Primer pair, kit, detection method for identifying genetic sex of paralichthys olivaceus and application thereof

Abstract

This application discloses a primer pair, kit, detection method, and application for identifying the genetic sex of *Pelteobagrus vachelli*. Through GWAS and Fst analysis of *Pelteobagrus vachelli*, a male-specific InDel marker was identified. This InDel marker is located at position 23294490 on chromosome 3 of the *Pelteobagrus vachelli* XX genotype reference genome GCF_030014155.1, where the inserted sequence "GTTATT" is present. This application also discloses a primer pair for amplifying this InDel marker sequence, a kit containing this primer pair, and an identification method. This method involves PCR amplification of extracted *Pelteobagrus vachelli* genomic DNA, followed by electrophoretic detection of the amplified products. The presence of two bands indicates a male, while one band indicates a female. The identification method provided in this application allows for early, rapid, and accurate identification of the genetic sex of *Pelteobagrus vachelli* with an accuracy rate of 100%.

Description

Technical Field

[0001] This application relates to the field of genetic sex identification technology for yellow catfish (Pelteobagrus vachelli), specifically to a primer pair, reagent kit, detection method, and its application for identifying the genetic sex of yellow catfish. Background Technology

[0002] The Vachellii yellow catfish, also known as the Yangtze yellow catfish, belongs to the order Siluriformes, family Bagridae, and genus Tachysurus. It is widely distributed in the Yangtze and Pearl River systems of my country and is a unique, high-quality freshwater economic fish species. In recent years, the yellow catfish aquaculture industry has developed rapidly in my country. The hybrid yellow catfish "Huangyou No. 1" has become one of the important freshwater aquaculture varieties in my country, with aquaculture areas covering the Yangtze River Basin, Pearl River Basin, and some northern provinces. The scale of aquaculture and economic benefits have been increasing year by year. The hybrid yellow catfish "Huangyou No. 1" is obtained by crossbreeding the Vachellii yellow catfish (selected through multiple generations) as the male parent and the common yellow catfish as the female parent. It possesses excellent traits such as rapid growth, tolerance to transportation, high spawning rate, and strong resistance to adverse conditions, and has been promoted for aquaculture in many parts of my country.

[0003] Currently, the farming of *Pelteobagrus vachelli* is constrained by a shortage of high-quality paternal fry. In the artificial breeding of hybrid *Pelteobagrus vachelli*, a large number of males are used, while the number of females is relatively small. Nearly sexually mature *Pelteobagrus vachelli* can only be sexed during the breeding season through their secondary male sexual characteristics (such as genital buds). In other seasons, it is impossible to completely distinguish males and females by appearance alone, and juveniles are virtually indistinguishable. More importantly, *Pelteobagrus vachelli* exhibits significant sexual dimorphism between males and females; two-year-old males bred in the same batch grow more than twice as fast as females. Related research and industry studies also indicate that the offspring of hybrid *Pelteobagrus vachelli* show a certain degree of sexual dimorphism in growth, with males growing more significantly than females. This suggests that breeding all-male hybrid *Pelteobagrus vachelli* is an important direction in breeding and a crucial means for breeding units to control core germplasm. Therefore, developing sex-specific molecular markers that can identify the XX, XY, and YY genotypes of yellow catfish and establishing a rapid method for identifying the genetic sex of yellow catfish is crucial for further improving breeding efficiency and success rate, accelerating the sex-controlled breeding process, and reducing breeding costs. This is of great significance to the aquaculture and breeding of yellow catfish.

[0004] In recent years, although there have been reports on sex-specific molecular markers in *Pelteobagrus vachelli*, the sex determination mechanism and key genomic regions of *Pelteobagrus vachelli* remain unclear. Accurate sex identification in *Pelteobagrus vachelli* still faces significant challenges. The genetic association between existing markers and sex-determining regions cannot be verified, rendering these markers unreliable. Their stability during multi-generational breeding is difficult to guarantee due to genetic drift. Furthermore, reported sex molecular markers in *Pelteobagrus vachelli* often fail to match phenotypic patterns in many populations, and their stability during multi-generational breeding is difficult to guarantee due to genetic drift. In addition, existing markers typically rely on the presence or absence of male-specific bands to determine sex. When DNA quality is low, male samples may be misidentified as females due to the absence of amplified bands, posing a false negative risk and affecting the accuracy of identification results.

[0005] Therefore, developing a molecular marker and identification method that can accurately and stably distinguish the sex of XX and XY genotypes in yellow catfish is of great significance for sex-controlled breeding research and industrial development of yellow catfish. Summary of the Invention

[0006] In view of this, the purpose of this application is to provide a molecular marker and identification method for accurately and stably distinguishing the XX and XY genotypes of *Pelteobagrus vachelli*. This application utilizes whole-genome resequencing and structural variation analysis of male and female *Pelteobagrus vachelli* populations to screen for a female-homozygous, male-heterozygous InDel insert fragment as a sex-specific molecular marker. Based on the flanking sequences of this molecular marker, specific primer pairs are designed, and PCR amplification accurately determines the genotype sex of the tested individual based on the number of bands in the amplified product. The technical solution provided in this application can achieve 100% accurate differentiation between the XX and XY genotypes of *Pelteobagrus vachelli*, and does not rely on the presence or absence of a male-specific band to determine sex. This effectively avoids false negative results caused by poor DNA quality. Sex identification can be performed from fertilized eggs to adult fish, and it is simple, fast, low-cost, and harmless to the fish, providing reliable technical support for sex control breeding of *Pelteobagrus vachelli* and the cultivation of new all-male hybrid *Pelteobagrus vachelli* varieties.

[0007] To achieve the above objectives, this application provides the following technical solution:

[0008] In one aspect, this application provides a primer pair for identifying the genetic sex of the yellow catfish, the primer pair being used to detect the inserted InDel molecular marker in the genome of the yellow catfish;

[0009] The InDel molecular marker is a molecular marker containing an inserted sequence at position 23294490 on chromosome 3 of the XX genotype reference genome GCF_030014155.1 of the yellow catfish. The inserted sequence is “GTTATT”. In XY genotype males, the InDel molecular marker is heterozygous for insertion, meaning that the Y chromosome of the male contains the inserted sequence, while the X chromosome does not. In XX genotype females, the InDel molecular marker is homozygous for non-insertion, meaning that neither of the two X chromosomes of the female contains the inserted sequence.

[0010] The InDel molecular marker described above corresponds to the nucleotide sequence shown in SEQ ID NO.1 on the X chromosome; the InDel molecular marker corresponds to the nucleotide sequence shown in SEQ ID NO.2 on the Y chromosome; compared with the sequence shown in SEQ ID NO.1, SEQ ID NO.2 inserts the GTTATT sequence between positions 324-325 corresponding to SEQ ID NO.1.

[0011] The term "InDel marker" refers to a genetic marker formed based on insertion / deletion variations; this application describes an insertion-type marker. It should be understood that the aforementioned InDel marker does not refer only to the nucleotide fragment GTTATT, but rather to any DNA molecule containing the characteristics of the insertion sequence at a specific insertion site in the *Pelteobagrus vachelli* genome, as long as it reflects the insertion heterozygous (male) or homozygous non-insertion (female) state at that site. In other words, the scope of protection of this application covers primers designed based on any form of marker sequence designed based on the disclosed insertion / deletion sites and their sequence information, and is not limited to the sequence molecules specifically shown in the embodiments of this application.

[0012] In some preferred embodiments, the primer pair comprises:

[0013] Upstream primer: TAGTCCAGTGAGACGCCAGA (SEQ ID NO.3);

[0014] Downstream primer: TTCTAGTCACCCAAGCGCAG (SEQ ID NO.4).

[0015] The nucleotide sequences of the InDel marker sequences used for amplification by the above primer pairs are shown in SEQ ID NO.1 (X sequence) and SEQ ID NO.2 (Y sequence).

[0016] Secondly, this application provides a kit for identifying the genetic sex of yellow catfish, the kit comprising the primer pair described in the first aspect.

[0017] In some embodiments, the kit further includes DNA polymerase, Mg 2+ One or more of the following: dNTPs, PCR buffer, and sterile water.

[0018] In some embodiments, the kit further includes a positive control and a negative control; the positive control is a liquid preparation containing genomic DNA of XY-type male yellow catfish, and the negative control is a liquid preparation containing genomic DNA of XX-type female yellow catfish.

[0019] Thirdly, this application provides a method for identifying the genotype sex of the yellow catfish (Pelteobagrus vachelli), comprising the following steps:

[0020] Obtain genomic DNA samples from the yellow catfish to be tested;

[0021] The genomic DNA sample was amplified by PCR using the primer pair described in the first aspect;

[0022] The amplification products were detected by electrophoresis.

[0023] The genotype and sex of the yellow catfish to be tested are determined based on the electrophoresis results: if the electrophoresis result shows one amplified band, the individual to be tested is determined to be a female with the XX genotype; if the electrophoresis result shows two amplified bands, the individual to be tested is determined to be a male with the XY genotype.

[0024] In some embodiments, the PCR amplification reaction system, in 10 μL quantities, includes: 3 μL ddH2O, 5 μL PreMix PCR buffer, 0.5 μL upstream primer, 0.5 μL downstream primer, and 1 μL genomic DNA template.

[0025] In some embodiments, the PCR amplification reaction program is as follows: 95 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, 34 cycles; 72 °C final extension for 5 min; cooling to 4 °C.

[0026] In some implementations, the amplification products can be sequenced, and the results can be used to determine the outcome.

[0027] If the sequencing results show that only the sequence shown in SEQ ID NO.1 is present, then it is determined to be a female with the XX genotype;

[0028] If the sequencing results show the presence of both SEQ ID NO.1 and SEQ ID NO.2, the individual is identified as an XY genotype male.

[0029] In some embodiments, the genomic DNA sample is extracted from the fin tissue of the yellow catfish (Pelteobagrus vachelli).

[0030] Fourthly, this application provides the application of the primer pairs described in the first aspect and the kit described in the second aspect in the genotypic sex identification, screening, or parthenogenesis of the yellow catfish.

[0031] Compared with the prior art, this application has at least the following beneficial effects:

[0032] The InDel molecular marker screened in this application is homozygous without insertion in female yellow catfish of the XX genotype, and heterozygous with insertion in male individuals of the XY genotype. The accuracy of sex identification using this marker is 100%. Primer pairs designed based on this marker can accurately determine genotype sex by PCR amplification combined with electrophoresis detection, based on the number of bands in the amplified products. This method avoids false negative results due to poor DNA quality and has the advantages of being simple to operate, low in cost, harmless to fish, and applicable to all developmental stages. It can be widely used for genotype sex identification and screening, and asexual breeding in yellow catfish, providing reliable technical support for sex-controlled breeding research in yellow catfish. Attached Figure Description

[0033] Figure 1 The Fst Manhattan plot of sex differences in yellow catfish provided in this application embodiment shows significant differences in genotype between male and female populations on chromosome 3 of the genome.

[0034] Figure 2 A pairing diagram of the target fragment is provided for embodiments of this application, showing the 6 bp difference fragment on the X and Y chromosomes.

[0035] Figure 3 This is a schematic diagram of the gonads of physiologically type male and female catfish provided in the embodiments of this application. The accuracy of molecular markers is determined by comparing physiologically type male and female with genetically type male and female.

[0036] Figure 4 The image shows the agarose gel electrophoresis results of the PCR products for sex identification of *Pelteobagrus vachelli* provided in this application embodiment. There are 12 samples each of XX females and XY males.

[0037] Figure 5 The comparison results of the sequencing peak diagrams of the X and Y sequences of the yellow catfish provided in the embodiments of this application show a 6 bp difference between the X and Y sequences.

[0038] Figure 6 This image shows agarose gel electrophoresis results for sex determination of 66 randomly sampled yellow catfish from a large population. In the image, females with the XX genotype show one band of 494 bp, while males with the XY genotype show two bands of different sizes, 494 bp and 500 bp respectively. The three images, totaling 66 lanes, correspond to the 66 fish samples. Detailed Implementation

[0039] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0040] The materials used in the following embodiments are not limited to those listed below, and other similar materials may be used instead. Unless otherwise specified, the instruments shall be used under conventional conditions or as recommended by the manufacturer. Those skilled in the art should have relevant knowledge of the use of conventional materials and instruments.

[0041] In this application, unless the context clearly indicates otherwise, the terms “including,” “comprising,” “containing,” “having,” etc., shall be understood as open-ended and mean “including but not limited to.”

[0042] To better understand this teaching and without limiting its scope, all figures and other numerical values ​​used in the specification and claims to express quantities, percentages, or proportions should, in all cases, be understood to be modified by the term "about." Therefore, unless otherwise stated, the numerical parameters set forth in the following specification and appended claims are approximate values ​​that may be adjusted according to the desired performance. At a minimum, each numerical parameter should be interpreted based on the reported significant figures and by applying common rounding techniques.

[0043] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the subject matter of this application pertains. The technical solutions and effects of this application are described in detail below through more specific embodiments.

[0044] Example 1: Discovery and Primer Design of Sex Difference Fragments in Yellow Pepper (Pelteobagrus vachelli)

[0045] This embodiment provides a method for mining sex-difference fragments and designing primers for yellow catfish.

[0046] 1.1 Whole-genome resequencing of male and female populations of *Pelteobagrus vachelli*

[0047] The yellow catfish fry used in this application came from the yellow catfish breeding base in Sichuan. On the third day after the fry hatched (3DPH), they were airlifted with oxygen bags to the recirculating aquaculture system in the fish house of the College of Fisheries, Huazhong Agricultural University, where they were cultured under normal indoor conditions to reduce the impact of environmental stress.

[0048] Once the sexes could be distinguished by the appearance of the gonads, 60 individuals were randomly collected, anesthetized, and dissected. The sex of the individuals was determined by the appearance of the gonads and histological sections. The fins of each fish were preserved in labeled centrifuge tubes containing 95% ethanol. DNA was extracted from the fin tissues of 20 female fish and 20 male fish, and then whole-genome resequencing was performed.

[0049] 1.2 Comparison of male and female genomes and analysis of structural variations

[0050] The genomes of 20 female and 20 male catfish were aligned to the reference genome of female yellow catfish (GenBank accession number: GCF_030014155.1; version: HZAU_Pvac_v1; chromosome 3, GenBank number: NC_083462.1), and structural variation differences were analyzed.

[0051] Fst Manhattan plots of sex differences in *Pelteobagrus vachelli* were obtained through whole-genome resequencing and population genetic differentiation analysis, as shown in the following figures. Figure 1 As shown. From Figure 1 It can be seen that there are significant differentiation signals on chromosome 3, indicating that this chromosomal region is closely related to sex determination in yellow catfish.

[0052] The obtained differentially expressed InDel (insertion / deletion) fragments were sorted and screened, with 100% homozygous mutation-free females and 100% heterozygous mutation-free males as the screening targets, resulting in a reliable sex-difference fragment. At this site, the male Y sequence has a 6 bp insertion sequence "GTTATT" relative to the female X sequence. This InDel molecular marker is located at nucleotide position 23294490 on chromosome 3 of the reference genome of the XX genotype of *Pelteobagrus vachelli* in GenBank GCF_030014155.1 (hereinafter referred to as "this site"). At this site in the reference genome, the extracted nucleotide sequence on chromosome X (hereinafter referred to as "X sequence") is shown in SEQ ID NO.1, with a length of 494 bp; the nucleotide sequence on chromosome Y (hereinafter referred to as "Y sequence") is shown in SEQ ID NO.2, with a length of 500 bp. The pairing diagram of the X and Y target fragments is shown below. Figure 2 As shown, from Figure 2It is clearly visible that, compared to SEQ ID NO.1, SEQ ID NO.2 inserts a 6 bp nucleotide sequence (GTTATT) between positions 324-325 corresponding to SEQ ID NO.1; the rest of the sequence is identical. The X and Y sequences are as follows:

[0053] X sequence (494 bp, SEQ ID NO.1):

[0054] TAGTCCAGTGAGACGCCAGA CAGTGAATCATGGAGAGCAATATACAGTGAAATTGATTTTCCAGAATATTTGTGAGATAAATAAACCAGTTCCTCTCTTGTGCTGGTGTTTATAAGGGGATTTGAATATCTCAAACATCTGATCTGCAGACTGCTGCATGGCAGAACCAGG GTTAAACCAACTACAATCTGGAACTGACAAGCTTTTATGATCTGATTTTATTGTGTATGAATGATAGTCTCTATTTTGTCTATATATATTTTGGAGTGTTTTCTTTGCACAGGATTTGAGAGATCCAGTCAAGAGTAAAGCTAAGCAGTTAA G GTTTTTAGTCAAAGCCAATGAGTGGAGGATTTGAACCCCAAACCTTTTCGTCACCGCTGCTTCTGTGTTGCTGATTTCTGTGGTGTTGTTTTACAGGTCGGGTTTGTGGGGTTTCAGGTGAACAGATGAGTGAACTTGGGTGTCCACATCT CTGCGCTTGGGTGACTAGAA

[0055] Y sequence (500 bp, SEQ ID NO.2):

[0056] TAGTCCAGTGAGACGCCAGACAGTGAATCATGGAGAGCAATATACAGTGAAATTGATTTTCCAGAATATTTGTGAGATAAATAAACCAGTTCCTCTCTTGTGCTGGTGTTTATAAGGGGATTTGAATATCTCAAACATCTGATCTGCAGACTGCTGCATGGCAGAACCAGG GTTAAACCAACTACAATCTGGAACTGACAAGCTTTTATGATCTGATTTTATTGTGTATGAATGATAGTCTCTATTTTGTCTATATATATTTTGGAGTGTTTTCTTTGCACAGGATTTGAGAGATCCAGTCAAGAGTAAAGCTAAGCAGTTAA GGTTATT GTTTTTAGTCAAAGCCAATGAGTGGAGGATTTGAACCCCAAACCTTTTCGTCACCGCTGCTTCTGTGTTGCTGATTTCTGTGGTGTTGTTTTACAGGTCGGGTTTGTGGGGTTTCAGGTGAACAGATGAGTGAACTTGGGTGTCCACATCT CTGCGCTTGGGTGACTAGAA

[0057] 1.3 Design of sex-specific primers

[0058] Primers containing the InDel molecular marker sequence (SEQ ID NO. 1 / 2) obtained from the aforementioned screening were designed online. The primer pair includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO. 3, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 4. The specific primer sequences are shown below:

[0059] Upstream primer: TAGTCCAGTGAGACGCCAGA (SEQ ID NO.3);

[0060] Downstream primer: TTCTAGTCACCCAAGCGCAG (SEQ ID NO.4).

[0061] 1.4 Verification of sex-specific primers

[0062] Twenty-four fish were randomly selected from a cultured, normal control group of *Pelteobagrus vachelli*. Physiological sex was determined by secondary sexual characteristics (genital protuberance) and anatomical observation of the gonads: males at a certain size had a prominent genital protuberance, while females lacked one; the male gonads were branched, while the female gonads were granular. A schematic diagram of the gonads of physiologically sexed male and female *Pelteobagrus vachelli* is shown below. Figure 3 As shown. From Figure 3 It can be seen that the male fish's gonads are branched, while the female fish's gonads are granular, and there is a one-to-one correspondence between physiological males and females and genetic males and females.

[0063] After anesthetizing the yellow catfish, fin tissue was collected and preserved in 95% ethanol, with the sex information corresponding to the fin number information.

[0064] Genomic DNA samples were extracted from fin tissue, and the concentration was adjusted to 200 ng / μL after testing. Using the genomic DNA as a template, PCR amplification was performed using the primer pairs described above. The PCR reaction system (10 μL) contained: 3 μL ddH2O, 5 μL PreMix PCR buffer, 0.5 μL upstream primer (SEQ ID NO.3), 0.5 μL downstream primer (SEQ ID NO.4), and 1 μL DNA sample. The PCR amplification program was: 95 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, 34 cycles; 72 °C final extension for 5 min; cooling to 4 °C.

[0065] The PCR products were subjected to agarose gel electrophoresis. The agarose gel concentration was 3%-3.1%, the electrophoresis voltage was 180V, and the electrophoresis time was 90 min. The electrophoretic bands were observed in a gel imaging system.

[0066] The results of agarose gel electrophoresis of PCR products are as follows: Figure 4 As shown: among the 24 fish, 12 fish showed a single band (494 bp) in electrophoresis results, corresponding 100% to the physiologically female fish recorded in the sampling; the remaining 12 fish showed two bands (494 bp and 500 bp, respectively), corresponding 100% to the physiologically male fish recorded in the sampling. These results indicate that the primer pair designed in this embodiment can effectively distinguish between XX-genotype females and XY-genotype males of the yellow catfish (Pelteobagrus vachelli).

[0067] To further verify the aforementioned differentially expressed fragments, PCR amplification products from females with the XX genotype and males with the XY genotype, identified by electrophoresis, were sent to a sequencing company for Sanger sequencing. The comparison results of the X and Y sequence sequencing peaks of *Pelteobagrus vachelli* are shown below. Figure 5 As shown, the results indicate that female individuals with the XX genotype show a single peak at the insertion site, indicating that the individual does not contain the inserted sequence; male individuals with the XY genotype show overlapping peaks (i.e., the superposition of two base signals) at the insertion site, indicating that the X chromosome of the individual does not contain the inserted sequence and the Y chromosome does contain the inserted sequence, further verifying the existence of a 6 bp differential fragment on the X and Y sequences.

[0068] Example 2: Large-scale validation of sex identification based on XX and XY genotypes in Yellow Catfish (Pelteobagrus vachelli)

[0069] This embodiment utilizes the primer pairs designed in Example 1 to conduct large-scale genotypic sex identification of a population of yellow catfish (Pelteobagrus vachelli) to further verify the accuracy and reliability of the technical solution of this application.

[0070] 2.1 Collection of male and female samples of Yellow catfish (Pelteobagrus vachelli)

[0071] Sixty-six untreated, normal control group yellow catfish (Pelteobagrus vachelli) were randomly collected from the experimental breeding base. These fish were offspring of normal male and female reproduction and were raised in an indoor circular tank. After anesthesia, the fish were dissected, and their sex was determined by examining their gonads. The caudal fin rays of each fish were cut and placed into centrifuge tubes containing 95% ethanol and labeled with numbers. After each fish's fin rays were matched with a number, the tubes were stored at -80 ℃ for later use.

[0072] 2.2 Genomic DNA extraction from Yellow Catfish (Pelteobagrus vachelli)

[0073] DNA samples were extracted from fin tissue using the conventional phenol-chloroform method. After detecting the DNA concentration and quality using a NanoDrop 2000 ultraviolet spectrophotometer, the DNA concentration for each fish was adjusted to 200 ng / μL.

[0074] 2.3 PCR Amplification

[0075] Using the extracted genomic DNA as a template, PCR amplification was performed using the primer pair (SEQ ID NO.3 and SEQ ID NO.4) designed in Example 1. The PCR reaction system contained, in 10 μL volumes: 3 μL ddH2O, 5 μL PreMix PCR buffer, 0.5 μL upstream primer (SEQ ID NO.3), 0.5 μL downstream primer (SEQ ID NO.4), and 1 μL DNA sample (concentration of 200 ng / μL).

[0076] The PCR amplification program was as follows: 95 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, 34 cycles; 72 °C final extension for 5 min; then cooled to 4 °C.

[0077] 2.4 Agarose gel electrophoresis detection

[0078] PCR products were subjected to agarose gel electrophoresis. The agarose gel concentration was 3%–3.1%, the electrophoresis voltage was 150 V, and the electrophoresis time was 90 min. After electrophoresis, the electrophoretic bands were observed using a gel imaging system.

[0079] 2.5 Sex determination

[0080] From DNA extraction to gel electrophoresis, the entire process only records the sample number, without considering sex, to ensure the objectivity of the results.

[0081] The criteria for interpreting electrophoresis results are as follows:

[0082] If the electrophoresis result shows an amplified band (494 bp in size), the individual being tested is determined to be a female with the XX genotype.

[0083] If the electrophoresis results show two amplified bands (494 bp and 500 bp in size, respectively), the individual being tested is determined to be an XY genotype male.

[0084] 2.6 Large-scale validation results

[0085] Agarose gel electrophoresis results for sex determination of 66 yellow catfish (Pelteobagrus vachelli) are as follows: Figure 6 As shown. The sampling records were compared one by one with the electrophoresis results, and the identification results of the 66 fish are as follows:

[0086] First edition of the gel: 23 male fish showed two bands (494 bp and 500 bp in size, respectively), and 1 female fish showed one band (494 bp in size), which corresponded 100% with the male and female fish in the sampling records;

[0087] Second version of the glue: 23 female fish showed one band (494 bp in size), and 1 male fish showed two bands (494 bp and 500 bp in size respectively), which corresponded 100% with the male and female fish in the sampling records;

[0088] Third edition of the gel: random sampling, 5 male fish showed two bands (494 bp and 500 bp in size, respectively), and 13 female fish showed one band (494 bp in size), which corresponded 100% with the male and female fish in the sampling records.

[0089] The above results indicate that the primer pairs and identification method provided in this application achieve 100% accuracy in identifying the genotype and sex of Yellow catfish, demonstrating good reliability and stability, and are suitable for large-scale identification of the genotype and sex of Yellow catfish.

[0090] The present application has been described in detail above. Specific examples have been used to illustrate the principles and implementation methods of the present application. The descriptions of the embodiments above are only for the purpose of helping to understand the present application and its core ideas. It should be noted that those skilled in the art can make several improvements and modifications to the present application without departing from the principles of the present application, and these improvements and modifications also fall within the protection scope of the claims of the present application.

Claims

1. A primer pair for identifying the genetic sex of the yellow catfish (Pelteobagrus vachelli), characterized in that, The primer pair was used to detect the inserted InDel molecular marker in the genome of the yellow catfish (Pelteobagrus vachelli). The InDel molecular marker is a molecular marker containing an insertion sequence at position 23294490 on chromosome 3 of the XX genotype reference genome GCF_030014155.1 of the yellow catfish. The insertion sequence is GTTATT. In XY genotype males, the InDel molecular marker is heterozygous for insertion, meaning that the Y chromosome of the male contains the insertion sequence, while the X chromosome does not. In XX genotype females, the InDel molecular marker is homozygous for non-insertion, meaning that neither of the two X chromosomes of the female contains the insertion sequence.

2. The primer pair according to claim 1, characterized in that, The primer pair includes: Upstream primer: Nucleotide sequence as shown in SEQ ID NO.3; Downstream primer: Nucleotide sequence as shown in SEQ ID NO.

4.

3. A kit for identifying the genetic sex of the yellow catfish (Pelteobagrus vachelli), characterized in that, The kit includes the primer pair as described in claim 1 or 2.

4. The reagent kit according to claim 3, characterized in that, The kit also includes DNA polymerase, Mg 2+ One or more of the following: dNTPs, PCR buffer, and sterile water.

5. The reagent kit according to claim 4, characterized in that, The kit also includes a positive control and a negative control; the positive control is a liquid preparation containing genomic DNA of male yellow catfish with XY genotype, and the negative control is a liquid preparation containing genomic DNA of female yellow catfish with XX genotype.

6. A method for identifying the genotype sex of the yellow catfish (Pelteobagrus vachelli), characterized in that, Includes the following steps: Obtain genomic DNA samples from the yellow catfish to be tested; The genomic DNA sample was amplified by PCR using the primer pair described in claim 2; The amplification products were detected by electrophoresis. The genotype and sex of the yellow catfish to be tested are determined based on the electrophoresis results: if the electrophoresis result shows one amplified band with a size of 494 bp, the individual to be tested is determined to be a female with the XX genotype; if the electrophoresis result shows two amplified bands with sizes of 494 bp and 500 bp respectively, the individual to be tested is determined to be a male with the XY genotype.

7. The method according to claim 6, characterized in that, The PCR amplification reaction system, in 10 μL increments, includes: 3 μL ddH2O, 5 μL PreMix PCR buffer, 0.5 μL upstream primer, 0.5 μL downstream primer, and 1 μL genomic DNA template. The PCR amplification reaction program is as follows: 95 °C pre-denaturation for 5 min; 94 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, 34 cycles; 72 °C final extension for 5 min; cooling to 4 °C.

8. The method according to claim 6, characterized in that, The amplification products can be sequenced, and the results can be used to determine the cause. If the sequencing results show that only the sequence shown in SEQ ID NO.1 is present, then it is determined to be a female with the XX genotype; If the sequencing results show the presence of both SEQ ID NO.1 and SEQ ID NO.2, the individual is identified as an XY genotype male.

9. The method according to claim 6, characterized in that, The genomic DNA sample was extracted from the fin tissue of the yellow catfish (Pelteobagrus vachelli).

10. The application of the primer pair according to claim 1 or 2, or the kit according to any one of claims 3-5, in the genotypic sex identification, screening, or parthenogenesis of *Pelteobagrus vachelli*.

Images