprotonation reaction. This reaction simplifies the initiation step relied upon by conventional conjugation methods. Conventional crosslinking techniques teach that the maleimide chemical group is a thiol-reactive targeted (-SH) functional group. However, the inventors have advantageously discovered that the maleimide group can be crosslinked to a rigid polyolefin substrate after activation via a deprotonation reaction. Importantly, maleimide-mediated crosslinking has been found to be stable under acidic conditions and during click reactions. Suitable polyolefin surfaces include, but are not limited to, substrates made of polypropylene or cyclic olefin copolymers (COC).

[0117] To partially functionalize a substrate, such as a COC chip, with alkynes, an exemplary catalyst-free photochemical deprotonation reaction may include the following steps: 1) coating the chip with an organic solvent such as DMSO or DMF; 2) adding a linker having a maleimide moiety at one end, such as propargyl maleimide, dissolved in, for example, DMSO and water; 3) incubating the chip under a UV lamp; 4) cleaning the chip with a series of solvents, which in some embodiments may include solutions of DMSO, DMF, and Na2HPO4, Tween-20, and SDS; and 5) cleaning the chip with an aqueous solution, such as water and / or PBS, prior to the click reaction.

[0118] While these examples illustrate the extension of the 5' end of the oligonucleotide, i.e., the primer attached to the support, it should be understood that in alternative embodiments, surface chemistry may be adapted to attach the 3' end of the oligonucleotide, for example, the terminal oligonucleotide with a terminal cap structure (or the 5' end of an oligonucleotide having an inverse complementary sequence as the terminal oligonucleotide) to the support.

[0119] In some embodiments, the linker between the oligonucleotide and the solid support is cleavable, allowing the primer extension product to be released from the support post-synthesis. Cleavable linkers and methods for cleaving such linkers are known and can be used in the provided methods using knowledge of those skilled in the art. For example, cleavable linkers can be cleaved by enzymes, catalysts, compounds, temperature, electromagnetic radiation, or light. Optionally, cleavable linkers include portions that can be hydrolyzed by β-elimination, portions that can be cleaved by acid hydrolysis, enzymatically cleaved portions, or photocleavable portions. In some embodiments, suitable cleavable portions are photocleavable (PC) spacers or linker phosphorous amides available from Glen Research.

[0120] The inventors have advantageously discovered that the solid-state synthesis and processing of Xpandomer allows for the optimization of many steps in the workflow, resulting in nanoporous sequence reads exceeding 400 bases. In some embodiments, solid-state synthesis can be performed using acid-resistant magnetic beads as a support. The geometry of the bead structure offers several advantages, including favorable template binding and rapid reaction kinetics in solution, increased surface area, magnetic collection, etc. The acid resistance of the beads makes them a particularly suitable support for Xpandomer processing reactions. One embodiment of a method for preparing acid-resistant magnetic beads for Xpandomer synthesis is shown in Figure 5. Here, acid-resistant magnetic beads 510 (e.g., TurboBeads® Peg amine) are functionalized with a linker 520 to produce functionalized beads 530, providing a terminal alkyne group. The beads can be functionalized using any form of amine coupling or chemical condensation. In one embodiment, the beads can be functionalized by conjugation with an amine NHS-ester provided on the bead surface. By click chemistry, an extended oligonucleotide (“E-oligonucleotide”) 540 providing the 5’ azide moiety is covalently linked to a functionalized bead 530 to generate a support-bound E-oligonucleotide 550. The bead-bound E-oligonucleotide can be hybridized with a single-stranded template 560 for, for example, a primer extension reaction to generate an Xpandomer copy of the template. Advantageously, subsequent Xpandomer processing steps, including acid-mediated cleavage of aminophosphate bonds, can be performed on the same bead support.

[0121] End In this embodiment, a single-stranded copy of the nucleic acid template is operatively ligated (e.g., joined or attached) at the 5' end of an oligonucleotide "cap" that specifically hybridizes with a portion of the template at its 3' end. The ligation of the single-stranded copy to the oligonucleotide cap is mediated by a nucleic acid polymerase, as it reaches the 5' end of the oligonucleotide cap during template-dependent processing. The oligonucleotide cap may alternatively be referred to herein as a "terminal cap," a "capped blocking oligonucleotide," or a "terminal tag." The terminal cap serves as a molecular tag to identify and / or isolate copies of the nucleic acid template of a defined length from product heterogeneities that may include copies of unwanted lengths, such as incomplete or truncated copies of the product.

[0122] In alternative embodiments, the template nucleic acid can be a DNA molecule or an RNA molecule. The end cap can be designed to hybridize with any portion of the template nucleic acid (i.e., with the "end cap target sequence") to selectively modify, for example, "mark" a copy of the template region having a defined or desired length, i.e., the "target sequence." In some embodiments, the end cap is designed to hybridize with a sequence near the 5' end of the target sequence to "mark" a complete or near-complete copy of the target sequence. In some embodiments, the end cap target sequence is part of the natural nucleic acid sequence of the template nucleic acid. In other embodiments, the end cap target sequence is a heterologous sequence (e.g., an adaptor or linker) attached to or linked to the template nucleic acid.

[0123] In some embodiments, the copy of the single-stranded nucleic acid template is an Xpandomer and the end cap is designed to hybridize with the 5' end of the template DNA library fragment. Advantageously, the Xpandomer product population enriched with full-length copies of the library fragment provides improved sequence information or "reads" from the nanopore-based sequencing system of the present invention.

[0124] Figure 6A illustrates an overview of one embodiment of the capping strategy in a simplified form. In this embodiment, capping enables the selective labeling of Xpandomer copies of a DNA target sequence, referred to herein as target sequence template 610. Xpandomer is synthesized via a primer extension reaction initiated by oligonucleotide primer 620 (i.e., extension or “E-oligonucleotide”), which hybridizes with a single-stranded template using a suitable DNA polymerase, XNTP matrix, and other extension reagents and additives. The inventors have discovered that variants of DPO4 polymerase can utilize XNTP as a matrix to synthesize Xpandomer in a template-dependent manner, particularly when the primer extension reaction includes one or more PEM additives (PEM additives are described, for example, in the applicant’s pending application PCT / US18 / 67763, entitled “Enhancement of Nucleic Acid Polymerization by Aromatic Compounds,” the entire contents of which are incorporated herein by reference). When the oligonucleotide incorporated into the extension product is ligated to a detectable dye 630, the primer extension product can be visualized by gel electrophoresis.

[0125] A general feature of one embodiment of the end-cap structure is shown in schematic diagram 4 of Figure 6A. In this embodiment, the end cap 640 includes a terminal oligonucleotide 645 (which may be referred to herein as a “blocker” oligonucleotide) that is complementary to and specifically hybridizes to a sequence near the 5' end of the target sequence template. The end cap also includes a 5' triphosphate group 647 that binds to a dideoxyribonucleoside analog (i.e., the “cap”) that can be used as a substrate by a DNA polymerase. During a primer extension reaction (e.g., an Xpandomer synthesis reaction), the DNA polymerase synthesizes the grown Xpandomer from the bound extension oligonucleotide in a template-dependent manner. Upon reaching the template end, the DNA polymerase encounters the end cap and attaches the 5' end of the terminal oligonucleotide to the 3' end of the Xpandomer by forming a phosphodiester bond between the triphosphate group of the cap and the 3' end XNMP of the Xpandomer, as shown in the fifth sketch. In contrast, oligonucleotide 645 in the third image of Figure 6A, lacking a free 5' triphosphate terminal oligonucleotide, cannot be linked to Xpandomer by DNA polymerase.

[0126] In some embodiments, the end cap may be attached to a detectable dye 630 to visualize a capped copy of the target sequence by, for example, gel electrophoresis. Figure 6B shows an exemplary gel in which a copy of the 100-mer template of Xpandomer is labeled in the end cap (lanes 1-4, corresponding to the fourth sketch in Figure 6A) or primer (lanes 5-8, corresponding to the first sketch in Figure 6A). The capping depends on the availability of a 5' nucleotide triphosphate group that binds to the terminal oligonucleotide, as indicated by the lack of fluorescence signal when primer extension is performed using an inhibitor oligonucleotide 645 lacking a free 5' triphosphate group (data not shown), corresponding to the second and third sketches in Figure 6A).

[0127] In some embodiments, the terminal cap or an oligonucleotide complementary to the terminal oligonucleotide of the terminal cap may be attached to a solid support to enable the separation or purification (e.g., “capture”) of the full-length Xpandomer product, as described in more detail herein.

[0128] The terminal or “blocker” oligonucleotide is designed to hybridize strongly with the terminal cap target sequence in the template nucleic acid. The desired hybridization strength can be achieved by optimizing features such as the length of the oligonucleotide and / or the chemical structure of one or more nucleotide monomers of the oligonucleotide. Generally, the melting temperature of the terminal oligonucleotide-target sequence template will be at least 37°C for optimal hybridization formation, but lower melting temperatures are also possible. In some embodiments, the length of the terminal oligonucleotide is from about 10 to about 30 nucleotides. In some embodiments, a nucleotide analog, such as one or more 2'-methoxyribonucleotides, LNAs (i.e., “locked” nucleic acid analogs), or G-clamps, is incorporated into the terminal oligonucleotide to increase binding efficiency. In one embodiment, substantially all nucleotides of the terminal nucleotide are located at the 2'-methoxyribonucleotide.

[0129] Details of certain features of the exemplary terminal cap structure are shown in Figures 7A-7D. Figures 7A and 7B depict a terminal oligonucleotide (SEQ ID NO:2) 700, wherein the 5' end of the oligonucleotide is linked to a flexible linker 710. The flexible linker includes a terminal azide portion 720 that provides a substrate for a click reaction capable of covalently linking to a modified 5' nucleoside triphosphate cap (i.e., a "cap"), as further described with reference to Figure 7C. Exemplary embodiments of flexible linkers 710A and 710B bound to the 5' end of the 23mer terminal oligonucleotide 700 are shown in Figures 7A and 7B, respectively. The flexible linker may be an inert linear polymer comprising, for example, an alkyl and / or PEG moiety of suitable length. In one embodiment, the flexible linker is formed of C6 bromohexamethylenephosphonamide. In some embodiments, the 5' end of the oligonucleotide may include one or more G-clamp nucleotide analogs.

[0130] In an exemplary synthetic method, the terminal oligonucleotide is synthesized via conventional automated phosphoramidite chemistry, during which the 5'-hydroxyl group of the oligonucleotide is coupled with bromhexylphosphoramidite (available from, for example, Glen Research). The solid support is treated with sodium azide to convert the bromine group to an azide. Finally, the oligonucleotide is deprotected and cleaved from the solid support to provide an azide oligonucleotide, as shown in Figure 7B.

[0131] Figure 7C illustrates one embodiment of the modified 5' nucleoside triphosphate cap 740, referred to herein as “ddNTP-O” (represented in this description as ddCTP-0). The heterocyclic portion of the cap is modified with a terminal alkyne portion 745 linked via an octadiyne arm 747 to mediate the azide linkage to the terminal oligonucleotide via a click reaction. In some embodiments, the resulting terminal capped alkynyl nucleoside triphosphate (i.e., cap 740) is capable of pairing with a template base at the 5' end of the terminal oligonucleotide. The alkynyl nucleoside triphosphate cap can be synthesized using the method described by Ludwig and Eckstein or other 5'-triphosphate synthetic methods, see, for example, AR Kore, AR, Srinivasan B., Recent Advances in the Syntheses of Nucleoside Triphosphates, Current Organic Synthesis, 10(6), 903-34 (2013), the entire contents of which are incorporated herein by reference.

[0132] Figure 7D illustrates one embodiment of a complete end cap structure 780 formed via a click reaction to operatively link a triphosphate cap 740 (i.e., an alkynyl nucleoside triphosphate cap) to a terminal oligonucleotide (SEQ ID NO:2) 700. Without being bound by theory, it is assumed that the flexible linker 710B of the end cap provides sufficient spatial flexibility or degrees of freedom for the structure, allowing the triphosphate group 750 to enter the active site of the DNA polymerase and function as a substrate for forming a phosphodiester bond between the end cap and the 3' end of Xpandomer during primer extension. Variants of DPO4 DNA polymerase are particularly well-suited for linking the end cap structure to the 3' end of Xpandomer.

[0133] In some embodiments of the invention, alternative terminal cap structures and methods for linking terminal oligonucleotides to the 3' end of Xpandomer are considered. In one embodiment, a psoralen bridging method is used. Briefly, the 5' end of the terminal oligonucleotide is modified to present a psoralen moiety, which can form a monoadduct and intervalent crosslink (ICL) with thymine upon exposure to ultraviolet (UVA) radiation. Thus, the psoralen-modified terminal oligonucleotide can be chemically crosslinked to the 3' thymine in Xpandomer upon exposure to UVA radiation. Advantageously, the psoralen bridge is acid-resistant to cleavage.

[0134] In other embodiments, the psoralen-modified terminal oligonucleotide may include additional features to enable attachment to and release from a solid matrix. For example, the 3' end of the oligonucleotide may include a linker nucleic acid sequence containing a nuclease cleavage site. In some embodiments, the cleavage site is recognized and cleaved by an RNase. Any suitable RNase recognition site may be used, for example, for RNase A, RNase H, or RNase T1. In other embodiments, the cleavage site is recognized and cleaved by a nicking endonuclease or trypsin. When bound to a solid support via the 3' end of the linker, the terminal oligonucleotide may be selectively released by enzymatic treatment with a suitable nuclease.

[0135] End marker As an alternative strategy to end capping, the inventors have devised compositions and methods to operatively attach (e.g., link or covalently attach) a leader sequence to the 3' end of an Xpandomer post-synthesis. In this way, only the substantially full-length Xpandomer will include a 3' leader sequence, which is necessary for the Xpandomer to pass through a nanopresensor. In one embodiment, the end-tag structure is essentially a modified Xpandomer in which the reporter element is replaced by a leader element and a reinforcing element, and the translocation control element is replaced by a polyG oligomer. Both the aminophosphate bond of the end tag and the polyG oligomer element are acid-labile. Therefore, after acid treatment, the 5' half of the end tag will remain associated with the Xpandomer, including one of the leader element and the reinforcing element, allowing the nanopore to emerge from the 3' end of the Xpandomer.

[0136] In one embodiment, a method for end-labeling Xpandomer may include the following steps: 1) performing solid-state Xpandomer synthesis, wherein the substrate-bound elongating oligonucleotide lacks a leader sequence and an enhancer sequence; 2) performing an elongation reaction for a sufficiently long time to provide a large population of substantially full-length Xpandomer products; 3) washing the substrate-bound products to remove all elongation reagents; and 4) adding the end-tag structure and other reaction components required for polymerase-mediated ligation of the end tag to the 3' end of the Xpandomer to the substrate. In some embodiments, the method may include the following steps: hybridizing the end-blocking nucleotide with the template prior to the elongation reaction and removing the end-blocking nucleotide after elongation and before washing and performing the end-tag addition reaction.

[0137] B. Solid-state synthesis with end caps The capping method described herein can be integrated with the solid-state Xpandomer synthesis workflow using any suitable support platform known in the art. In some embodiments, the solid support may be a conventional bead, tube, capillary, or microfluidic chip. In one embodiment, the solid support is an acid-resistant magnetic bead. As further discussed herein, in some embodiments of the invention, oligonucleotide primers may bind to the support. In other embodiments, the terminal oligonucleotide of the cap or its reverse complementary sequence may bind to the support.

[0138] Away from Support (AFS) Xpandomer Synthesis Workflow In this embodiment, Xpandomer synthesis begins with a primer-template complex bound to a support and extends away from the support toward a cap structure that hybridizes to the opposite (i.e., 3') end of the template. The initial configuration of the AFS model is shown in Figure 8A, with each of the three sketches illustrating the same features. In this embodiment, the 5' end of oligonucleotide primer 810 is bound to solid support 820 via linker 830. Single-stranded template 840 hybridizes to the primer via standard hydrogen bonds. Similarly, capped oligonucleotide 850 hybridizes to the 5' end of the template via standard hydrogen bonds, providing a free 5' triphosphate group 855. The direction of nucleic acid polymerization (i.e., Xpandomer synthesis) is indicated by arrows.

[0139] An exemplary product of the Xpandomer synthesis reaction starting with primer 810 is shown in Figure 8B. The top and middle sketches depict a full-length Xpandomer copy 870 covalently linked to primer 810 and hybridized to template 840 via hydrogen bonds. The full-length Xpandomer product is also covalently linked to the capped oligonucleotide 850 via a phosphodiester bond. The bottom sketch depicts an incomplete Xpandomer copy 860, which is still covalently linked to the primer, but importantly, is not linked to the capped oligonucleotide 850.

[0140] As discussed elsewhere in this paper, after synthesis, Xpandomer was processed and acid-treated to transform it from the constrained form depicted in Figure 8B to the extended linearized form depicted in Figure 8C. Here, the separation of template 840 from the support-bound Xpandomer is shown. The top sketch shows the linearized full-length Xpandomer 875 still covalently bound to the solid support 820 and the capped oligonucleotide 850. The middle sketch shows the alternative result of the acid treatment, where the full-length Xpandomer has been cleaved to generate linearized fragments 865A and 869. Fragment 865A remains attached to the solid support, while fragment 869 is released from the support into solution. The bottom sketch shows the linearized Xpandomer fragment 865B, also bound to the solid support. As illustrated in Figure 8D, after washing, the full-length linearized Xpandomer 875 and the linearized fragments 865A and 865B remain bound to the solid support. Importantly, only the full-length Xpandomer 875 is linked to the capped oligonucleotide 850.

[0141] Figure 8E illustrates how capped oligonucleotide 850 can be used as a molecular tag to isolate or “fish out” the full-length Xpandomer product from a heterogeneous population containing incomplete fragments. The Xpandomer product, still bound to the initial support as shown in Figure 8D, is released from the support via photolysis. As described elsewhere in this document, the ligation of the oligonucleotide primers to the initial solid support is designed to be photosensitive. The released Xpandomer 865 and 875 remain covalently bound to oligonucleotide primer 810, and the full-length Xpandomer 875 remains covalently bound to capped oligonucleotide 850. To isolate the full-length Xpandomer, the sample is contacted with a second solid support 890, which is conjugated to oligonucleotide 880, the inverse complementary sequence of capped oligonucleotide 850. As shown, only the full-length Xpandomer 875 binds to the solid support via hydrogen bonds between oligonucleotides 850 and 880. As shown in Figure 8F, all incomplete Xpandomer products can be washed off the solid support, leaving the separated full-length Xpandomer 875, which can then be eluted from the support and used, for example, for single-molecule nanopore sequencing. In this embodiment, the extended oligonucleotide includes features (e.g., leader elements and aggregator elements) necessary for nanopore localization and translocation.

[0142] In an alternative embodiment, the terminal cap oligonucleotide is modified to include leader and aggregator features for nanopore threading, while the elongation oligonucleotide lacks these features. In this embodiment, only the full-length elongation product will be linked to the leader and aggregator elements, thus enabling translocation through the nanopore to generate sequence information.

[0143] In another embodiment, the extended oligonucleotide structure is modified to include leader and aggregator features for nanopore threading, features lacking in the terminal cap oligonucleotide. In this embodiment, Xpandomer synthesis and capping reactions can be performed in solution. After Xpandomer synthesis, the capped product can be purified by contacting the sample with the oligonucleotide immobilized on a bead support, for example by biotin-streptavidin chemistry, where the oligonucleotide includes a sequence of reverse complementary sequence that is part of the terminal cap oligonucleotide sequence. In this way, only Xpandomer products that simultaneously include the extended oligonucleotide structure (providing leader and aggregator features) and the terminal cap can pass through the nanopore sensor to provide sequence information.

[0144] Xpandomer Synthesis Workflow Towards Support (TS) In an alternative embodiment of the invention, the terminal oligonucleotide of the terminal cap structure is covalently bound to the substrate. In this embodiment, Xpandomer synthesis begins with a primer-template complex hybridizing with the terminal oligonucleotide of the terminal cap structure, and the Xpandomer synthesis is directed toward the support. The initial configuration of the TS model is shown in Figure 9A, with each of the two terminal caps 980 bound to the support illustrating the same characteristics. In this embodiment, the 3' end of the terminal oligonucleotide 950 is bound to the solid support 920 via a photocleavable linker 930. The terminal cap 980 provides free 5' triphosphate 955.

[0145] The terminal cap oligonucleotide sequence was designed as the reverse complementary sequence to the 5' end sequence of the single-stranded target nucleic acid template. Figure 9B illustrates the association between the 5' end of the target nucleic acid template 940 and the terminal cap oligonucleotide via standard base pairing. In this embodiment, the extending oligonucleotide 910 hybridizes to the complementary sequence at the 3' end of the template. Xpandomer synthesis begins at the 3' end of primer 910 and proceeds towards the terminal cap that binds to the support. The direction of nucleic acid polymerization (i.e., Xpandomer synthesis) in this model is indicated by arrows.

[0146] An exemplary product of the Xpandomer synthesis reaction starting from primer 910 is shown in Figure 9C. The top sketch depicts a full-length Xpandomer copy 970 covalently linked to primer 910 and capped oligonucleotide 950 via a phosphodiester bond. The bottom sketch depicts an incomplete Xpandomer copy 960, which is still covalently bound to the primer, but importantly, is not linked to the capped terminal oligonucleotide 950.

[0147] As discussed elsewhere in this paper, after synthesis, Xpandomer is processed and acid-treated to transform it from the constrained form depicted in Figure 9C to the extended linearized form depicted in Figure 9D. Here, template 840 and the incomplete Xpandomer 960 have been dissociated from the support and washed away from the bound material. The top sketch shows the linearized full-length Xpandomer 975 covalently bound to the solid support 920 via the terminal oligonucleotide 950 of the end cap. Importantly, only the full-length Xpandomer copy remains bound to the solid support. These can then be released via photo-mediated cleavage of the photocleavable portion 930 and used for nanopore sequencing.

[0148] In some cases, such as if DNA polymerase prematurely attaches the end cap structure to an incomplete copy of the template, truncated byproducts may form during the capping process. This phenomenon is referred to herein as a polymerase "short circuit." To prevent short circuits, the inventors have devised several strategies to delay the incorporation of the end cap structure into the Xpandomer, thereby facilitating the synthesis of a near-full-length copy of the template. In one embodiment outlined in Figure 10A, the blocking nucleotide 1010 hybridizes with a region near the 3' end of the single-stranded template 1020. The blocking oligonucleotide is designed to prevent incorporation into the growing Xpandomer by DNA polymerase. In some embodiments, the blocking oligonucleotide lacks a 5' triphosphate group at its 5' end and therefore cannot attach to the 3' end of the Xpandomer. When the polymerase reaches the blocking oligonucleotide, the elongation of oligonucleotide 1030 is thus halted. At this point, the blocking oligonucleotide can be removed from the template, for example, by thermal melting, and replaced with a terminal cap oligonucleotide 1040, which can be linked to a substantially full-length Xpandomer 1050 by DNA polymerase. A suitable melting temperature can be calculated that causes the short blocking oligonucleotide to dissociate without affecting the hybridization of the longer Xpandomer with the template.

[0149] In another embodiment, as shown in FIG10B, the blocking oligonucleotide 1015 is designed to provide a 5' phosphate group. As described above, DNA polymerase cannot incorporate the blocking oligonucleotide into the growing Xpandomer, therefore synthesis stops when the polymerase encounters the blocking agent. In this embodiment, the blocking agent can be removed, for example, by exonuclease-mediated digestion. After exonuclease treatment, the terminal cap oligonucleotide 1040 hybridizes with the template and is ligated to a substantially full-length Xpandomer 1050 by DNA polymerase.

[0150] C. Mirrored Xpandomer library built using endcaps This general embodiment describes a novel method and nucleic acid composition for generating template construct libraries, wherein each individual construct contains two single-stranded copies of the same strand of a nucleic acid target sequence (i.e., the template), the two single-stranded copies being tandemly linked by an oligonucleotide-based linker. Libraries of such template constructs are referred to herein as “mirror libraries.” Mirror libraries provide templates for novel Xpandomer synthesis schemes employing the end-capping strategy disclosed herein. In short, a single Xpandomer polymer is synthesized from each template construct, yielding an Xpandomer product comprising two copies of the same strand of the target, the two copies being operatively linked to a cap-branched structure via covalent bonding. The two copies of the target sequence are each ligated to the cap-branched structure during synthesis using the end-capping method described herein. Advantageously, Xpandomer synthesized from mirror library constructs provides two sequence reads of a single target sequence upon passage through a nanopore. Differences between the first and second reads indicate potential sequencing errors that can be excluded or addressed through quality scoring or some kind of discrepancy resolution.

[0151] The mirror library template construct is generated through a series of ordered enzymatic reactions, each producing a characteristic precursor construct. Figure 11A illustrates the basic structural features of one embodiment of the mirror library template construct precursor, referred to as “M1”, 1100. The M1 precursor is formed by the operative linking (i.e., by forming covalent bonds or attachment) of a Y-shaped adaptor construct 1110, a library fragment 1120, and a cap primer adaptor construct (referred to herein as a “trifleur”) 1130. In this embodiment, the Y-shaped adaptor 1110 comprises 3' to 5' oligonucleotide chains 1111 and 5' to 3' oligonucleotide chains 1113, conventionally referred to herein as the “negative” and “positive” chains, respectively. The adaptor chains 1111 and 1113 specifically hybridize in the “stem” portion of the Y-shaped adaptor, which is close to the library fragment, while the “arm” portion is distant from the library fragment, remaining single-stranded. The double-stranded stem portion of the Y-connector can be linked to a library fragment. In this embodiment, the 3' end of the connector strand 1113 has an unpaired nucleotide, here represented by a free "T," which can pair with a free nucleotide base provided by the library fragment to facilitate ligation. The arms of the Y-connector can be designed to mirror the library workflow, providing several useful functions, including binding sites for oligonucleotide primers (i.e., extending oligonucleotides) used later in Xpandomer synthesis. In some embodiments, the ends of one or both single-stranded regions of the Y-connector strand are provided with azide groups, which, as described herein, enable the Y-connector to be immobilized onto a functionalized solid support via a click reaction. In other embodiments, one or both strands of the Y-connector may include a selectively cleaving element capable of, for example, releasing the construct from the solid support. In some embodiments, as further described herein, the negative strand 1111 is linked to the solid support, while the positive strand 1113 provides a 5' nucleotide substrate for exonuclease digestion.

[0152] Library fragment 1120 is a double-stranded nucleic acid, in one embodiment with the 5' phosphate terminus and 3' nucleotide protruding on both strands, which can be generated using techniques recognized in the art. The library fragment is also referred to herein as a "nucleic acid target sequence" and is the target of the sequence determined by SBX. The library fragment includes a "positive" strand 1120A and a "negative" strand 1120B. In some embodiments, the 3' terminus of the negative strand may provide an unpaired nucleotide (represented herein by a free "A") that forms a base pair with the unpaired nucleotide at the 3' terminus of the adaptor strand 1113. In other embodiments, the 3' terminus of the positive strand may also provide an unpaired nucleotide (represented herein by a free "T") to facilitate ligation with the cap primer adaptor 1130. The library fragment may include known or unknown sequences. For SBX, the length of the library fragment may be up to about 50, 100, 200, 500, or 1000 base pairs. In some embodiments, the length of the library fragment is about 100 to about 200 base pairs.

[0153] Cap primer adaptor construct 1130 comprises three oligonucleotide chains, 1131A, 1133, and 1131B, operably linked by chemical branching. The sequences of chains 1131B and 1133 are complementary and hybridize. The sequence of chain 1131A is identical to that of 1131B, and this chain can remain single-stranded in cap primer adaptor 1130 (or, in some cases, hybridize with chain 1133). In some embodiments, the 3' end of chain 1131B provides an unpaired nucleotide (represented here by a free "A") that forms a base pair with the unpaired nucleotide at the 3' end of the positive-stranded chain 1120A of the library fragment.

[0154] Cap primer adaptors can be generated via standard automated phosphoramide-based oligonucleotide synthesis. In some embodiments, chain 1133 is first synthesized in the 5' to 3' direction, followed by incorporation of a symmetrical chemical branch (e.g., Chemgenes CLP-5215), which enables simultaneous 5' to 3' synthesis of chains 1131A and 1131B. In some embodiments, a standard hydrophilic spacer (e.g., a PEG6 spacer) is incorporated between the branch and the 5' ends of chains 1131A and 1131B, providing a flexible linker that allows these chains to fold backward on chain 1133 to form the characteristic "trifle" structure of the cap primer adaptor. The length and composition of the oligonucleotide and branch components of the cap primer adaptor can be optimized for specific applications. In some embodiments, the oligonucleotide is approximately 15 to 25 nucleotides in length and is capable of efficient hybridization with the cap branch construct discussed below.

[0155] The mirror library template construct can be formed in solution or on a solid support. In one embodiment, the mirror library template construct is formed on a solid support by first generating an M1 precursor according to the following exemplary steps: 1) a Y-shaped linker chain 1111 is immobilized on a functionalized solid support (e.g., a microfluidic chip or bead) via a click reaction, and then the Y-shaped linker chain 1113 specifically hybridizes with the linker chain 1111; 2) a cap primer linker 1130 is linked to the library fragment 1120 via an in-solution enzymatic ligation of the 3' end of the positive chain 1120A to the 5' end of the 1133 chain and the 5' end of the negative chain 1120B to the 3' end of fragment 1131A; and 3) the linked library fragment-cap primer linker structure is then linked to the support via enzymatic ligation to the end of the double-stranded portion of the Y-shaped linker 1110.

[0156] M1 Mirror Library Template Construct Precursor 1100 provides a matrix for forming the final mirror library template construct, referred to as "M3", 1150 as depicted in Figure 11B. In one embodiment, template construct 1150 can be generated via two enzymatic steps: a first DNA polymerization step that produces a complementary sequence to the positive strand 1120A, followed by a second exonuclease step that removes the same positive strand. In the first step, the cap primer linker strand 1131A is extended from the 3' end in the direction indicated by the arrow using strand 1120A as a template by a DNA polymerase (e.g., a strand displacement thermostable polymerase); this produces a three-stranded structure, referred herein as template construct precursor "M2" 1140. The M2 precursor includes a daughter strand 1120C having the same sequence as the negative strand 1120B. In the second step, the intermediate oligonucleotide chain of the M2 precursor is enzymatically removed by exonuclease digestion starting from the 5' end of the Y-shaped connective strand 1113, providing the exonuclease with a 5' phosphate substrate. The entire original positive strand 1120A is removed, as is the cap primer connective strand 1133. The resulting product is a mirror library template construct "M3" 1150, which comprises two identical copies 1120B and 1120C of the original negative strand of the library fragment linked together by the cap primer connective strands 1131A and 1131B, remaining connected. The M3 mirror library construct 1150 can be used as a template to synthesize a single Xpandomer comprising two copies of the same strand of the library fragment 1120.

[0157] As discussed herein, the M3 construct serves as a template for the synthesis of Xpandomers, each containing two copies of the same strand of the target sequence for nanopore sequencing, i.e., amplified sequencing (SBX). In some embodiments, the SBX of the mirror library construct is performed on a solid support using the end-capping scheme described herein. In this embodiment, as shown in FIG11C, the 5' ends of the extending oligonucleotides 1170 and 1180 are ligated to the solid support 1190 via click chemistry as described herein. In these embodiments, the extending oligonucleotides include 5' azide groups to mediate the click ligation. In other embodiments, only one extending oligonucleotide is ligated to the support, while the other extending oligonucleotide includes a leader sequence for passing through the nanopore. Each extending oligonucleotide is designed to specifically hybridize with one of the single-stranded portions of the Y-shaped adaptor element of the M3 template construct. In some embodiments, the extended oligonucleotide may include a photocleavable or acid-cleavable element inserted between the solid support and the 5' end of the oligonucleotide sequence to enable the final Xpandomer product to achieve light- or acid-mediated release from the matrix. The M3 template construct 1150 hybridizes with the immobilized extended oligonucleotides 1170 and 1180 via standard hybridization between the complementary sequence in the extended oligonucleotide and the arm of the Y-shaped connective portion of the M3 construct. The cap-branched construct 1195 hybridizes with the M3 construct. The cap-branched construct 1195 comprises two identical oligonucleotides 1197A and 1197B, which are complementary to and hybridize with the 5' ends of both strands of the mirror library construct 1150. The terminal oligonucleotide arms 1197A and 1197B each provide a free 5' triphosphate group. The cap-branched structure can be synthesized by conventional phosphoramidite chemistry, wherein the two strands 1197A and 1197B are chemically branched together.

[0158] Figure 12 illustrates further details of the cap branch structure features. In this embodiment, the cap branch 1295 includes branch structure 1220, terminal oligonucleotide arms 1230A and 1230B, which include a triazole moiety (“R”), a terminal cap (“ddCTP”), and an oligonucleotide (SEQ ID NO: 3). The cap branch is synthesized starting from the 3' terminal portion using standard phosphoramidite chemistry, with PEG6 polymer as an example. Symmetrical chemical branches are added to the 5' end of the terminal portion to achieve parallel synthesis of the branch spacer, with PEG6 polymer as an example. In some embodiments, the length and composition of the spacer can be optimized for a specific application. In some embodiments, the spacer may include a C2, C6, or PEG3 monomer. Terminal oligonucleotide arms 1230A and 1230B extend away from the 5' end of the branch arms. The sequences of the terminal oligonucleotides are designed to hybridize to the 5' end of the M3 template construct, and their sequences are provided by the cap primer adaptor. In some embodiments, the terminal oligonucleotide is about 15 to about 50 nucleotides in length and includes one or more methoxynucleotide analogs. The 5' end of the terminal oligonucleotide is attached to a terminal cap structure, ddCTP is used herein as an example (although in some embodiments any other nucleobase may be substituted), which allows the nascent Xpandomer to be attached to the terminal oligonucleotide via capping. Details of the capping method are described herein and referenced in [reference]. Figure 7A – 7D was discussed. The terminal cap is linked to the terminal oligonucleotide via a triazole moiety (“R”), which is the product of a click reaction between the alkyne moiety provided by the terminal cap and the azide moiety provided by the terminal oligonucleotide. In some embodiments, the cap branch is designed to include other linker structures, such as a spermine polymer located between the terminal cap and the terminal oligonucleotide, to provide, for example, increased steric flexibility and binding to the terminal cap.

[0159] Referring again to Figure 11C, the Xpandomer synthesis reaction is performed, initiating at the 3' ends of elongating oligonucleotides 1170 and 1180, proceeding in the same direction (as indicated by arrows), and terminating at the 5' ends of terminal oligonucleotides 1197A and 1197B at cap branch 1195. Following this synthesis, polymerase ligates intact Xpandomer copies 1199A and 1199B to the cap branch using the capping method described herein. In one embodiment, the first elongating oligonucleotide includes a photocleavable linker element, and the second elongating oligonucleotide includes an acid-labile linker element. Acid treatment of Xpandomer simultaneously converts the Xpandomer copy from the "bound" configuration to the "open" configuration 1000 and cleaves the acid-labile linker in the elongating oligonucleotide. The resulting product, comprising two linked Xpandomer 1199A and 1199B containing the library fragment, can then be removed from the support by photolysis of the photocleavable linker of the second elongating oligonucleotide. In some embodiments, a final purification step is performed, wherein the released mirror Xpandomer 1000 hybridizes with an oligonucleotide complementary to one of the extended oligonucleotides linked to a second solid support.

[0160] The reaction conditions used to generate the M1, M2, and M3 mirror library constructs and SBX for the synthesis of Xpandomer can be optimized through trial and error. In some embodiments, these constructs can be generated via the workflow outlined in Figure 13 below. In step 1, the M1 precursor is generated by connecting a Y-connector, a library insert, and a trifurcation. The molar ratio of YAD1:YAD2:insert:trifurcation can be optimized for specific conditions or applications. In some embodiments, the M1 precursor can be generated on a microfluidic chip by first assembling the Y-connector on an alkyne functionalized chip. In one embodiment, a first Y-shaped linker chain providing terminal azide groups is linked to a functionalized chip via click chemistry according to the following exemplary scheme: 1) A catalyst mixture comprising 3.0 mM THPTA, 6.0 mM sodium ascorbate, 1 mM CuSO4, 5.0 mM aminoguanidine, and 10% DMF or DMSO is prepared; a substrate mixture comprising 10% DMF or DMSO, 25 mM sodium phosphate, pH 7.0, 1 µM azide-Y-shaped linker oligonucleotide chain 1, 2.5 mM MgCl2, 5 mM aminoguanidine, and 6.0 mM sodium ascorbate is prepared; 2) 11 µl of the catalyst mixture is added to 44 µl of the substrate mixture, and 50 µl of the reaction solution is added to an alkyne-functionalized microfluidic chip, such as a COC chip, and incubated at room temperature for 20°C; 3) The chip is then coated with 300 µl of solution I0002 (0.3 M sodium phosphate, pH 7.0). Washed for 5 minutes at 37°C with 8.0, 1% Tween 20, 0.5% SDS, and 1 mM EDTA, followed by washing with 900 µl of buffer A.1 (0.5 M NH4OAc, pH 6.5, 1 M urea, 5% NMS, and 2% PEG8000). After click ligation, the second Y-shaped linker strand was hybridized to the substrate-bound first strand by preparing a hybridization mixture containing 100 pmol of the second oligonucleotide in buffer A.1. The hybridization mixture was incubated at 90°C for 15 minutes, then cooled to 72°C. The mixture was then added to a preheated chip, and the chip was cooled to 32°C for 5 minutes using a thermal cycler. The chip was then washed with buffer A.1. Next, the library insert and trifled linker were ligated to the bound Y-linker. The insert was denatured at 90°C for 3 minutes in a buffer consisting of 100 mM NaCl / 20 mM Tris, pH 8.0, and then cooled to 50°C over 5 minutes using a thermal cycler.A ligation mixture was prepared comprising 20 pmol of double-stranded insert, 50 pmol of triple-stranded adaptor, 3 mM ATP, 2 U / µl T4 PNK, and 200 U / µl T4 DNA ligase in 1x ligation buffer (66 mM Tris, 10 mM MgCl2, 1 mM DTT, and 7.5% PEG6000). The ligation reaction was run at 16 °C for 15', and then the reaction was added to a chip containing the Y-shaped adaptor. The chip was incubated at 16 °C for 15'. The ligation mixture was then removed, and 3 µl of 5' deadenylate enzyme (50,000 U / ml) was added to the ligation mixture. The ligation mixture was then added back to the chip, and the chip was incubated at 16 °C for 15'. The chip was then washed for 5' with 4 ml of buffer I0002 at 37 °C. The chip was then washed with water and could be stored in 10 mM Tris at 4 °C.

[0161] In step 2, the M2 precursor is prepared via extension of the M1 precursor. In one embodiment, approximately 2.5–10 pmol of chip-bound M1 is used in an extension reaction comprising 1.0X polymerase buffer, 0.2 mM of each dNTP, 0.28 U / µl DNA polymerase, and 1 mM MgCl2. A suitable DNA polymerase is Vent (exo-) DNA polymerase or KAPA HiFi. The chip is placed in a thermal cycler and incubated at 95°C for 1 minute, followed by 10 to 40 cycles at 90°C to 98°C for 20 minutes, and then at 76°C for 6 minutes. The chip is washed with water to remove excess reagent. The chip is then treated with proteinase K by adding a solution containing 0.05 U / µl to 0.80 U / µl proteinase K to water and incubating at 55°C for 5 minutes, followed by incubation at 95°C for 5 minutes. The chip is then washed with water.

[0162] In step 3, the M3 template construct is generated by exonuclease digestion. In some embodiments, an exonuclease digestion mixture comprising 0.45 U / µl λ exonuclease in an exonuclease buffer is added to the chip and incubated at 37°C for 5', followed by incubation at 75°C for 10'. The chip is first washed with buffer 10002, then washed with water, and then stored in a buffer containing 10 mM Tris.

[0163] In step 4, the bonded M3 construct is released by photocutting. In some embodiments, the chip is exposed to ultraviolet light (e.g., 365 nm) for 15” via a UV curing lamp (e.g., a Phoseon Technology FireFly lamp), and the released M3 construct is recovered by aspirating liquid from the chip.

[0164] In step 5, an Xpandomer copy of the M3 template construct is generated by the SBX method. In some embodiments, the Xpandomer is generated on a microfluidic chip, as in step 1, the first extending oligonucleotide (e.g., “E52” EO) is covalently bound to the microfluidic chip via click chemo. This EO may be referred to herein as a “capture oligonucleotide.” The capture oligonucleotide is used to assemble the M3 template, the second extending oligonucleotide, and the cap branch structure on the chip via hybridization. The capture chip is washed with buffer A1 (0.5 M NH4OAc, pH 6.5, 1 M urea, 5% NMS, and 2% PEG8000) and incubated at 65°C. A hybridization mixture was prepared comprising approximately 5 pmol to approximately 30 pmol of the M3 construct, approximately 20 pmol to approximately 80 pmol of the second extension oligonucleotide (e.g., “E6 EO”; the actual amount will be determined by the amount of E52 capture oligonucleotide bound to the chip), and approximately 20 pmol to 80 pmol of the cap branch (the actual amount will be approximately the same as the amount of EO). The hybridization mixture was incubated at 95 °C for 15" and then added to the chip and incubated at 65 °C for 30" and then decreased to 37 °C at a rate of 0.1 °C / s and held at this temperature for 5" . The chip incubation temperature was controlled by a standard thermal cycler equipped with an in situ hybridization adapter plate.

[0165] For Xpandomer synthesis, an extension mixture was prepared by mixing buffer P (0.6 mM MnCl2 and 0.18 µg / µl DPO4 DNA polymerase variant) and buffer X (80 µM PP-60.22 and 80 µM per XNTP), followed by the addition of buffer A (50 mM Tris, pH 8.84, 200 mM NH4OAc, pH 6.88, 20% PEG8K, 5% NMS, 0.2 µg / µl SSB, 0.5 M betaine, 0.25 M urea, 1 mM PEM AZ-8,8 and 4 mM PEM additive). The extension mixture was added to the chip and incubated at 20–45 °C for 15–60 minutes. The chip was washed with buffer B (100 mM HEPES, 100 mM NaHPO4, 5% Triton and 10% DMF).

[0166] In step 6, Xpandomer is cleaved and eluted in 0-75% acetonitrile. In one embodiment, the captured oligonucleotide comprises a photocleavable element. To release Xpandomer from the chip, the chip is exposed to UV light for 15"; the chip is then incubated at 37°C for 2" and the Xpandomer sample is removed using a pipette.

[0167] For nanopore sequencing, one or two extending oligonucleotides include a leader sequence designed to facilitate Xpandomer passage through the nanopore. Further details of certain embodiments of the leader sequence are in the applicant's granted U.S. Patent No. 9,670,526, "Concentrating a Target Molecule for Sensing by a Nanopore," the entire contents of which are incorporated herein by reference. In one embodiment, the sequence of an exemplary extending oligonucleotide is: RD 10 (PC)L 25Z6[TCATAAGACGAACGGA(SEQ ID NO:4)] represents a 5'-azide group capable of being click-chemically linked to a functionalized solid-substrate; "D" represents a poly-PEG6 spacer; "PC" represents a photocleavable spacer capable of being released from the solid matrix; "L" represents a poly-C2 spacer acting as a leader sequence during nanopore translocation; "Z" represents a poly-C12 spacer; and TCATAAGACGAACGGA (SEQ ID NO:4) represents an oligonucleotide that will hybridize with the target sequence and be used as an extension primer for DNA polymerase. In other embodiments, the PC spacer can be replaced by an acid-labile spacer, such as [dT p-ethoxy][DMS(O)MT-NH2-C6 or Glen amidite 10-1907]phosphamide. The number of each phosphoramide monomer (i.e., "spacer") designed into the extension oligonucleotide is variable and can be optimized for specific applications. In other embodiments, during mirror library synthesis, a leader sequence may be included in one or both extending oligonucleotides that initiate Xpandomer synthesis. In some embodiments, the leader sequence is provided by a first extending oligonucleotide that is not covalently bound to the substrate, while the second extending oligonucleotide, which is bound to the substrate, lacks a leader sequence. After Xpandomer synthesis and processing, any truncated product not bound to the second extending oligonucleotide can be removed from the matrix by washing. After Xpandomer is released from the matrix, any truncated product not bound to the first extending oligonucleotide will lack a leader sequence and advantageously cannot pass through the nanopore to provide sequence data.

[0168] D. Next-generation, YAD-free, mirrored library builder and methodology Several features of the mirror library workflow discussed herein can be modified and / or optimized to provide advantages for specific experimental needs. In the embodiments shown in Figures 11A-11C, the binding site for the Xpandomer extended oligonucleotide and the functional group for solid-state ligation are provided by a Y-shaped adaptor, which is enzymatically ligated to the library fragment. In alternative “next-generation” embodiments, the binding site for the extended oligonucleotide is instead provided by oligonucleotide primers ligated to the library fragment via PCR. This approach amplifies the target sequence while eliminating the ligation step of ligating YAD to the library fragment. After incorporating the primer sequence into the library fragment, the resulting PCR product is referred to as a “tailed” or “tagged” library fragment (or, alternatively, a “tagged target sequence”). In some embodiments, the functionalized terminal groups for solid-state ligation are provided by a separate oligonucleotide structure comprising an oligonucleotide sequence referred to herein as a “capture oligonucleotide” designed to specifically hybridize with the library tag after PCR amplification. Generally, these embodiments are referred to herein as “YAD-free” mirror library construction.

[0169] An example of YAD-free tagging and capture of a library fragment (i.e., the DNA target sequence) is shown in Figure 14. In this example, the library fragment is an example of a double-stranded 100mer 1410 having a positive strand (SEQ ID NO:5) 1410A and a negative strand (SEQ ID NO:6) 1410B. Forward and reverse PCR primers are designed to include oligonucleotide sequences complementary to the target sequence and linked to a heterologous sequence at their 5' ends. In one embodiment, primer (SEQ ID NO:7) 1420 includes a 3' oligonucleotide sequence that specifically hybridizes to the complementary sequence in the positive strand 1410A of the library fragment, and a 5' heterologous sequence that introduces a tag into the PCR product, enabling capture of the tagged library fragment. In this embodiment, the 5' heterologous sequence is referred to as "UP38" and is the same sequence present in both the capture oligonucleotide structure and the Xpandomer extending oligonucleotide. In some embodiments, primer (SEQ ID NO:8) 1425 comprises a 3' oligonucleotide sequence that specifically hybridizes to the complementary sequence in the target sequence negative strand 1410B, and a 5' heterologous sequence that provides a binding site for the incorporated cap adaptor structure during Xpandomer synthesis. Figure 14A shows PCR primers hybridizing to single-stranded positive strand 1410A (SEQ ID NO:5) and negative strand 1410B (SEQ ID NO:6). PCR amplification of the library fragment produces a tagged fragment 1430 having a positive strand (SEQ ID NO:9) 1430A and a negative strand (SEQ ID NO:10) 1430B), which includes a first tag (SEQ ID NO:11) 1438 and a second tag (nucleotides 1-22 of SEQ ID NO:9) 1439 whose sequence is determined by the heterologous sequence tail of the PCR primer. When designing primers 1420 and 1425, we followed the standard primer design principles that are well established in the field.

[0170] To capture tagged library fragments, the capture oligonucleotide structure is covalently linked to a solid support via click chemistry, as described herein. An example of a general capture oligonucleotide structure can be represented as follows: [azide]D n L n Z n(SCL)(CO), wherein the azide provides covalent linkage (i.e., immobilization) to a functionalized solid support (e.g., functionalized with an azide group or a dibiotin group); D represents PEG6, L represents C2, and Z represents C6, wherein polymers of D, L, and Z can form a flexible linker structure; (SLC) represents a selectively cleavable linker, which in this embodiment is a polymer of uracil residues; (CO) represents an oligonucleotide sequence that captures oligonucleotides. In this embodiment, the CO sequence is identical to the UP38 heterologous sequence (SEQ ID NO: 11) and will specifically hybridize with the tag sequence of the positive strand of the library fragment. In some embodiments, the flexible linker is composed only of PEG6 monomers (e.g., D... 16 This flexible linker provides an advantage when PCR reactions are performed on beads or microfluidic chips as discussed in this article.

[0171] To capture the tagged library fragment, a second PCR reaction is performed on a solid support providing the capture oligonucleotide. The capture of the library fragment is shown in simplified form in Figure 14B. Here, the capture oligonucleotide structure 1440 is immobilized on the solid support 1445. The capture oligonucleotide structure includes a 3' oligonucleotide sequence identical to the tag sequence (SEQ ID NO: 11) 1438 in the negative strand of the library fragment 1430B. When the double-stranded library fragment denatures, the positive strand 1430A specifically hybridizes with the capture oligonucleotide. The capture oligonucleotide provides primers for synthesizing a complementary sequence copy of the positive strand 1430A, denoted here by 1430C (SEQ ID NO: 10). An appropriate number of PCR cycles will produce the double-stranded library fragment 1450 immobilized on the solid support.

[0172] The reaction conditions for labeling library fragments in solution and then capturing tagged amplicon products on a chip can be optimized through repeated trials. In one embodiment, the in-solution PCR labeling reaction can be performed as follows: A reaction mixture is prepared comprising 1–15 amol of synthetic template DNA (or, in other embodiments, cleaved natural library DNA), 2 µM of each primer, 350 µM dNTP, 1X KOD buffer (120 mM Tris, pH 8.0, 20 mM KCl, 6 mM NH4SO4, 1.5 mM MgSO4, and 1% Triton X100), and 0.05 U / µl KOD polymerase; the reaction is cycled for 2' at 95°C, followed by 30 cycles of 10” at 95°C, 8” at 68°C, and 8” at 72°C, with a 3' extension at 72°C; the final yield of approximately 25 pmol of tagged amplicon can be purified, for example, using a QIAquick column (available from QIAGEN).

[0173] In one embodiment, the capture chip can be prepared as follows: 100 pmol of UP38 capture oligonucleotides are covalently linked to an alkyne-functionalized chip via a click reaction comprising 10% DMF, 3 mM THPTA, 25 mM Na3PO4, 5 mM aminoguanidine, 6 mM NaAsc, and 1 mM CuSO4; the reaction is carried out at room temperature for 20 minutes, followed by chip washing and then BSA passivation (10 mg / ml unacetylated BSA in PBS for approximately 1 hour at room temperature).

[0174] In one embodiment, the on-chip PCR reaction can be performed as follows: approximately 1x10 6One copy of the tagged amplicon product, 200 pmol of UP39 primers, and 5 pmol of UP38 primers were added to a chip containing approximately 100 pmol of bound UP38-capture oligonucleotides; a PCR mixture containing KAPA HiFi HS U+, 1X ReadyMix buffer (2.5 mM mg), 0.1 µg / ml unacetylated BSA, 1 M betaine, 2% DMSO, 1% PEG, and 0.5% Tween was added; the PCR cycling conditions were as follows: 35 cycles of 98°C for 2', 100°C for 1', 48°C for 12" / 67°C for 30" / 80°C for 2', followed by a final 2' at 80°C; the chip was then washed in a buffer containing 1 M NaCl and 10 mM Tris, pH 8.0.

[0175] As discussed herein, tagged library fragments captured on a solid support provide a matrix for generating an M3 mirror library template construct, which serves as a template for Xpandomer synthesis. This invention considers several alternative workflows for M3 and Xpandomer generation. The following is a non-limiting discussion of some embodiments of alternative “next-generation” mirror library workflows.

[0176] By utilizing a bystander-extended oligonucleotide single-support mirror library, a library was generated.

[0177] In this embodiment, the M3 mirror library template construct and Xpandomer are synthesized on the same solid support, such as beads or microfluidic chips. Both the capture oligonucleotides for M3 generation and the extension oligonucleotides for Xpandomer synthesis are immobilized on the support. In some embodiments, the extension oligonucleotides are designed to form hairpin structures that prevent hybridization with the library fragments during PCR-based capture, and are therefore referred to herein as “bystander” oligonucleotides. As discussed further below, after capturing the tagged library fragments, the bystander oligonucleotides can be selectively converted into functional extension oligonucleotides.

[0178] Figures 15A and 15B illustrate the basic features of single-support synthesis with bystander-extended oligonucleotides. In Figure 15A, the tagged library fragment 1510 is shown immobilized on solid support 1505. PCR-based tagging of the library fragment and ligation of the captured oligonucleotide structure 1515 to the solid support are performed as described herein and with reference to Figure 14. In one embodiment, the captured oligonucleotide structure may have the following sequence: 5' [azide]D 16(UUUUU)(UP38) 3', where the azide group mediates the connection to the solid support, "D" represents the PEG6 linker, "U" represents deoxyuracil, and "UP38" represents the capture oligonucleotide sequence. The U5 sequence is selectively cleavable, for example, obtainable from NEB via USER® (uracil-specific excision reagent), which creates a single nucleotide nick at the uracil residue and cleaves the resulting base-free site. Bystander extension oligonucleotides 1520A and 1520B are also immobilized on the support. The sequences of the bystander oligonucleotides are designed to form a double-stranded hairpin structure that prevents hybridization with library fragments during PCR. In one embodiment, the bystander oligonucleotide may have the following sequence: 5' [azide]D n L n Z n [TCATAAGACGAACGGAGAUUTCCGTTCG(SEQ ID NO:12)]X 3, as further discussed herein, wherein the “D”, “L”, and “Z” portions form a polymer that performs a specific function during SBX, while the 3' terminal TCCGTTCG sequence folds back into a base pair with the inner CGAACGGA sequence to form a hairpin structure in which the inserted GAUU sequence remains single-stranded. The uracil-containing single-stranded sequence can be cleaved using USER®. The terminal “X” portion of the bystander oligonucleotide represents a “blocker” (e.g., a PEG or C3 spacer blocker) that prevents elongation from the oligonucleotide during PCR.

[0179] To form the M1 precursor construct 1530, a triplet adaptor 1525 is ligated to an immobilized library fragment. In some embodiments, this can be achieved by first adding an "A" tail to the free 3' end of the library fragment, which forms a base pair with a free 3' "T" provided by the triplet construct. An exemplary A-tailing reaction may include 10 pmol PCR amplicons, 1x MolTaq buffer, 1 mM dATP, and 2.5 U MolTaq, and run at 72°C for 30'. An exemplary ligation reaction may include 40 pmol of the triplet construct, 1x ligation buffer, 3 mM ATP, 2 U / pl T4 PNK, and 30 U / pl T4 DNA ligase, and run at room temperature for 20', followed by the addition of 150 U of 5' deadenylate enzyme and incubation for 10'. As described herein and referring to Figure 11B, the M1 precursor is then extended to form a triplet M2 construct using DNA polymerase.

[0180] Figure 15B shows the M2 precursor construct 1540, which has a selectively cleavable uracil moiety in both the bystander extending oligonucleotide and the capture oligonucleotide designated by the letter "U". To generate the M3 template construct 1550, the M2 precursor is cleaved using USER® to cut the uracil moiety. This results in 1) cleavage of the hairpin structure in the extending oligonucleotide and 2) cleavage of the capture oligonucleotide to produce a free 5' end in the intermediate strand of the M2 construct. Simultaneously, the M2 precursor is treated with an exonuclease that 1) digests the terminal TCCGTTGC sequence of the bystander oligonucleotide to expose the extending oligonucleotide sequence and 2) digests the intermediate strand of the M2 complex from the 5' to the 3' end. The exposed extending oligonucleotide then specifically hybridizes to the complementary sequence provided by the 3' end of the M3 template construct. In some embodiments, the cleavage and exonuclease digestion reaction can be performed by treating the M2 precursor 15' with a reaction mixture comprising 1xλ exonuclease buffer (67 mM glycine-KOH, 2.5 mM MgCl2, and 50 µg / ml BSA), 20% PEG8000, 0.15 U / µl USER®, and 0.4 U / µl λ exonuclease at 37°C. Following the cleavage and exonuclease digestion reaction, a subsequent phosphatase reaction is performed to remove the 3' phosphate residue left by the USER® cleavage of the bystander oligonucleotide, resulting in a functionally extended oligonucleotide synthesized by Xpandomer. In some embodiments, the phosphatase reaction can be carried out using a reaction mixture comprising 1x CutSmart buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, 100 µg / mL BSA) and 0.1 U / µL Quick calf intestinal alkaline phosphatase (CIP) at 37°C for 5', followed by inactivation by heating at 80°C for 2'.

[0181] The M3 construct provides a template for Xpandomer synthesis, which can be performed as described herein and with reference to Figure 11C. In some embodiments, as described throughout this disclosure, extended oligonucleotides can provide additional features for selective release from the support and nanopores via translocation.

[0182] Two mirrored libraries generated on the card In this embodiment, the microfluidic chip, or card, is designed with two physically discrete regions for a mirror library workflow, including a first region for capturing library fragments and generating M3 template constructs, and a second region for Xpandomer synthesis. Dividing the workflow into two regions in this way provides several advantages, such as eliminating the need for bystander-led oligonucleotide extension.

[0183] Figure 16A depicts an embodiment of a two-region card configuration. Here, card 1600 is divided into physically discrete chambers 1610 and 1620, referred to as “Region 1” and “Region 2”, respectively. Region 1, 1610, is dedicated to the generation of the M3 template construct, while Region 2, 1620, is dedicated to Xpandomer synthesis. Capture oligonucleotide structures, such as the UP38 primers described herein, are immobilized on the surface of Region 1, for example, by click chemistry. The extended oligonucleotides used for Xpandomer synthesis are immobilized on the surface of Region 2 in the same manner. In some embodiments, the extended oligonucleotides may include photocleavable, acid-cleavable, or enzymatically cleavable elements for the selective release of the Xpandomer product. The generation of the M3 template construct takes place in Region 1 as described herein. In short, a tagged library fragment and PCR mixture were added to region 1, and on-chip PCR was performed to ligate the tagged library fragment to capture oligonucleotides; the M1 precursor was formed by ligating an A-tailed library fragment to a triple-joint; the triple-joint was extended by DNA polymerase to produce the M2 precursor; and the M2 precursor construct was cleaved with uracil, followed by exonuclease digestion to cleave the capture oligonucleotides and remove the intermediate strand, thereby producing the M3 template construct 1615.

[0184] Figure 16B illustrates the transfer of the M3 template precursor from region 1 to region 2 of the card, followed by specific hybridization with the elongating oligonucleotides 1625A and 1625B. The cap-adaptor structure 1630 specifically hybridizes with the M3 template construct, and Xpandomer synthesis begins with the elongating oligonucleotide in the direction indicated by the arrow. Details of the structure of the cap-adaptor and the reaction conditions for Xpandomer synthesis are described in full in this disclosure.

[0185] In an alternative embodiment, the capture oligonucleotide bound in region 1 is designed to include a photocleavable element replacing a uracil residue. In this embodiment, the M2 precursor is treated with ultraviolet light to cleave the capture oligonucleotide, and a 5' substrate is provided for exonuclease digestion to produce the M3 template construct. During photocleavage, the region 2 chamber can be protected from exposure to an ultraviolet-blocking interface. An exemplary capture oligonucleotide including a photocleavable element may have the following structure: [azide]D 10 _L 30 _Z6_PC_UP038, where the polymers of the D, L and Z portions, such as the “spacer”, form a flexible linker, “PC” represents a photocleavable element, and UP038 represents an oligonucleotide with the sequence 5' TCATAAGACGAACGGAGACT 3' (SEQ ID NO:13), which is designed to hybridize with the tag sequence of the library fragment.

[0186] Bead-based mirror library generation This embodiment describes a workflow in which M3 template constructs are produced through a series of steps performed on a bead-based support. In this embodiment, as discussed with reference to Figure 4A, various constructs are linked to beads via streptavidin-biotin bonds. Beads offer certain advantages as a solid matrix, such as suitability for PCR conditions and high scalability, thus providing higher yields compared to other matrices.

[0187] Figure 17 summarizes one embodiment of the bead-based workflow. Advantageously, the beads can be washed between steps to remove excess reagent. As described herein and referring to Figure 14A, in step 1, the library fragment is tagged by in-solution PCR. In step 2, bead-on PCR is performed to generate tagged library fragments on capture oligonucleotides. In this embodiment, the capture oligonucleotide includes a biotin moiety for attachment to the SA beads. Any suitable SA bead matrix can be used, for example, Dynabeads® MyOneC1 SA available from ThermoFisher Scientific. 35 cycles of PCR reaction using KAPA HiFi Uracil+ polymerase will be used from up to 10 6Up to 1-20 pmol of bead-binding amplicon is generated from each copy of the input. After step 2, the beads are treated with proteinase K at 55°C for 5', and then washed with PCR wash buffer (1 M NaCl, 10 mM Tris, 0.1% Tween-20). In another embodiment, in-solution PCR can be performed using biotinylated capture oligonucleotides, followed by spin-column-based PCR purification. The purified biotinylated amplicon can then be bound to SA beads. In step 3, a 3' A "tail" is added to the library fragment, followed by ligation of a trifid adaptor including a 5' T overhang. An exemplary A-tailing reaction comprises 2.5 U MolTaq enzyme and 1 mM dATP, and incubated at 65°C for 30'. An exemplary ligation reaction includes a triple-forked adaptor construct (with a "T" overhang), 30 U / µl T4 DNA ligase, 2 U / ml T4 PNK, and 3 U / µl 5' deadenylate enzyme, incubated at room temperature for 20'. In step 4, the triple-forked adaptor is extended to generate the M2 precursor. An exemplary extension reaction includes KAPA HiFi U+ polymerase, available from Roche in 1x ReadyMix. After step 4, the beads are treated again with proteinase K and washed. In step 5, the M3 template construct is generated by cleaving the uracil portion in the M2 precursor to create a free 5' end in the middle strand of the construct, followed by digestion of the strand with an exonuclease. An exemplary cleavage / digestion reaction includes 0.1 U / µl USER® and 0.3 U / µl λ exonuclease, incubated at 37°C for 15'. The exonuclease can then be inactivated by incubating the beads at 75°C for 10'. In step 6, a free M3 template precursor and a cap-adaptor construct are added to a microfluidic chip comprising covalently bound extended oligonucleotides. The M3 construct specifically hybridizes to the extended oligonucleotides and the cap-adaptor. In step 7, Xpandomer synthesis and processing reactions are performed as described throughout this disclosure. The final Xpandomer product can be released from the chip by photocleavage. In alternative embodiments, steps 6 and 7 can also be performed on a bead-based support.

[0188] Solid-state Xpandomer synthesis of branched-extension oligonucleotides As discussed herein, the extended sequencing (SBX) protocol developed by the inventors utilizes extended oligonucleotides (EOs) for Xpandomer synthesis, which includes several features that perform unique functions during Xpandomer synthesis, processing, and nanopore translocation. For example, in some embodiments, the 5' end of the EO provides a "lead" sequence that initiates the final Xpandomer product through the nanopore. The leader sequence may include a polymer of C2 (referred to herein as "L"), such as L... 25 In some cases, it is necessary to generate a mirror Xpandomer group in which only full-length copies pass through the nanopore and generate sequence information. To achieve this, the inventors designed a branched extension oligonucleotide comprising a first and a second extension oligonucleotide linked by chemical branches. In this embodiment, only one EO includes a leader sequence, and each EO includes a unique, selectively cleavable element. An embodiment of the branched EO is shown in Figure 18.

[0189] Figure 18 depicts branched EO 1800, which includes a first EO 1810 and a second EO 1820 connected by branch 1815. Branched EO 1800 can be synthesized by conventional phosphoramidite chemistry using asymmetric chemical branching. In this embodiment, only the first EO 1810 includes a leader sequence represented by a polymer of “L” units (where “L” represents a C2 spacer). Similarly, only the first EO includes a polymer of “Z” units (where “Z” represents a C12 spacer). The polymer of the Z units also plays a role in nanopore translocation. In this embodiment, the first EO includes a polymer of uracil (“U”) residues that is capable of selectively cleaving the EO by, for example, USER®, and the second EO includes a photocleaving element (“PC-spacer”) for UV-mediated cleavage. The 3' oligonucleotide primer (SEQ ID NO: 14) sequence of each EO is identical and is designed to hybridize with the M3 template construct. In some embodiments, oligonucleotide primers are synthesized using one or more 2'-OMe base analogs. The inventors have found that, advantageously, variants of the DPO4 polymerase used in the Xpandomer synthesis are capable of utilizing 2'-OMe analogs as substrates. The branched EO includes a 5' terminal azide group for click attachment to the substrate. The lengths of the L, Z, D, and U polymers described in this exemplary embodiment are not intended to be limiting; the invention is understood to accommodate a variety of suitable polymer lengths and branched EO structures.

[0190] Figures 19A and 19B illustrate how branched EOs can generate and isolate a full-length Xpandomer population for nanopore sequencing. In step 1, the M3 template construct 1910 hybridizes with the branched EO 1920, which is bound to the support 1930. Only one EO in the branched structure contains the leader sequence 1925. In step 2, the cap-adaptor structure 1940 hybridizes with the M3 template construct. In step 3, Xpandomer copies 1950A and 1950B are synthesized using extension oligonucleotide primers 1927A and 1927B. As described herein, the 3' end of the Xpandomer is capped and attached to the free end of the cap primer construct. In step 4, the Xpandomer is treated with USER®, which selectively cleaves the first extension oligonucleotide, exposing the leader sequence 1925. In step 5, Xpandomer is cleaved and processed to transition from a “constrained” configuration to an “extended” configuration. In this step, incomplete or truncated Xpandomer byproducts can be washed away. In step 6, Xpandomer is released from the substrate via photocleavage of a second extended oligonucleotide. Advantageously, only the full-length Xpandomer 1950 includes the leader sequence 1925 and will pass through the nanopore to provide sequence information.

[0191] All references disclosed in this article, including patent references and non-patent references, are incorporated into this article as if each reference were incorporated separately.

[0192] It should be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. It should also be understood that, unless specifically defined herein, the terms used herein will be given their conventional meanings known in the relevant art.

[0193] Throughout this specification, references to "an embodiment," "a particular embodiment," and variations thereof indicate that a specific feature, structure, or characteristic described in connection with that embodiment is included in at least one embodiment. Therefore, the phrases "in one embodiment" or "in a particular embodiment" appearing in different places throughout this specification do not necessarily refer to the same embodiment. Furthermore, specific features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0194] As used in this specification and the appended claims, the singular forms “a,” “an,” “the,” and “the” include plural referents, i.e., one or more, unless the context explicitly specifies otherwise. It should also be noted that the connecting terms “and” and “or” are generally used in the broadest sense to include “and / or” unless the content and context explicitly specify inclusiveness or exclusivity as the specific circumstances dictate. Therefore, the use of alternatives (e.g., “or”) should be understood to mean any one, both, or any combination of alternatives. Furthermore, the composition of “and” and “or” as “and / or” herein is intended to cover embodiments including all relevant items or ideas, as well as one or more other alternative embodiments including fewer than all relevant items or ideas.

[0195] Unless the context otherwise requires, throughout the specification and subsequent claims, the word “comprising” and its synonyms and variations, such as “having” and “including,” and its variations, such as “comprising,” are interpreted in an open, inclusive sense, for example, “including but not limited to.” The term “consisting substantially of” limits the scope of the claims to specific materials or steps, or those that do not substantially affect the essential and novel features of the claimed invention.

[0196] The abbreviation “for example” derives from the Latin *exempli gratia* and is used herein to indicate a non-limiting example. Therefore, the abbreviation “for example” is synonymous with the term “for instance.” It should also be understood that the singular forms “a,” “an,” and “described” used herein and in the appended claims include the plural forms, and unless the context clearly specifies otherwise, the terms “X and / or Y” mean “X” or “Y” or “X” and “Y”, with the letter “s” following the noun indicating both the plural and singular forms of that noun. Furthermore, in the case where features or aspects of the invention are described according to the Markush group, it is intended and will be recognized by those skilled in the art that the invention includes and is therefore also described with respect to any individual member and any member subgroup of the Markush group, and the applicant reserves the right to amend the application or claims to expressly refer to any individual member or any member subgroup of the Markush group.

[0197] Any headings used in this document are for the reader's convenience only and should not be construed as limiting the invention or claims in any way. Therefore, the headings and abstracts provided herein are for convenience only and do not define the scope or meaning of the embodiments.

[0198] Where numerical ranges are provided herein, it should be understood that every intermediate value between the upper and lower limits of the range (based on one-tenth of the lower limit unit, unless the context explicitly specifies otherwise) and any other stated or intermediate values ​​within the range are included within this invention. The upper and lower limits of these smaller ranges may be independently included within that smaller range and are also covered by this invention, subject to any explicitly excluded limitations within the specified range. If a specified range includes one or two limits, ranges excluding any one or both of those included limitations are also included in this invention.

[0199] For example, unless otherwise stated, any concentration range, percentage range, proportion range, or integer range provided herein should be understood to include any integer value within the range and, where appropriate, its fractional value (e.g., one-tenth and one-hundredth of an integer). Furthermore, unless otherwise stated, any numerical ranges referenced herein relating to any physical characteristic (e.g., polymer subunits, size, or thickness) should be understood to include any integer within the range. As used herein, unless otherwise stated, the term "about" means ±20% of an indicated range, value, or structure.

[0200] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patents, and non-patent publications mentioned in and / or listed in the application data sheets are incorporated herein by reference in their entirety. These documents may be incorporated by reference for the purpose of describing and disclosing, for example, materials and methods described in publications, which may be used in conjunction with the invention currently described. The publications provided above and throughout this document are for the purpose of their publication prior to the filing date of this application only. Nothing herein should be construed as an admission that the inventor has no right to claim prior invention in any of the cited publications.

[0201] All patents, publications, scientific articles, websites, and other documents and materials cited or referenced herein indicate the skill level of a person skilled in the art to which this invention pertains, and each such cited document and material is incorporated herein by reference to the extent that it has been individually incorporated in its entirety or is set forth herein in its entirety. The applicant reserves the right to actually incorporate any and all materials and information from any such patents, publications, scientific articles, websites, electronically available information, and other cited materials or documents into this specification.

[0202] Generally, the terminology used in the following claims should not be construed as limiting the claims to the specific embodiments disclosed in the specification and claims, but should be interpreted to include all possible embodiments and the full scope of the equivalents granted by these claims. Therefore, the claims are not limited to this disclosure.

[0203] Furthermore, the written description portion of the patent includes all claims. Moreover, all claims, including all original claims and all claims from any and all priority documents, are hereby incorporated in their entirety into the written description portion of the specification, and the applicant reserves the right to any and all such claims physically incorporated into the written description or any other portion of this application. Therefore, for example, in no event can a patent be construed as allegedly lacking a written description of the claims because the precise wording of the claims is not elucidated in the written description portion of the patent using those phrases. The claims shall be interpreted in accordance with the law. However, notwithstanding any claim or consideration of ease or difficulty in interpreting any claim or any part thereof, in no event shall any adjustment or modification to the claims or any part thereof during the examination of one or more applications leading to this patent be construed as forfeiture of any and all equivalents that do not constitute part of the prior art.

[0204] The invention has been described broadly and generally herein. Each narrower group of species and subgenus that falls within the general disclosure also constitutes part of this invention. This includes the general description of the invention, with any accompanying conditions or negative limitations from which any subject matter is removed, regardless of whether the excised material is specifically cited herein.

[0205] Example Example 1 Solid-state Xpandomer synthesis - Extending the direct conjugation of oligonucleotides to microfluidic chips This example describes the solid-state synthesis of Xpandomer, a scalable copy of a single-stranded polynucleotide template containing an XNTP nucleotide analog with unique properties that improve nanopore sequencing. Solid-state Xpandomer synthesis is performed on a microfluidic chip matrix functionalized by covalently linking elongating oligonucleotides (“E-oligonucleotides”) to the chip. Polymerase-mediated elongation of the bound E-oligonucleotides with XNTPs yields Xpandomer products that remain attached to the chip and can be washed, processed, and released in an efficient and controlled manner.

[0206] The E-oligonucleotide (“E52 SIMA PC azide”) used in this experiment includes the following features: a 5' azide group followed by a PEG-6 monomer, a photocleavable spacer, a “lead” polymer sequence, a “aggregator” polymer sequence, fluorescently labeled nucleotides, and oligonucleotide primers. The role of the leader polymer and the aggregator polymer is, for example, to enhance the efficiency of Xpandomer translocation via a nanopore sensor, and is described in the applicant’s granted U.S. Patent No. 9,670,526, entitled “Concentrating a target molecule for sensing by a nanopore,” the entire contents of which are incorporated herein by reference.

[0207] A. Chip functionalization A commercially available continuous flow PCR chip manufactured by Zeonor (a cyclic olefin thermoplastic polymer) was used as the solid support in this experiment. The chip was functionalized with a direct conjugation alkyne using the light extraction protocol described herein. Briefly, the chip was coated with 350 µL of 80% DMS; then 60 µL of 10 mM propargyl maleimide in 80% DMSO was added, and the chip was incubated under a 20 W UV lamp for 20 min; then the chip was washed sequentially with 300 µL of 80% DMSO, 300 µL of 100% DMF, 300 µL of water, 300 µL of 300 mM Na2HPO4, 1% Tween-20, and 0.5% SDS solution, and incubated at 37 °C for 5 min; finally, the chip was washed with 300 µL of water and then with 300 µL of 3X PBS.

[0208] B. Click Response The solutions used for the click reaction were prepared as follows: 1) A catalyst mixture was prepared by mixing 5.0 µL water, 1.5 µL 100 mM THPTA, 1.5 µL 100 mM sodium ascorbate, 0.5 µL 10 mM CuSO4, 0.5 µL 100 mM aminoguanidine, and 1.0 µL 100% DMF, and the catalyst mixture was incubated at room temperature for 5–15 minutes; 2) A catalyst mixture was prepared by mixing 29.22 µL water, 4.00 µL 100% DMF, 1.25 µL 1000 mM sodium phosphate (pH 7.0), 0.78 µL 25.6 µM extended oligonucleotide (20 pmol E52 SIMA PC azide), 1.25 µL 100 mM MgCl2, 2.0 µL 100 mM aminoguanidine, and 1.5 µL 100 mM... 3) Prepare a substrate mixture using sodium ascorbate; 4) Add the substrate mixture to the catalyst mixture and vortex. Wash the functionalized chip with 300 µL of water and add 50 µL of the click reaction mixture, then incubate at room temperature for 20 minutes.

[0209] C. Extension reaction For the extension reaction, a 20 pmol:20 pmol ratio of DNA template to E-oligonucleotide was used. The template was a single-stranded 100-mer sequence derived from the HIV2 genome; the E-oligonucleotide primer sequence was 5'TCATAAGACGAACGGA 3' (SEQ ID NO:4). The single-stranded DNA template molecules were hybridized to the support-bound E-oligonucleotides by incubating the 20 pmol template with the chip at 37°C for 5 minutes, followed by washing with 300 µL of MEB buffer.

[0210] The extension reaction consisted of the following reagents: 4 nmol XNTP, 0.08 mM polyphosphate, 0.6 mM MnCl2, 0.5 M betaine, 0.25 M urea, 10 μg single-strand binding protein (SSB), 9 μg DNA polymerase protein (C4760), and 1.4 mM PEM combo (AZ8-8 and AZ43-43). The final reaction volume was brought to 50 µL using 5% NMS, and the extension was performed at 42 °C.

[0211] Following extension, the chip was processed and washed to remove the extension reagents. The bound Xpandomer product was released from the chip by photocutting (treatment with a Firefly UV curing lamp for 15 min), and the cleaved Xpandomer product was eluted from the chip in 60 µL of 40% acetonitrile. The Xpandomer product was analyzed by gel electrophoresis, with approximately 0.75 pmol of product per lane in a 2.5% Nusieve gel buffered with 1X TAE. Representative gels are shown in Figure 20, with the product from solid-state Xpandomer synthesis shown in lane 3, and full-length product indicated by arrows. For reference, the product from Xpandomer synthesis in solution using the same template is shown in lane 1. The denser bands observed in lane 3 indicate that solid-state Xpandomer synthesis improves product distribution and reduces partially or truncated product (the significantly larger size of the smeared band in lane 1 reflects the compositional differences of the E-oligonucleotides used in the solution-based extension reaction). Lane 2 is the negative control, in which the template used does not hybridize with the E-oligonucleotide, and lane 4 is the positive control, showing the solid-state extension products under different reaction conditions. These results demonstrate proof of concept for Xpandomer solid-state synthesis.

[0212] Example 2 Solid-state Xpandomer synthesis for extended sequencing (SBX) This example describes the solid-state synthesis and processing of Xpandomer copies of a 222mer template, followed by sequencing of the product using a nanopore sensor system. All workflow steps prior to sequencing were performed using Xpandomer intermediates and the final product bound to the matrix. This approach offers several advantages over solution-based workflows, such as the ability to sequentially add pure reagents to each reaction with reduced volume. In this experiment, the Xpandomer extension reaction was carried out on a microfluidic chip matrix coated with direct covalent linkages of E-oligonucleotides. Chip functionalization and click-linking of the E-oligonucleotides were performed as described in Example 1.

[0213] A. Extension reaction Extension was performed using a DNA template to E-oligonucleotide molar ratio of 10 pmol:20 pmol. The template used was a single-stranded 222mer sequence derived from the HIV2 genome, and the E-oligonucleotide used was the E52 oligonucleotide described in Example 1. The single-stranded DNA template molecules were hybridized to the bound E-oligonucleotide by incubating the 10 pmol template with the chip at 37°C for 5 min in a solution of 500 mM NH4OAc, 5% NMS, 1 M urea, and 2% PEG 8K, followed by washing with 300 µL of MEB buffer. Prior to extension, the chip was washed with 300 µL of a solution of 50 mM TrisCl, 200 mM NH4OAc, 5% NMS, 10% PEG 8K, and 1 M urea.

[0214] The extension reaction consisted of the following reagents: 4 nmol XNTP, 0.08 mM polyphosphate, 0.6 mM MnCl2, 0.5 M betaine, 0.25 M urea, 10 μg single-strand binding protein (SSB), 9 μg DNA polymerase protein (C4760), 1.0 mM AZ-8,8, and 4 mM AZ-43,43 PEM additives. A final reaction volume of 50 µL was achieved using 5% NMS and a buffer consisting of 50 mM Tris HCl (pH 8.84), 200 mM NH4OAc (pH 6.73), and 20% PEG. The extension reaction was carried out at 42 °C for 30 minutes.

[0215] After extension, the chip was washed three times with 300 µL of washing solution containing 100 mM MEPES in D2O, pH 8.0, 100 mM Na2HPO4, 1% Tween 20, 3% SDS, 15% DMF and 5 mM EDTA.

[0216] B. Xpandomer processing As shown in Figure 1C, the bound extended product was first treated with acid to break the phosphoramidite bond in Xpandomer to linearize the molecule. Acid-mediated cleavage was accomplished by adding 200 µL of 7.5 M DCl in D₂O to the chip and incubating at room temperature for 30 min. The bound product was then neutralized and washed by adding 900 µL of a solution of 100 mM HEPES (pH 8.0), 100 mM Na₂HPO₄ (pH 8.0), 1% Tween-20, 3% SDS, 15% DMF, and 5 mM EDTA in D₂O. The modified product was then added by adding 300 µL of a solution of 100 mM HEPES (pH 8.0) in D₂O, 100 mM Na₂HPO₄ (pH 8.0), 1% Tween 20, 3% SDS, 15% DMF, and 5 mM EDTA, while simultaneously adding 200 µmol succinic anhydride (separately packaged in a syringe) directly to the chip, followed by incubation at 23°C for 5 minutes. The modified product was then washed with 500 µL of a solution of 15% ACN and 5% DMSO in H₂O.

[0217] C. Release Xpandomer from the chip The bound Xpandomer product was released from the chip matrix via photocutting. First, 60 µL of a solution of 15% ACN and 5% DMSO in H₂O was added to the chip, followed by UV curing for 15 minutes. The released Xpandomer was eluted from the chip using a solution of 5% DMS and 15% acetonitrile. As shown in Figure 21A, the eluted material was first analyzed by gel electrophoresis. 15% of the sample was run in lane 3 of the gel (2.5% NuSieve agarose in 0.5 XTBE), and the full-length Xpandomer product is indicated by arrows. For reference, the product from a solution-based Xpandomer synthesis using the same template is shown in lanes 1 and 2. It can be seen that solid-phase synthesis produces tighter bands compared to solution-based synthesis, indicating a greater percentage of full-length product in the sample.

[0218] D. Nanopore sequencing For sequencing, protein nanopores were prepared by inserting α-hemolysin into a DPhPE / hexadecane bilayer member in buffer B1, wherein buffer B1 contained 2 M NH4Cl and 100 mM HEPES at pH 7.4. CisThe pore was filled with buffer B2, which contained 0.4 M NH4Cl, 0.6 M GuCl and 100 mM HEPES, at pH 7.4. The Xpandomer sample was heated to 70°C for 2 minutes, completely cooled, and then 2 µL of sample was added... Cis In the hole. Then apply a voltage pulse of 90mV / 390mV / 10µs, and acquire the data using LabVIEW software.

[0219] Sequence data were analyzed using histograms of sequence read groups from a single SBX reaction. The analysis software aligned each read to the template sequence and trimmed the sequence extents at the ends of reads that were misaligned with the correct template sequence. A representative histogram of nanopore sequencing of the 222Mer template is shown in Figure 21B. Notably, the Xpandomer product, resulting from solid-state synthesis and processing, produced highly accurate sequence reads across the entire length of the 222mer molecule when read by the nanopore sensor.

[0220] Example 3 Xpandomer synthesis with capped ends This example describes the end-capping of the Xpandomer product during synthesis and efforts to optimize the process using different reaction additives. The template used in the following experiments was a 121mer sequence derived from the HIV2 genome, and the E-oligonucleotide (“EO”) used was an E52 EO with the following characteristics: a 5' SIMA (fluorescent tag) followed by a leader polymer, an aggregator polymer, and an oligonucleotide primer with the sequence 5' TCATAAGACGAACGGA 3' (SEQ ID NO:4). The end cap consisted of a terminal oligonucleotide with the sequence 5' K[GCGTTAGGTCCCAGTGTTTAC (SEQ ID NO:15)]X 3', where K represents a G-shaped clip and X represents the PEG3 moiety. The terminal oligonucleotide was complementary to and hybridized to the 5' end of the template. The 5' end of the terminal oligonucleotide was connected to the ddCTP cap via a linker shown in feature 710A of Figure 7A to form a complete end cap structure.

[0221] In this experiment, five extension reactions were run, each containing the following reagents: a 1:1 molar ratio of template to E-oligonucleotide, 2 mM AZ-8,8 and 10 mM AZ-43,43 PEM additives, 5% NMS, 1.8 µg DNA polymerase, 0.08 mM XNTP, 0.08 mM polyphosphate, and 0.6 mM MnCl2. Reactions 2-5 included a two-molar excess of end caps relative to the template and EO, while reaction 1 did not include an end cap. Various additives were also included in the reactions, as shown below. Reaction 1: 0.5 M betaine, 0.25 M urea, and 2 µg single-chain binding protein (SSB); Reaction 2: 0.5 M betaine, 0.25 M urea, and 2 µg SSB; Reaction 3: 0.25 M urea; Reaction 4: 0.5 M betaine and 0.25 M urea; Reaction 5: 0.25 M urea and 2 µg SSB. The final reaction volume for each reaction was 10 µL, and the reactions were run at 42 °C.

[0222] The products of the extension reactions were analyzed by gel electrophoresis, as shown in Figure 22. Lane 1 shows the product of reaction 1, excluding the end cap. In this reaction, the SIMA dye was linked to EO, and the extension product was a 121-mer Xpandomer. Lanes 2-5 show the products of reactions 2-5, each including the end cap. In these reactions, the SIMA dye was linked to the end cap, unlike in reaction 1. It can be seen that in each of reactions 2-5, the end cap has been successfully linked to the Xpandomer by DNA polymerase, indicating that the Xpandomer represents a complete copy of the DNA template. Due to the incorporation of the terminal oligonucleotide of the end cap into the extension product, the products of reactions 2-5 are 100-mer Xpandomers and migrate faster on the gel than the 121-mer Xpandomer in reaction 1. These results show that the Xpandomer bands on the gel are very tight, indicating that the capping reaction is very efficient under the experimental conditions tested. Importantly, capping provides a method for labeling and capturing full-length Xpandomers, for example, for nanopore sequencing.

[0223] Example 4 Synthesis of end-capped solid-state Xpandomer This example describes the solid-state synthesis of 222mer Xpandomer and the capping of the full-length product. As described in Example 1, the solid-state synthesis was performed on a microfluidic chip matrix functionalized by covalently linking an elongating oligonucleotide (“E-oligo”) to the matrix. After completing a full-length copy of the template, the DNA polymerase encountered a terminal cap that hybridized to the 5' end of the template and attached the 5' end of the terminal cap to the 3' end of the Xpandomer. The fluorescent dye attached to the terminal cap allowed the full-length copy of the template to be visualized by gel electrophoresis.

[0224] A. Extension and capping reactions.

[0225] The template used in the following experiments was a 243mer sequence derived from the Streptococcus pneumoniae genome. The E-oligo (“EO”) used was E52 EO, which included a light-cleavable linker and an oligonucleotide primer with the sequence 5' TCATAAGACGAACGGA 3' (SEQ ID NO:4). The terminal cap included a terminal oligonucleotide with the sequence 5' K[GCGTTAGGTCCCAGTGTTTAC (SEQ ID NO:15)] 3', where K represents a G-shaped clip. The terminal oligonucleotide was complementary to and hybridized to the 5' end of the template. The 5' end of the terminal oligonucleotide was connected to the ddCTP cap via the linker shown in feature 710A of Figure 7A to form a complete terminal cap structure.

[0226] In this experiment, the same template, primers, and end caps were used to run extension reactions on four chips. Reaction 1 consisted of the following reagents: template in a molar ratio of 16:20:32:EO:end cap, 0.08 mM XNTP, 1 mM AZ-8,8 and 4 mM AZ-43,43 PEM, 9 μg DNA polymerase (DPO4 variant C4760), 10 µg SSB, 0.6 mM MnCl2, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NH4OAc, pH 6.73, 20% PEG, 5% NMS, 0.25 M urea, and 0.5 M betaine. 50 µL of the reaction was run at 42 °C. Reaction 2 consisted of the following reagents: template in a molar ratio of 6:10:12; EO: terminal cap; 0.08 mM XNTP; 1 mM AZ-8,8 and 4 mM AZ-43,43 PEM; 9 μg DNA polymerase (C4760); 10 µg SSB; 0.6 mM MnCl2; 0.08 mM polyphosphate; 50 mM Tris HCl, pH 8.84; 200 mM NH4OAc, pH 6.73; 20% PEG; 5% NMS; 0.25 M urea; and 0.5 M betaine. The 20 µL reaction was run at 37°C. Reaction 3 consisted of the following reagents: template in a molar ratio of 6:10:12; EO: terminal cap; 0.08 mM XNTP; 1 mM AZ-8,8 and 4 mM AZ-43,43 PEM; 9 μg DNA polymerase (C4760); 10 µg SSB; 0.6 mM MnCl2; 0.08 mM polyphosphate; 50 mM Tris HCl, pH 8.84; 200 mM NH4OAc, pH 6.73; 20% PEG; 5% NMS; 0.25 M urea; and 0.5 M betaine. The 25 µL reaction was run at 42 °C. Reaction 4 consisted of the following reagents: template in a molar ratio of 10:10:20: EO: terminal cap, 0.08 mM XNTP, 1 mM AZ-8,8 and 4 mM AZ-43,43 PEM, 9 μg DNA polymerase (C4760), 10 µg SSB, 0.6 mM MnCl2, 0.08 mM polyphosphate, 50 mM Tris HCl, pH 8.84, 200 mM NH4OAc, pH 6.73, 20% PEG, 5% NMS, 0.25 M urea, and 0.5 M betaine. The 25 µL reaction was run at 42 °C.

[0227] The products of the extension reaction were analyzed by gel electrophoresis on 2.5% NuSieve agarose gel, as shown in Figure 23. Lanes 1-4 show the products of reactions 1-4, each including a terminal cap. In these reactions, the SIMA dye was attached to the terminal cap. It can be seen that in each reaction, the terminal cap was successfully attached to Xpandomer by DNA polymerase, indicating that Xpandomer represents a complete copy of the DNA template. These results show that the Xpandomer bands on the gel are very tight, indicating that the capping reaction is also very efficient in solid-state synthesis. Interestingly, the efficiency of extension and capping appears to be affected by the nature of the additives present in the reaction. These results suggest that the solid-state synthesis of Xpandomer can be optimized through trial and error.

[0228] Example 5 Mirror library construction - connection of ternary connectors and library inserts This example describes the initial steps for generating the mirror library construct of this invention, wherein a triple-forked adaptor is ligated to a library fragment of double-stranded DNA. Figure 24A illustrates the basic structural features of the construct used in this experiment. The library fragment is a double-stranded 60-mer sequence derived from the HIV2 genome, wherein the "negative" strand (corresponding to the top strand in the inset) and the "positive" strand (corresponding to the bottom strand in the inset) are doped with 3' single-base overhangs. The polarity of the library strands is indicated by "5'" in the figure. As shown in Figure 24A, the triple-forked adaptor consists of three DNA strands, each with its polarity indicated by "3'". The top and bottom strands of the triple are 24-mer oligonucleotides with identical sequences, while the sequence containing the middle strand of the oligonucleotide is the reverse complementary sequence of the top and bottom strand sequences. The top and bottom strands also have 3' single-base overhangs that can be oriented to the library fragment. The 5' ends of the three strands are connected together by chemical branches to form a trifid linker, in which the middle and bottom strands form a double-stranded hybrid, while the top strand remains a single strand.

[0229] In this experiment, the ligation reaction was carried out in solution with a trifid linker to library fragment molar ratio of 5:1. The final reaction volume of 15 µL contained the following reagents: ligase reaction buffer, 3 mM ATP, 6% glycerol, 6% 1,2-propanediol, 0.1 µM library fragment, 0.5 µM trifid linker, 1 U / µL PNK, and 120 U / µL DNA ligase. The reaction was run at 15 °C for 5 min, and the ligation products were analyzed by gel electrophoresis in a 6% TBE-U gel stained with SYBR to visualize the products. A representative gel is shown in Figure 24B, where the unligated trifid linker and library reference fragment were run in lane 1, and the ligation products were run in lane 2. It can be seen that the ligated trifid linker / library fragment products are significantly different from the unligated products. Notably, the band corresponding to the unligated library fragment in lane 2 is very weak, indicating that most of the library fragment has been converted into the trifid linker / library linker.

[0230] Example 6 Mirror library construction - from triple adaptor extension and exonuclease digestion to produce mirror library constructs This embodiment describes the extension and digestion steps for generating a mirror library construct, which are illustrated in simplified form in Figure 25A. For the extension step, the top single-stranded strand of the triple-connector of the M1 construct is used as an extension primer by a DNA polymerase to synthesize a new DNA strand using the library fragment as a template. The extension of the M1 construct yields the M2 construct shown in the figure. For the digestion step, the original template strand of M2 (indicated by the 5' symbol) is then removed by exonuclease treatment to produce the M3 construct. M3 comprises two identical single-stranded copies of the "positive" strand of the library fragment and is referred to as the "mirror library construct."

[0231] The extension reaction was performed using the following reagents: 0.3 pmol M1 ligation product, 0.2 mM dNTPS, and 0.4 U / µL DNA polymerase (Vent®(exo-)) in Thermo Pol reaction buffer. Vent®(exo-) was chosen as the DNA polymerase for the extension reaction because it has no exonuclease activity and strong strand displacement activity. The extension reaction (5 µL total volume) was performed with an initial denaturation step at 95 °C for two minutes, followed by 25 cycles of 15 seconds at 95 °C and 6 seconds at 72 °C. After the denaturation / extension cycles, the reaction was quenched, denatured, and run on a gel to visualize the extension product.

[0232] For the digestion reaction, 0.3 pmol of the M2 extension product was treated with λ exonuclease (1 U / µL) in λ exonuclease reaction buffer. After exo addition, the digestion reaction (10 µL total volume) was run for 5 minutes. The digestion products were analyzed by gel electrophoresis as described above. The results of representative experiments are shown in Figure 25B. Lane 1 of the gel shows the M1 reference product (0.2 pmol product / lane), while lanes 2 and 3 show the products of the extension and digestion reactions, respectively. The large band in lane 2 indicates that the M1 ligation product was successfully converted into the larger M2 extension product, while the smaller band in lane 3 indicates that the M2 extension product was successfully converted into the M3 digestion product.

[0233] Example 7 Solid-state synthesis of M1 mirror library construct This example describes the workflow for constructing the M1 construct on a solid support. Figure 26A illustrates the workflow in a simplified form. In the following experiment, a Y-shaped linker (“YAD”) is first covalently bound to the support via click chemocovalent bonding; then a library fragment and a trifid linker are attached to the bound YAD to generate the M1 construct on the support. M1 is ultimately released from the support by cleaving the photosensitive bond between the YAD and the support.

[0234] A. Click connection between YAD and solid support.

[0235] A commercially available continuous flow PCR chip manufactured by Zeonor (a cyclic olefin thermoplastic polymer) was used as the solid support in this experiment. The chip was functionalized as described in Example 1. The copper click reaction was performed as follows: a 60 μL catalyst mixture was prepared by mixing 3 mM THPTA, 6 mM sodium ascorbate, 1 mM CuSO4, 5 mM aminoguanidine, and 10% DMF; a 120 μL substrate mixture was prepared by mixing 10% DMF, 25 mM sodium phosphate, pH 7.0, 50 mol YAD with an E6 oligonucleotide arm (linked to the azide moiety), 2.5 mM MgCl2, 5 mM aminoguanidine, and 6 mM sodium ascorbate. 30 μL of the catalyst mixture was then added to the substrate mixture, and 75 μL of this click mixture was added to the chip, followed by incubation at room temperature for 30 minutes.

[0236] B. Extension of the M1 construct After the click reaction, the chip was washed with water and solution "10002" (300 mM sodium phosphate, pH 8.0, 1% Tween-20, 0.5% SDS, and 1 mM EDTA). A 50 µL E52YAD mixture (containing the second oligonucleotide arm of the Y-shaped adaptor) was prepared by mixing 25 µL of solution "CHB002" (500 mM NH4OAc, 2% PEG 8K, 1 M urea, and 5% NMS) and 100 pmol E52 oligonucleotide and applied to the chip. The chip was incubated at 30 °C for 20 min to allow the E52 oligonucleotide to hybridize with the E6 oligonucleotide. The chip was then washed three times with 300 µL CHB002.

[0237] To ligate the library fragment and the trinoderic adaptor to the matrix-bound YAD, a 50 µL ligation reaction mixture was prepared by combining 15 pmol of the library insert (HIV2 60mer), 50 pmol of the trinoderic adaptor, 11 mM ATP, 1 U / μL T4 PNK, and a blunt / T4 ligase reaction mixture (available from NEB). The ligation mixture was added to the chip and incubated at 16 °C for 15 min. The ligation mixture was then removed from the chip, and 5 µL of 5'-deadenylate enzyme (50,000 U / mL) was added; the ligation mixture was then added back to the chip and incubated at 16 °C for 15 min. The chip was then washed twice with 300 µL of CHB002 and 300 µL of water. 300 µL of 10002 was then added, and the chip was incubated at 37 °C for 5 min. The chip was then washed three times with 300 µL of CHB002 and 300 µL of water. Then remove all liquid from the chip and add 75 µL of water.

[0238] To release the bound product from the chip, the photosensitive linker of YAD to the chip was cleaved by exposing the chip to ultraviolet light using a firefly curing lamp for 15 minutes. The released product was eluted from the chip, and the 1% recovered material was analyzed by gel electrophoresis. Representative gels are shown in Figure 26B. The sample in lane 1 represents 1% of the material recovered from the chip by photocleavage, while the samples in lanes 2-5 are control titrations of purified, uncleaved M1 synthesized in solution. It can be seen that the solid-state synthesis protocol successfully produced a fully assembled mirror library of M1 products.

[0239] Example 8 Sequencing was performed using an extended mirror library construct. This example illustrates a proof-of-concept for mirror library extended sequencing (SBX). The starting material in this experiment was the M1 product constructed around the HIV2 60mer library fragment described in Example 7. The extension conditions for producing the M2 product were as follows: approximately 7.5 pmol of M1 product, 0.2 mM dNTPs, and 0.16 U / µL LVent polymerase in Thermopol reaction buffer. 37.3 µL of the reaction solution was incubated at 95°C for 2 min, followed by 25 cycles at 95°C for 15 sec and 72°C for 6 sec. The M2 digestion conditions for producing the M3 product were as follows: 36.68 µL of the extension reaction was treated with 0.26 U / µL λ exonuclease in λ exo buffer. The reaction was run at 37°C for 5 min, followed by heat inactivation to produce the M3 mirror library construct.

[0240] The generation of Xpandomer copies of the M3 product was performed via solid-state synthesis. As an initial step, as shown in Figure 27, the M3 digest product was hybridized to a microfluidic chip. In this experiment, the chip was coated with click-linked E52 oligonucleotides designed for hybridization with the upper arm of the M3 YAD. The E52 oligonucleotides provided primers for the synthesis of copies of the top chain of the M3 construct, as indicated by the arrows in Figure 27. To hybridize the M3 digest with the chip and create a template for Xpandomer extension, 42.75 µL of the digest was mixed with 10 pmol of E6 oligonucleotide (designed to hybridize with the bottom chain arm of YAD and provide a copy for synthesizing the bottom chain of the M3 construct) and 10 pmol of capped oligonucleotide (designed to hybridize with the M3 trifurcation and provide free 5' triphosphate to the capping of each copy of the M3 library fragment) in a hybridization buffer consisting of 200 mM NH4OAC, pH 6.62, 2% PEG8K, and 0.25 M urea. 50 µL of the hybridization solution was incubated at 95 °C for 15 seconds and then added to the chip, which had been heated to 65 °C. The chip was then heated to 37 °C and incubated for five minutes.

[0241] A representative gel showing samples from the mirror library workflow is shown in Figure 28. Lanes 1-3 of the gel show reference samples of purified M1 product (0.5, 0.1, and 0.15 pmol M1, respectively). Lane 4 represents 1.3% of the extension reaction that produces M2 product, and lane 5 represents 1.2% of the digestion reaction that produces M3 product. Lane 6 represents 5% of the M3 material retained on the chip after hybridization. Importantly, despite the presence of secondary products in the digestion reaction, only the complete M3 product is retained on the chip.

[0242] For extended sequencing, all steps of Xpandomer synthesis and processing were performed on a microfluidic chip. Xpandomer extension conditions were as follows: 6% NMP, AZ in a 1:4 molar ratio, 8-8 with AZ, 43-43 PEM, 0.25 M urea, 0.5 M betaine, 80 µM XNTP, 10 µg SSB, and C4760 polymerase at 42°C for 30 min. After extension, the chip was washed. Xpandomer was then cleaved by treating the chip with 200 µL of 7.5 M DCl at 23°C for 30 min. The chip was then neutralized and washed. Xpandomer was then modified by adding 300 µL of 125 mM succinic anhydride and incubating at 23°C for 5 min. After washing, Xpandomer was photo-cut from the chip (15-second UV treatment) and eluted with 100 µL of a solution containing 100 µM NaPO4, 15% ACN, and 5% DMSO. Nanopore sequencing of the Xpandomer product was performed as described in Example 2. A representative nanopore trace of this sample is shown in Figure 29. The trace shows portions of two identical sequence reads, “read 1” and “read 2”, which reflect the sequence of the HIV2 library fragment (SEQ ID NO: 16). The reads are separated by signals generated by cap oligonucleotide structures referred to as “mirrors” in the figure.

[0243] Example 9 Synthesis of solid-state Xpandomer with end caps on acid-resistant magnetic beads This example demonstrates that solid-state synthesis of Xpandomer on beads is at least as efficient as in-solid synthesis. Four different Xpandomer synthesis reactions were performed: 1) in-solid synthesis (fluorescent SIMA dye on the extending oligonucleotide); 2) uncapped bead synthesis (dye on the extending oligonucleotide); 3) capped bead synthesis (dye on the terminal capped oligonucleotide); and 4) bead synthesis using an inhibitor oligonucleotide instead of the terminal cap. The extending oligonucleotide used in this experiment had the following sequence: 5' [azide]D 10 [PC-spacer]L 25 Z6[TCATAAGACGAACGGA(SEQ IDNO:4)] 3', (where “PC” represents a photocleavable spacer; “D” represents a PEG6 spacer; “L” represents a C2 spacer; and “Z” represents a C12 spacer). The beads are functionalized with alkyne groups and covalently bound to an elongating oligonucleotide, as discussed herein and with reference to Figure 5. 4 pmol of the elongating oligonucleotide on the bead hybridizes with 4 pmol of 100 mer template DNA + / - terminal cap oligonucleotide. The terminal cap included in reaction 3 has the following sequence: 3' ddCTPRK[GCGTTAGGTCCCAGTTTTAC(SEQ ID NO:17)]W 5', and the blocking oligonucleotide included in reaction 4 has the following sequence: 3' RK[GCGTTAGGTCCCAGTGTTTTAC(SEQ ID NO:18)]X 5', where "R" represents phosphoramide, "K" represents a G-clamp, "W" represents SIMA dye, and "X" represents PEG3. Use a cap or blocking oligonucleotide in excess of twice the molar amount relative to the template DNA. All extension reactions include: 50 mM Tris-HCl, 200 mM NH4OAc, 20% PEG, 1 M urea (0.25 M for reaction 4), 5% NMS, 10 mM PEM, 0.26 µg / µl DPO4 polymerase variant, 1.6 mM MnCl2, 100 µM dXTP, and 300 µM polyphosphate. Reactions 3 and 4 also included 0.02% Tween, and reaction 4 also included 0.5 M betaine. As shown in Figure 30, the extension reactions were run at 37°C for 60 minutes, and the extension products were analyzed by gel electrophoresis. It can be seen that bead-based extension (lane 2) is as effective as solution-based extension (lane 1). In addition, bead-based end-capping (lane 3, with dye on the end caps) is also very effective.

[0244] Example 10 Synthesis and processing of solid-state Xpandomer acid-resistant magnetic beads This example illustrates the efficient bead-based synthesis and processing of Xpandomer. Following primer extension, the Xpandomer product is acid-treated to cleave the aminophosphate bonds, yielding an extended polymer. The extended product is then released from the beads via photocleavage and analyzed by gel electrophoresis.

[0245] Bead functionalization and extension oligonucleotide ligation were performed as described in Example 9. Template DNA was hybridized to the extension oligonucleotides at a 1:1 molar ratio (4 pmol each). The extension reaction consisted of: 50 mM Tris-HCl, 200 mM NH4OAc, 50 mM TMACl, 50 mM GuCl, 20% PEG, 0.1 M urea, 6% NMP, 15 mM PEM, 0.26 µg / µl DPO4 polymerase variant, 1.4 mM MnCl2, 100 µM dXTP, 0.05 µg / µl Kod single-strand binding protein, 0.02% SDS, and 300 µM polyphosphate. The extension reaction was run at 37°C for 60 minutes. The samples were then treated with proteinase K at 55°C for 5' using buffer B (100 mM HEPES, 100 mM NaHPO4, 5% Triton, and 15% DMF), and washed again with buffer B. The samples were then acid-cleaved with 7.5 M DCI / 1% Triton, neutralized with buffer B, and modified with succinic anhydride from buffer B. The samples were then washed with buffer E (40% ACN) and photo-cleaved (1' exposed to UV). The released Xpandomer product was recovered and analyzed by gel electrophoresis, as shown in Figure 31. Lane 1 represents the Xpandomer product synthesized and processed in solution, while lanes 2-4 represent the Xpandomer product synthesized and processed on acid-resistant magnetic beads, with different additives in the elution buffers (100 mM PI in lane 2; 100 mM GuHCl in lane 3; and 100 mM HEPES in lane 4). It can be observed that the on-bead process shows better results than the solution process because the Xpandomer bands are tighter, indicating that the sample is enriched with the full-length product.

[0246] All U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patents, and non-patent publications mentioned in and / or listed in the application data sheets herein, including but not limited to U.S. Provisional Patent Application No. 62 / 808,768, filed February 21, 2019, and U.S. Provisional Patent Application No. 62 / 826,805, filed March 29, 2019, are incorporated herein by reference in their entirety. These documents may be incorporated by reference for the purpose of describing and disclosing, for example, the materials and methods described in publications, which may be used in conjunction with the invention currently described.

[0247] The present invention includes the following embodiments.

[0248] 1. A method for synthesizing copies of a nucleic acid template on a solid support, the method comprising the following steps: (a) A linker is fixed to the solid support, wherein the linker includes a first end near the solid support and a second end away from the solid support, wherein the first end is coupled to a maleimide portion and the second end is coupled to an alkyne portion, and wherein the maleimide portion is crosslinked with the solid support. (b) Connecting an oligonucleotide primer to the linker, wherein the oligonucleotide primer contains a nucleic acid sequence complementary to a portion of the 3' end of the nucleic acid template, wherein the 5' end of the oligonucleotide primer is coupled to an azide moiety, and wherein the azide moiety reacts with the alkyne moiety to form a triazole moiety; (c) Providing a reaction mixture comprising the nucleic acid template, a nucleic acid polymerase, a nucleotide substrate or analogue thereof, a suitable buffer, and optionally one or more additives, wherein the nucleic acid template specifically hybridizes to the oligonucleotide primer; and (d) Perform primer extension reaction to generate a copy of the nucleic acid template.

[0249] 2. The method according to embodiment 1, wherein the maleimide moiety is crosslinked with a solid matrix via a photo-initiated deprotonation reaction.

[0250] 3. The method according to embodiment 1, wherein the solid matrix comprises a polyolefin.

[0251] 4. The method according to embodiment 3, wherein the polyolefin is a cyclic olefin copolymer (COC) or polypropylene.

[0252] 5. The method according to implementation plan 1, wherein the nucleic acid template is a DNA template.

[0253] 6. The method according to embodiment 5, wherein the copy of the DNA template is a scalable polymer, wherein the scalable polymer comprises a chain of non-natural nucleotide analogs, and wherein each of the non-natural nucleotide analogs is operatively linked to an adjacent non-natural nucleotide analog via an aminophosphate bond.

[0254] 7. The method according to embodiment 6, wherein the scalable polymer is Xpandomer.

[0255] 8. The method according to embodiment 1, wherein the linker further comprises a spacer arm inserted between the first end and the second end, wherein the spacer arm comprises one or more monomers of ethylene glycol.

[0256] 9. The method according to embodiment 1, wherein the connecting base further comprises a cuttable portion.

[0257] 10. The method according to embodiment 1, wherein the solid support is selected from the group consisting of beads, tubes, capillaries and microfluidic chips.

[0258] 11. A method for selectively modifying the 3' end of a copy of a nucleic acid target sequence, the method comprising the following steps: (a) Providing a first oligonucleotide having a sequence complementary to a first sequence of the nucleic acid target sequence and a second oligonucleotide having a sequence complementary to a second sequence of the nucleic acid target sequence, wherein the first sequence of the nucleic acid target sequence is at the 3' of the second sequence of the nucleic acid target sequence, wherein the first oligonucleotide provides an extension primer for a nucleic acid polymerase and the 5' end of the second oligonucleotide is operatively linked to dideoxynucleotide 5' triphosphate, wherein the dideoxynucleotide 5' triphosphate provides a substrate for the nucleic acid polymerase; (b) Providing a reaction mixture comprising the first oligonucleotide and the second oligonucleotide, the nucleic acid target sequence, the nucleic acid polymerase, a nucleotide substrate or analogue thereof, a suitable buffer, and optionally one or more additives, wherein the first oligonucleotide and the second oligonucleotide specifically hybridize to the nucleic acid target sequence; and (c) Perform a primer extension reaction to generate a copy of the target sequence, wherein the 5' end of the second oligonucleotide is operatively ligated to the 3' end of the copy of the nucleic acid target sequence via the nucleic acid polymerase.

[0259] 12. The method according to embodiment 11, wherein the dideoxynucleotide 5' triphosphate is operatively linked to the 5' end of the second oligonucleotide via a flexible linker.

[0260] 13. The method according to embodiment 12, wherein the flexible connecting base comprises one or more hexyl (C6) monomers.

[0261] 14. The method according to embodiment 13, wherein the second oligonucleotide comprises one or more 2'-methoxyribonucleic acid analogs. 15. The method according to embodiment 11, wherein the 3' end of the second oligonucleotide is fixed to the first solid support.

[0262] 16. The method according to embodiment 15, further comprising the step of washing the first solid support to purify copies of the nucleic acid target operatively linked to the second oligonucleotide.

[0263] 17. The method according to embodiment 11, wherein the first oligonucleotide is immobilized to the first solid support.

[0264] 18. The method according to embodiment 17, further comprising the steps of releasing a copy of the nucleic acid target sequence from the first solid support and contacting the copy of the nucleic acid target sequence with a third oligonucleotide, wherein the third oligonucleotide has a sequence complementary to the sequence of the second oligonucleotide, wherein the third oligonucleotide specifically hybridizes with the second oligonucleotide, and wherein the 5' end of the third oligonucleotide is fixed to the second solid support.

[0265] 19. The method according to embodiment 18, further comprising the step of washing the second solid support to purify a copy of the nucleic acid target sequence operatively linked to the second oligonucleotide at the 3' end.

[0266] 20. The method according to embodiment 11, wherein the second oligonucleotide comprises one or more nucleotide analogs that increase the binding affinity of the second oligonucleotide to the nucleic acid target sequence.

[0267] 21. The method according to embodiment 11, wherein the second oligonucleotide is complementary to a heteronucleotide sequence operatively linked to the 5' end of the nucleic acid target sequence.

[0268] 22. The method according to embodiment 11, wherein the nucleic acid target sequence is single-stranded DNA and a copy of the target sequence is a scalable polymer, wherein the scalable polymer comprises chains of non-natural nucleotide analogs, and wherein each of the non-natural nucleotide analogs is operatively linked to an adjacent non-natural nucleotide analog via an aminophosphate bond.

[0269] 23. The method according to embodiment 11 or embodiment 18, wherein the first solid support and the second solid support are selected from the group consisting of beads, tubes, capillaries and microfluidic chips.

[0270] 24. A method for preparing a library of single-stranded DNA template constructs, wherein each of the template constructs comprises two copies of the same strand of a DNA target sequence, the method comprising the steps of: (a) Providing a group of DNA Y-shaped adaptors, wherein each of the Y-shaped adaptors comprises a first oligonucleotide and a second oligonucleotide, wherein the 3' region of the first oligonucleotide and the 5' region of the second oligonucleotide form a double-stranded region through sequence complementarity, wherein the 5' region of the first oligonucleotide and the 3' region of the second oligonucleotide are single-stranded and contain binding sites for oligonucleotide primers, and wherein the ends of the single-stranded regions of the first oligonucleotide and the second oligonucleotide are optionally fixed to a solid matrix; (b) Providing a group of double-stranded DNA molecules, wherein each of the double-stranded DNA molecules comprises a first strand and a second strand, wherein the first end of each of the double-stranded DNA molecules is compatible with the double-stranded end of the Y-shaped adaptor; (c) Providing a cap primer adaptor group, wherein each of the cap primer adaptors comprises a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide is inserted between the first oligonucleotide and the third oligonucleotide, wherein the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide are operatively linked by chemical branching at the 5' end of the first oligonucleotide and the 3' end of the second oligonucleotide, wherein a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, wherein a portion of the sequence of the second oligonucleotide is the reverse complementary sequence of portions of the sequences of the first oligonucleotide and the third oligonucleotide, and wherein the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region compatible with the second end of each of the double-stranded DNA molecules; (d) Connect the second end of each of the double-stranded DNA molecules to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of one of the cap primer adaptors; (e) Connect the first end of each of the double-stranded DNA molecules to the double-stranded end of one of the DNA Y-shaped adaptors; (f) Extending the first oligonucleotide of each of the connected cap primer adaptors using DNA polymerase, wherein the first strand of the connected double-stranded DNA molecule provides a template for the DNA polymerase, and wherein the DNA polymerase produces a third strand comprising the reverse complementary sequence of the sequence of the first strand of the double-stranded DNA molecule and the sequence of the first oligonucleotide of the Y-adaptor; and (g) Digestion of each of the first oligonucleotides of the linked Y-shaped adapter with an exonuclease at the 5' end, wherein the digestion removes the first oligonucleotide, the first strand of the double-stranded DNA molecule, and the second oligonucleotide of the cap primer adapter to produce a single-stranded template construct, wherein each of the single-stranded template constructs comprises two template molecules, each template molecule comprising the sequence of the second strand of the double-stranded DNA molecule, and wherein the two template molecules are operatively linked by the first oligonucleotide and the third oligonucleotide of the cap primer adapter.

[0271] 25. A single-stranded DNA template construct library, wherein each of the template constructs comprises a first copy and a second copy of the same strand of a DNA target sequence, wherein the first copy and the second copy of the target sequence are operatively linked; and wherein the single-stranded DNA template construct library is generated by the method according to embodiment 24.

[0272] 26. A method for generating a mirror-image Xpandomer molecular library, wherein each of the Xpandomer molecules comprises two copies of the same strand of a DNA target sequence, the method comprising the steps of: (a) Provide a single-stranded DNA template construct library according to embodiment 25; (b) Providing a first extended oligonucleotide group complementary to the single-stranded portion of the first strand of the Y-shaped inverse linker and a second extended oligonucleotide group complementary to the single-stranded portion of the second strand of the Y-shaped inverse linker, wherein the first extended oligonucleotide or the second extended oligonucleotide is optionally immobilized on a solid matrix; (c) The single-stranded DNA template construct library is specifically hybridized with the first extended oligonucleotide group and the second extended oligonucleotide group; (d) Providing a group of cap branching constructs, wherein the cap branching construct comprises a first oligonucleotide operatively linked to a second oligonucleotide, wherein the first oligonucleotide and the second oligonucleotide comprise sequences complementary to a portion of the sequences of the first oligonucleotide and the third oligonucleotide of the cap primer adapter construct, and wherein the first oligonucleotide and the second oligonucleotide of the cap branching construct provide a free 5' nucleoside triphosphate moiety; (e) Specifically hybridize the cap-branched construct population with the single-stranded DNA template construct population; and (f) Perform primer extension reaction to generate a first and a second copy of the DNA target sequence, wherein the Xpandomer copy is operatively linked via the cap branching construct.

[0273] 27. A method for generating a tagged double-stranded DNA amplicon library on a solid support, the method comprising the steps of: (a) Provide a group of double-stranded DNA molecules, wherein each of the double-stranded DNA molecules contains a first strand that specifically hybridizes with the second strand; (b) Providing forward PCR primers and reverse PCR primers, wherein the forward PCR primers comprise a first 5' heterotag sequence operatively linked to a 3' sequence complementary to a portion of the 3' end of the second strand of the double-stranded DNA molecule, and wherein the reverse PCR primers comprise a second 5' heterotag sequence operatively linked to a 3' sequence complementary to a portion of the 3' end of the first strand of the double-stranded DNA molecule; (c) Perform a first PCR reaction, wherein the double-stranded DNA molecule population is amplified to produce a first DNA amplicon product population, wherein the first DNA amplicon product contains a first heterologous sequence tag on a first end and a second heterologous sequence tag on a second end; (d) Providing a capture oligonucleotide structure immobilized on a solid support, wherein the capture oligonucleotide structure includes a first end and a second end, wherein the first end is covalently linked to the solid support, wherein the second end includes a capture oligonucleotide, the capture oligonucleotide including a sequence complementary to a portion of a second heterologous sequence tag of a first DNA amplicon product group, and wherein the capture oligonucleotide structure further includes a cleavable element inserted between the first end and the capture oligonucleotide; and (e) Performing a second PCR reaction comprising: the first DNA amplicon product group, a forward primer containing a sequence complementary to a sequence of one strand of the first heterologous sequence tag, and a reverse primer containing a sequence complementary to a sequence of one strand of the second heterologous sequence tag, wherein the first strand of the first DNA amplicon product group specifically hybridizes with the captured oligonucleotide, and wherein the second PCR reaction produces an immobilized DNA amplicon product group, wherein the second strand of the immobilized DNA amplicon product is operatively linked to the solid support.

[0274] 28. A method for preparing a library of single-stranded DNA template constructs, wherein each of the template constructs comprises two copies of the same strand of a DNA target sequence, the method comprising the steps of: (a) Providing a library of DNA amplicon products immobilized on a solid support according to embodiment 27; (b) Providing a cap primer adaptor group, wherein each of the cap primer adaptors comprises a first oligonucleotide, a second oligonucleotide, and a third oligonucleotide, wherein the second oligonucleotide is inserted between the first oligonucleotide and the third oligonucleotide, wherein the first oligonucleotide, the second oligonucleotide, and the third oligonucleotide are operatively linked by chemical branching at the 5' end of the first oligonucleotide and the 3' end of the third oligonucleotide, wherein a portion of the sequence of the first oligonucleotide is identical to a portion of the sequence of the third oligonucleotide, wherein a portion of the sequence of the second oligonucleotide is the reverse complementary sequence of portions of the sequences of the first oligonucleotide and the third oligonucleotide, and wherein the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide form a double-stranded region compatible with the free ends of each of the tagged immobilized DNA amplicon products; (c) Connect the free end of each of the immobilized DNA amplicon products to the 5' end of the second oligonucleotide and the 3' end of the third oligonucleotide of the cap primer adapter; (d) Extending from the 3' end of each of the first oligonucleotides of the cap primer adapter with DNA polymerase, wherein the second strand of the immobilized DNA amplicon product provides a template for the DNA polymerase, and wherein the DNA polymerase produces a third strand, wherein the third strand is a copy of the second strand; (e) Cleavage of the cleavable element of each of the captured oligonucleotide structures, wherein the cleavage releases the DNA amplicon product from the solid support and generates a free 5' end on the second strand of each of the DNA amplicon products; and (f) Digestion of the free 5' end of the cleaved second strand of each of the DNA amplicon products with an exonuclease, wherein the digestion removes the second strand of the DNA amplicon product and the second oligonucleotide of the cap primer adapter to produce a single-stranded template construct library, wherein each of the single-stranded template constructs comprises two copies of the first strand of the DNA amplicon product operatively linked by the first oligonucleotide and the third oligonucleotide of the cap primer adapter.

[0275] 29. A single-stranded DNA template construct library, wherein each of the template constructs comprises a first copy and a second copy of the same strand of a DNA target sequence, wherein the first copy and the second copy of the DNA target sequence are operatively linked; and wherein the single-stranded DNA template construct library is generated by the method according to embodiment 28.

[0276] 30. A method for generating a mirror-image Xpandomer molecular library, wherein each of the Xpandomer molecules comprises two copies of the same strand of a DNA target sequence, the method comprising the steps of: (a) Provide a single-stranded DNA template construct library according to embodiment 29; (b) Providing an extended oligonucleotide group complementary to a second tag of the DNA amplicon product, wherein the extended oligonucleotides are immobilized on a solid matrix; (c) Hybridize the single-stranded DNA template construct with the extended oligonucleotide; (d) Providing a group of cap branching constructs, wherein the cap branching construct comprises a first oligonucleotide operatively linked to a second oligonucleotide, wherein the first oligonucleotide and the second oligonucleotide comprise sequences complementary to a portion of the sequences of the first oligonucleotide and the third oligonucleotide of the cap primer adapter construct, and wherein the first oligonucleotide and the second oligonucleotide of the cap branching construct provide a free 5' nucleoside triphosphate moiety; (e) Specifically hybridize the cap-branched construct population with the DNA template construct population; and (f) Perform a primer extension reaction to generate Xpandomer copies of the first and second copies of the DNA target sequence, wherein the Xpandomer copies are operatively linked to the cap branch construct.

[0277] 31. The method according to embodiment 30, wherein the capturing oligonucleotide structure and the extending oligonucleotide are fixed on the same solid support, wherein the extending oligonucleotide includes a cleavable hairpin structure, and wherein the cleavable hairpin structure is cleaved during a cleavage step to provide a binding site for the DNA amplicon product.

[0278] 32. The method according to embodiment 30, wherein the capture oligonucleotide structure is immobilized on a first matrix of a first chamber of a microfluidic card, and the extension oligonucleotide is immobilized on a second matrix of a second chamber of the microfluidic card, wherein the first chamber is configured to generate the single-stranded DNA template construct population, and the second chamber is configured to generate the Xpandomer copy population of the single-stranded DNA template construct.

[0279] 33. The method according to embodiment 30, wherein the capturing oligonucleotide structure is immobilized on a bead support and the extending oligonucleotide is immobilized on a COC chip support, wherein the bead support is configured to generate the single-stranded DNA template construct population and the COC chip support is configured to generate the Xpandomer copy population of the DNA template construct.

[0280] 34. The method according to embodiment 30, wherein the capture oligonucleotide structure and the extending oligonucleotide are immobilized on a bead support, wherein the bead support is configured to generate the single-stranded DNA template construct population and the Xpandomer copy group of the DNA template construct.

[0281] 35. The method according to embodiment 30, wherein the extending oligonucleotide is provided by a branched oligonucleotide structure, wherein the branched oligonucleotide structure includes a first extending oligonucleotide operatively linked to a second extending oligonucleotide via a chemical branch, wherein the first extending oligonucleotide includes a leader sequence, an aggregator sequence, and a first cleavable portion inserted between the chemical branch and the leader sequence and the aggregator sequence, and wherein the second extending oligonucleotide includes a second cleavable portion.

Claims

1. A method for synthesizing copies of a nucleic acid template on a solid support, the method comprising the following steps: (a) A linker is fixed to the solid support, wherein the linker includes a first end near the solid support and a second end away from the solid support, wherein the first end is coupled to a maleimide portion and the second end is coupled to an alkyne portion, and wherein the maleimide portion is crosslinked with the solid support. (b) Connecting an oligonucleotide primer to the linker, wherein the oligonucleotide primer contains a nucleic acid sequence complementary to a portion of the 3' end of the nucleic acid template, wherein the 5' end of the oligonucleotide primer is coupled to an azide moiety, and wherein the azide moiety reacts with the alkyne moiety to form a triazole moiety; (c) Providing a reaction mixture comprising the nucleic acid template, a nucleic acid polymerase, a nucleotide substrate or analogue thereof, a suitable buffer, and optionally one or more additives, wherein the nucleic acid template specifically hybridizes to the oligonucleotide primer; and (d) Perform primer extension reaction to generate a copy of the nucleic acid template.

2. The method according to claim 1, wherein the maleimide moiety is crosslinked with the solid matrix via a photo-initiated deprotonation reaction.

3. The method of claim 1, wherein the solid matrix comprises a polyolefin.

4. The method according to claim 3, wherein the polyolefin is a cyclic olefin copolymer (COC) or polypropylene.

5. The method according to claim 1, wherein the nucleic acid template is a DNA template.

6. The method of claim 5, wherein the copy of the DNA template is a scalable polymer, wherein the scalable polymer comprises a chain of non-natural nucleotide analogs, and wherein each of the non-natural nucleotide analogs is operatively linked to an adjacent non-natural nucleotide analog via an aminophosphate bond.

7. The method of claim 6, wherein the scalable polymer is Xpandomer.

8. The method of claim 1, wherein the linker further comprises a spacer arm inserted between the first end and the second end, wherein the spacer arm comprises one or more monomers of ethylene glycol.

9. The method of claim 1, wherein the connecting base further comprises a cuttable portion.

10. The method of claim 1, wherein the solid support is selected from the group consisting of beads, tubes, capillaries, and microfluidic chips.

Images