A marker for head and neck squamous cell carcinoma and application thereof

Abstract

This invention belongs to the field of medical biotechnology, specifically relating to a biomarker for head and neck squamous cell carcinoma and its application. The biomarker is SUMO-specific peptidase 1 (SENP1). This invention establishes a prognostic model for head and neck squamous cell carcinoma (HNSCC) by detecting the expression of frg, which is associated with prognosis. Further research revealed that SENP1 is an important biomarker and verified that it can inhibit the ferroptosis pathway in HNSCC by regulating ACSL4 expression through deSUMOylation, thereby promoting the proliferation and invasion of HNSCC cancer cells. This invention provides a novel ferroptosis pathway in HNSCC, and further identifies functional molecules involved in the initiation and development of HNSCC.

Description

Technical Field

[0001] This invention belongs to the field of medical biotechnology, specifically relating to a biomarker for head and neck squamous cell carcinoma and its application. Background Technology

[0002] Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide, with 500,000 new cases diagnosed annually. Its 5-year overall survival rate is low, approximately 50%, and is associated with high rates of metastasis and recurrence. More than 50% of patients are diagnosed at an advanced stage. Despite the lack of a preclinical history of malignancy, most patients present with advanced HNSCC. The most common treatment for HNSCC is surgery, followed by adjuvant radiotherapy or chemotherapy depending on the stage of the disease. However, advanced HNSCC is associated with poor prognosis and limited treatment options, highlighting the need to develop new treatment strategies. Chemotherapy resistance is a major cause of treatment failure in HNSCC, and this resistance is partly mediated by tumor cell apoptosis resistance. However, both apoptosis resistance and chemotherapy resistance cannot be effectively overcome. Therefore, elucidating the mechanisms of cancer cell death is crucial for identifying new treatment strategies.

[0003] Ferroprelation, a novel form of programmed cell death (PCD) characterized by the accumulation of free iron and lipid peroxidation, was first proposed by Dixon and colleagues in 2012. Research on ferroptosis in tumors has increased rapidly over the past decade. It is an iron-dependent form of cell death that relies on the accumulation of reactive oxygen species (ROS) in cells, unlike apoptosis and autophagy. Disorders of iron metabolism are a risk factor for cancer and can also promote tumor growth. Cancer cells exhibit iron addiction compared to normal cells, meaning they proliferate with an excessive dependence on iron. In fact, activation of the ferroptosis pathway may mask resistance to current chemotherapy drugs, opening a new therapeutic frontier for cancer treatment. Several ferroptosis-associated genes (FRGs) have been identified as biomarkers for the diagnosis, prognosis, and treatment of many cancers. A recent study showed that mRNA FTH1 can inhibit the proliferation of HNSCC cells by affecting the expression levels of glutathione and Fe, while simultaneously promoting GPX4 expression. However, the potential role of FRGs in the diagnosis, prognosis, and treatment of head and neck squamous cell carcinoma remains not fully elucidated.

[0004] Small ubiquitin-like modifiers (SUMOs) are highly conserved molecules that couple to lysine residues of underlying proteins during post-translational modification (PTM). This pathway is present in almost all eukaryotes and is crucial for maintaining genome integrity, transcriptional regulation, gene expression, and the regulation of intracellular signal transduction. SUMOs regulate many biological processes, including DNA damage repair, immune responses, carcinogenesis, cell cycle progression, and apoptosis. SUMO-specific peptidase 1 (SENP1) is a widely studied SUMO-specific protease that can uncouple SUMOs and SUMOylated proteins. Aberrant expression and activation of SENP1 are associated with a variety of malignant diseases, including those of the stomach, liver, pancreas, cervix, kidney, and breast. Although SENP1-mediated desumolation of proteins has a protective effect against iron deposition in cardiomyocytes, the expression of SENP1 in HNSCC and its relationship with ferroptosis remain unclear.

[0005] Acyl-CoA synthetase long chain 4 (ACSL4), located on the human X chromosome, encodes an enzyme that more readily produces 20-carbon polyunsaturated fatty acid (PUFA) substrates, such as arachidonic acid (AA) and eicosapentaenoic acid (EPA). ACSL4 plays a crucial regulatory role in hematologic malignancy, a cell death process induced by iron-dependent lipid peroxidation, primarily involving PUFA-containing phospholipids (PLs). Overexpression of ACSL4 enhances the production of PUFAs and promotes ferroptosis. ACSL4 is also considered a key disease biomarker for hepatocellular carcinoma (HNSCC). However, the regulation of ferroptosis in ACSL4 by SENP1 has not been reported.

[0006] Currently, the treatment status of head and neck squamous cell carcinoma (HNSCC) is characterized by a low 5-year overall survival rate, with over 50% of patients diagnosed at an advanced stage. A lack of preclinical history of malignancy is common, and most patients present with advanced HNSCC. The most common treatment is surgery, followed by adjuvant radiotherapy or chemotherapy depending on the disease stage. Treatment of HNSCC is prone to resistance to traditional drugs, limiting treatment options and leading to poor prognosis. However, ferroptosis can overcome traditional drug resistance; therefore, there is an urgent need for a new prognostic and immune-related ferroptosis biomarker to develop novel immunotherapeutic targets for head and neck squamous cell carcinoma. Summary of the Invention

[0007] To address the problem that existing treatments for head and neck squamous cell carcinoma often result in drug resistance to traditional drugs, thus limiting treatment options and leading to poor prognosis, the present invention adopts the following technical solution to achieve the above objective:

[0008] This invention provides a biomarker for head and neck squamous cell carcinoma, wherein the biomarker is SUMO-specific peptidase 1.

[0009] The present invention also provides primers for amplifying markers of head and neck squamous cell carcinoma, the primers comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO.1; and the nucleotide sequence of the downstream primer being shown in SEQ ID NO.2.

[0010] The present invention also provides the use of reagents for detecting markers of head and neck squamous cell carcinoma in the preparation of kits for diagnosing head and neck squamous cell carcinoma.

[0011] Preferably, the kit includes the SUMO-specific peptidase 1 as described in claim 1.

[0012] Preferably, the kit further includes an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO.1; and the nucleotide sequence of which is shown in SEQ ID NO.2.

[0013] Preferably, the kit further includes long-chain acyl-CoA synthase 4, glutathione peroxidase 4, and CCK-8 reagent.

[0014] Preferably, the kit further includes 2% fetal bovine serum, DMEM, thiobarbituric acid solution, PBS, iron standard diluent, iron reducing agent, iron probe, thiosalicylic acid solution, nicotinamide adenine dinucleotide phosphate solution, and sodium dodecyl sulfate.

[0015] Preferably, the expression of SUMO-specific peptidase 1 is detected by real-time quantitative PCR and Western blotting.

[0016] Preferably, the biomarker inhibits the ferroptosis pathway in head and neck squamous cell carcinoma by regulating ACSL4 expression through desumolation.

[0017] Preferably, the biomarker is used to promote the proliferation and invasion of head and neck squamous cell carcinoma tumor cells.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] This invention provides a biomarker for head and neck squamous cell carcinoma (HNSCC). The invention establishes a prognostic model for HNSCC by detecting the expression of frg, which is associated with prognosis. Further research revealed SENP1 as an important biomarker and validated that it can inhibit the ferroptosis pathway in HNSCC by regulating ACSL4 expression through deSUMOylation, thereby promoting the proliferation and invasion of HNSCC cancer cells. This invention provides a novel ferroptosis pathway in HNSCC, leading to the discovery of functional molecules involved in the initiation and development of HNSCC. Using the biomarker provided by this invention for the treatment of HNSCC does not induce drug resistance, offers multiple treatment options, and does not result in poor prognosis. Attached Figure Description

[0020] Figure 1 This document describes the identification of ferroptosis mRNAs in Example 1 of the present invention; wherein, A is a heatmap of 457 ferroptosis-related mRNAs; B is a volcano map of 457 ferroptosis-related mRNAs; and C is a network map of ferroptosis genes and mRNAs with different expressions.

[0021] Figure 2 This invention establishes a prognostic model for ferroptosis mRNA in HNSCC in Example 1 of this invention; wherein, A is a heatmap of 32 ferroptosis mRNAs; B is the 32 ferroptosis mRNAs screened out by univariate Cox regression analysis; C is the 13 ferroptosis mRNAs screened out by Lasso regression analysis; D is the mRNA coefficients associated with ferroptosis calculated by 10-fold cross-validation of Lasso regression.

[0022] Figure 3 This is a prognostic representation of seven types of ferroptosis mRNA in the training group, experimental group, and each group in Example 1 of the present invention; wherein, A shows the prognostic model of ferroptosis mRNA in the risk scores of the training, testing, and all groups; B is a survival risk status map of the train group, experimental group, and each group; C is a heatmap of the expression level of ferroptosis mRNA in the high-risk and low-risk groups (red for high expression, blue for low expression); D is the total survival of the train group, experimental group, and each high-risk and low-risk group, with p < 0.05 for all.

[0023] Figure 4 The figures are: A) Independent prognostic analysis and nomogram plotting in Embodiment 1 of the present invention; B) Univariate combined analysis of clinical characteristics; C) Multivariate combined analysis of clinical characteristics; D) Comprehensive risk score and clinical characteristic nomogram predict 5-year, 3-year, and 1-year survival rates of HNSCC patients; E) ROC curves for each group at 5 years, 3 years, and 1 year; F) Comparison of ROC curves of the risk group with clinical characteristics.

[0024] Figure 5 In Example 1 of this invention, SENP1 was highly expressed in head and neck squamous cell carcinoma (HNSCC) tissues and the CAL-27 cell line. Specifically, qRT-PCR results of A and B showed high SENP1 expression in HNSCC tissues; Western blot results of C and D confirmed high SENP1 expression in HNSCC tissues; qRT-PCR results of E showed high SENP1 expression in the CAL-27 cell line; and Western blot results of F and G confirmed high SENP1 expression in the CAL-27 cell line. Statistical data are expressed as Mean ± SEM. NSP > 0.05, *P < 0.05, **P < 0.01, ***P < 0.001.

[0025] Figure 6 In Example 1 of this invention, SENP1 promoted the proliferation, migration, and invasion of head and neck squamous cell carcinoma (HNSCC) in vitro. Specifically, qRT-PCR results in A and C showed the transfection efficiency of sh-SENP11 and oe-SENP1; B analyzed and evaluated the effect of SENP1 knockout or overexpression via CCK-8 on the proliferation of head and neck squamous cell carcinoma (HNSCC) cells; Western blotting results in D and E verified the transfection efficiency of sh-SENP11 and oe-SENP1; and F and G showed the transfection efficiency of sh-SENP1. After transfection with oe-SENP1, the migration and invasion abilities of head and neck squamous cell carcinoma (HNSCC) cells were detected using Transwell assay; after H and I transfection with sh-SENP1 and oe-SENP1, the cell migration ability of LSCC cells was detected using a wound healing assay; Student's t-test for comparison between two groups: NSP>0.05, *P<0.05, **P<0.01, ***P<0.001; One-way ANOVA for comparison of multiple groups: NSP>0.05, *P<0.05, **P<0.01, ***P<0.001.

[0026] Figure 7This invention relates to Example 1, which describes the effect of Erastin on ferroptosis in HNSCC cells and its influence on SENP1. Specifically, A represents the relative expression level of SENP1 in HNSCC cells treated with 10 μm Erastin for 24 hours using qRT-PCR; B and C represent the relative expression levels of SENP1 in HNSCC cells treated with 10 μm Erastin for 24 hours using Western blotting; D represents the activity of HNSCC cells after Erastin (10 μm, 24 h) treatment as detected by CCK-8 assay; E represents the expression level of iron ions in HNSCC cells after Erastin treatment; F represents the expression level of GSH in HNSCC cells after Erastin (10 μm, 24 h) treatment; and H represents the expression level of MDA in HNSCC cells after Erastin (10 μm, 24 h) treatment. Statistical analysis results are as follows: *P<0.05, **P<0.01, ***P<0.001, NSP>0.05.

[0027] Figure 8 This invention relates to an example of SENP1 regulating ferroptosis in HNSCC cells. Specifically, A represents the expression level of SENP1 in sh-SENP1 and oe-SENP1 after treatment with Erastin (10 μm, 24 h) detected by qRT-PCR; B and C represent the expression level of SENP1 in sh-SENP1 after treatment with Erastin (10 μm, 24 h) detected by Western blot; D represents the regulation of iron levels in HNSCC cells by SENP1 after treatment with Erastin (10 μm, 24 h); E represents the regulation of GSH levels in HNSCC cells by SENP1 after treatment with Erastin (10 μm, 24 h); and F represents the regulation of MDA levels in HNSCC cells by SENP1 after treatment with Erastin (10 μm, 24 h). Statistical analysis results are as follows: *P<0.05, **P<0.01, ***P<0.001, NSP>0.05.

[0028] Figure 9This invention relates to the interaction between SENP1 and ACSL4 in HNSCC cells in Example 1 of this invention. A shows the interaction between SENP1 and ACSL4 in HNSCC cells, as indicated by co-immunoprecipitation and Western blot analysis. B and C show the changes in ACSL4 after SENP1 silencing detected by Western blot. D shows the sumochemical analysis of ACSL4 in the control group and SENP1 in the silencing group. E and F show the expression of ferroptosis-related protein SLC7A11 after SENP1 silencing detected by Western blot. E and G show the expression of ferroptosis-related protein GPX4 after SENP1 silencing detected by Western blot. Statistical analysis results are: *P<0.05, **P<0.01, ***P<0.001, NSP>0.05. Detailed Implementation

[0029] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments, but this should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments are commercially available unless otherwise specified.

[0030] All data in the following examples were analyzed using GraphPad Prism 7.0 (PraphPad, San Diego, CA, USA) software. All statistical tests were two-tailed, and a p-value < 0.05 was considered statistically significant.

[0031] Example 1

[0032] 1. Patients and organizations

[0033] This invention yielded 15 pairs of tumor tissue (T) and adjacent non-tumor tissue (N) samples, all from untreated patients with head and neck squamous cell carcinoma, Department of Stomatology, Affiliated Hospital of Xuzhou Medical University (Xuzhou, China). These samples were independently identified by two pathologists. Detailed clinicopathological features were collected. All tissue samples were collected between July 2022 and June 2023. Body materials were obtained with patient consent and approved by the Ethics Committee of Affiliated Hospital of Xuzhou Medical University.

[0034] 2. Cell lines and cell culture

[0035] CAL27 cells were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences and cultured in DMEM / F12 (1:1) medium. Cells were then incubated with 10% heat-inactivated fetal bovine serum (FBS), penicillin, and streptomycin at 37°C in a 5% CO2 incubator. DMEM / F12 (1:1) medium, 10% heat-inactivated fetal bovine serum (FBS): Gibco-BRL. Penicillin: 100 units / mL. Streptomycin: 100 μg / mL.

[0036] 3. RNA extraction and qRT-PCR

[0037] Use according to the reagent manufacturer's instructions. This reagent (Invitrogen) isolates total RNA from CAL27 cells and tissues. Complementary DNA (cDNA) is indicated by a superscript label. Complementary DNA (cDNA) was synthesized from total RNA using Invitrogen. The relative gene expression level of SENP1 was detected using small nuclear RNA U48 as an internal control, and all experiments were repeated in triplicate. All qRT-PCRs were performed using an ABI StepOne real-time PCR system (Life Technologies, Inc.) and a TB Green premixed Ex Taq reagent kit (Ta KaRa). PCR primers were designed and synthesized by Shenggong Biotechnology Co., Ltd. (Shanghai). The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1: CTGGGGAGGTGACCTTAGTGA; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2: Reverse: GTGATATCTGGACGATAGGCT G.

[0038] 4. Obtain public data on cancer genome mapping

[0039] RNA-seq transcriptome data from head and neck squamous cell carcinoma (HNSCC) samples, along with accompanying clinical information, and RNA-seq transcriptome data from normal control samples were obtained from The Cancer Genome Atlas (TCGA) (https: / / gdc.cancer.gov / ). RNA-seq data were normalized using the expectation-maximization method. A total of 502 HNSCC patients and 44 normal controls were randomly assigned for analysis. Accurate and efficient gene expression matrices were obtained using Perl from the TCGA transcriptome data; mRNA and lncRNA expression matrices were also obtained using the Perl package "limma" to identify differentially expressed mRNAs. A p < 0.05 selection criterion was used for lncRNAs, with a false discovery rate (FDR) < 0.05 and a fold change (FC) > 1. Volcano plots and heatmaps of ferroptosis-related mRNAs were generated. The relationship between differentially expressed mRNAs and necrosis-related genes was detected using R with a selection criterion of "Corfile > 0.4, p < 0.01".

[0040] 5. Establishment and verification of risk signatures

[0041] Differentially expressed mRNA matrix data were combined with clinical data downloaded from TCGA. A prognostic model was constructed based on differentially expressed mRNAs. 502 patients with head and neck squamous cell carcinoma (HNSCC) were selected and divided into training and experimental groups. The prognostic model was established using the training group and validated in the experimental group. The training group comprised 50% of the total HNSCC group. Univariate Cox proportional hazards regression analysis was used, and survival-related mRNAs were screened based on p < 0.05. A minimum absolute contraction and selection operator (LASSO) regression model was established using the screened mRNAs; 10-fold cross-validation was performed with 1000 cycles to determine the point of minimum cross-validation error. Significantly expressed mRNAs were identified by lasso regression, and a Cox model was established.

[0042] 6. Western blot analysis

[0043] CAL27 cells were collected, and total cellular protein was extracted using RIPA lysis buffer and identified using a BCA assay kit. The extracted total cellular protein samples were treated with 7.5% SDS-PAGE, transferred to a PVDF membrane, and incubated overnight (≥12 h) with SENP1 and β-actin antibodies. After 16 h, the PVDF membrane was incubated with HRP goat anti-mouse and HRP goat anti-rabbit (AB clone) secondary antibodies at room temperature for 1 h. RIPA lysis buffer: Proteintech, PR20001. BCA assay kit: Keygen, Nanjing, China. CAL27 cells: Corning Life Sciences, Inc.

[0044] 7. Cell proliferation, cell migration, and invasion assays

[0045] Cell proliferation was assessed using the CCK-8 assay and colony formation assay. CAL27 cells were seeded in 96-well plates. 10 μL of the culture was added at 0, 24, 48, and 72 h post-seeding, and the cells were incubated for 1 h. Absorbance was measured at 450 nm using the SpectraMax 190 enzyme marker (molecular device). CAL27 cells: Corning Life Sciences, Inc.

[0046] To perform colony formation experiments, stably knocked-down and SENP1-overexpressing CAL27 cells and negative controls were seeded into a row of 6-well plates. After incubation at 37°C in a 5% humidified CO2 incubator for 12 days, CAL27 colonies were stained with crystal violet, counted, and photographed. Each experiment was repeated three times. The negative control consisted of 500 CAL27 cells. Each CAL27 colony contained >50 cells.

[0047] Cell migration and invasion assays were performed in the Boyden laboratory using 8 μm well membranes coated with matrix adhesive (for invasion assays) or without matrix adhesive (for migration assays). CAL27 cells were starved for 24 h. A single-cell suspension diluted with serum-free medium (1 × 10⁵; 200 μL) was added to the upper chamber, and medium containing 15% fetal bovine serum (600 μL) was added to the lower chamber. Cells were fixed in 3.7% formaldehyde for 15 min, washed with PBS, stained with crystal violet for 10 min, and then the upper chamber was wiped to allow migration. Cells were then allowed to remain in the upper chamber for 24 h at 37°C. In three replicates, cell numbers were assessed to quantify migration and invasion. Boyden Laboratory: Corning, Corning, NY.

[0048] 8. Lipid peroxidation test

[0049] The relative levels of malondialdehyde (MDA) in CAL27 cells were determined using a lipid peroxidation kit. Prepared MDA standard dilutions and test samples (cell lysates) at optimal dilution were used. 600 μL of LTA (thiobarbituric acid) solution was added, followed by 200 μL of standard solution. 200 μL of test sample was incubated at 95°C for 60 min. The test samples were then cooled to room temperature in an ice bath for 10 min. 200% of each mixture was then added to a 96-well microplate, and colorimetric determination was performed immediately at an OD value of 532 nm. Finally, the concentration of malondialdehyde (MDA) was calculated based on the standard curve. Lipid peroxidation kit: Beyotime, S0131S.

[0050] 9. Iron Determination Method

[0051] The relative levels of intracellular iron in CAL27 cells were evaluated using an iron assay kit. Iron probes, iron reducing agent, iron standard diluent (5 mol / well), and test samples (cell lysis buffer) prepared in the iron assay kit were used. Then, 5 μL of iron reducing agent was added to each standard well and incubated at 37°C for 30 min. 100 μL of iron probe was added to each well and incubated at 37°C in the dark for 60 min. The samples were then immediately measured using a colorimetric plate with enzyme-labeled enzyme (OD value 593 nm). The total iron content of the test samples was obtained from a standard curve. Iron assay kit: Abcam, ab83366.

[0052] 10. Glutathione assay

[0053] The relative levels of glutathione (GSH) in CAL27 cells were determined using a GSH colorimetric assay kit. GSH colorimetric assay kit: CS0260, Sigma-Aldrich, St. Louis, USA.

[0054] The test samples were prepared according to the kit instructions, using 5% SSA (5-thiosalicylic acid) solution, glutathione standard solution, working mixture, NADPH solution, and CAL27 cell extract. A 5% SSA solution was used as a reagent blank. 10 μL of glutathione standard solution was added to each well, and 10 μL of the test sample was added to each well. 150 μL of working mixture was added to each well, and the mixture was incubated at room temperature for 5 min. Finally, 50 μL of NADPH solution was added to each well. The absorbance of each well was measured at an OD value of 412 nm. The GSH concentration was calculated based on the standard curve.

[0055] 11. Lentiviral transfection

[0056] GeneChem (China) has developed a shRNA lentivirus resistant to SENP1, namely shSENP1. The lentiviral vector constructed using Te was transfected into cells according to the lentiviral kit transfection instructions, followed by puromycin intervention. To identify stably transfected cells, Western blot analysis was used to determine the transfection efficiency.

[0057] 12. Immunoprecipitation (IP)

[0058] Harvest CAL27 cells, add an appropriate amount of cell lysis buffer (containing protease inhibitor), lyse on ice or at 4°C for 30 min, centrifuge at 12,000g for 30 min, and collect the supernatant; take a small amount of lysis buffer for Western blot analysis, add 1 μg SENP1 antibody and 20 μL ACSL4 (long-chain acyl-CoA synthase 4) antibody to the remaining lysis buffer, and incubate overnight at 4°C with gentle shaking; after immunoprecipitation, centrifuge at 3,000g for 5 min at 4°C to the bottom of the tube; carefully aspirate the supernatant, and wash the protein A / G-beads three times with 1 ml lysis buffer; finally, add 15 μL of 2×SDS loading buffer and boil for 10 min; perform SDS-PAGE and Western blotting for detection.

[0059] 13. Statistical Analysis

[0060] All data were analyzed using GraphPad Prism 7.0 (PraphPad, San Diego, CA, USA) software. All statistical tests were two-tailed, and a p-value < 0.05 was considered statistically significant.

[0061] result:

[0062] 1. Expression of ferroptosis-related mRNAs

[0063] Co-expression analysis of 65 ferroptosis genes and differentially expressed mRNAs identified 457 mRNAs associated with ferroptosis genes. All mRNAs and ferroptosis genes were positively regulated. Volcano plots and heatmaps were used to detect their expression in the normal and tumor groups; results are shown below. Figure 1 A and Figure 1 C. Finally, the relationship between mRNA and ferroptosis-related genes was visualized using a network diagram, and the results are shown in [Figure number missing]. Figure 1 B.

[0064] Results: A graph showing the relationship between ferroptosis genes and their associated mRNAs in head and neck squamous cell carcinoma was constructed.

[0065] 2. Construction of mRNA prognostic model

[0066] Univariate Cox proportional hazards regression analysis identified 32 mRNAs associated with ferroptosis and generated a heatmap, see [link to heatmap]. Figure 2 A and Figure 2 B. Significant mRNA data obtained from univariate Cox analysis were combined with clinical data to construct a lasso regression curve, see [reference needed]. Figure 2 C. Perform cross-validation and determine the point with the smallest cross-validation error. Finally, 13 mRNAs associated with ferroptosis were selected, see [link to relevant documentation]. Figure 2 D. After optimizing the Cox model, this invention identified seven mRNAs: SENP1, PBX4, SOCS1, DNAJB11, ART5, TCEAL5, and GRIA4. This invention selected SENP1, the mRNA most strongly associated with ferroptosis, to begin further validation.

[0067] 3. Survival Analysis and Risk Curve Construction

[0068] Based on risk scores, Kaplan-Meier survival curves were constructed for the overall survival (OS) probability of individuals with necrosis-related genes in the training group, experimental group, and all groups (inclusive). In all groups, the survival rate of high-risk patients was significantly lower than that of low-risk patients (see...). Figure 3 D. Similar results were obtained for age, sex, stage, type, and TNM stage, as shown in Figure S1. In training, testing, or all groups, the risk score of the high-risk group was significantly higher than that of the low-risk group, while the survival time was significantly shorter in the high-risk group.

[0069] This invention used heatmap analysis to examine the differences in the expression levels of seven necrosis-related mRNAs in prognostic models between high-risk and low-risk groups. (See attached image.) Figure 3 AC. Results: A novel prognostic model for ferroptosis consisting of 7 genes was constructed.

[0070] 4. Construction of nomograms and independent prognostic analysis

[0071] This invention uses univariate Cox analysis to identify effective independent prognostic factors (screening criteria, p < 0.05). The hazard ratio (HR) for the risk score is 1.732, and the 95% confidence interval (CI) is 1.476–2.032. This invention identifies two additional prognostic parameters: stage and N, see [link to relevant documentation]. Figure 4 A.

[0072] Multivariate Cox analysis showed that the hazard ratio (HR) for the risk score was 1.623, with a 95% CI of 1.373–1.918. Age, stage, and N can be used as additional prognostic parameters; see [link to relevant documentation]. Figure 4 B. This invention constructs a nomogram based on identified clinical risk factors, namely age, sex, stage, grade, and TNM stage, and obtains a comprehensive score to assess the 5-year, 3-year, and 1-year survival rates of patients with head and neck squamous cell carcinoma (HNSCC). (See attached diagram.) Figure 4 C.

[0073] This invention also plotted calibration curves for 5-year, 3-year, and 1-year survival rates to improve the reliability of the nomogram, see [link to nomogram]. Figure 4D. The area under the curve (AUC) was used to validate the model's accuracy in predicting patient survival. The predicted values ​​for 5-year, 3-year, and 1-year survival rates were 0.672, 0.716, and 0.666, respectively. Figure 4 As shown in E, these regions all have values ​​>0.65, validating the accuracy of the prognostic model in predicting 5-year, 3-year, and 1-year survival rates. Similarly, the AUC of the model proposed in this invention is also greater than other clinical features, indicating that the accuracy of the proposed model is higher than other clinical features, such as... Figure 4 As shown in F.

[0074] Therefore, the seven ferroptosis-related mRNA models constructed in this invention are undoubtedly closely related to the pathogenesis of head and neck squamous cell carcinoma (HNSCC). This invention selected SENP1, the mRNA most strongly associated with ferroptosis, to begin further validation.

[0075] 5. SENP1 is overexpressed in head and neck squamous cell carcinoma (HNSCC).

[0076] This invention first analyzed the KM survival curves of SENP1 in head and neck squamous cell carcinoma (HNSCC). It is evident that patients with high SENP1 expression had poorer survival rates, as shown in Figure S2. Then, this invention detected SENP1 expression in CAL-27 cell line and normal human oral mucosa using qRT-PCR and Western blot. Both results showed that SENP1 expression was high in the CAL-27 cell line, such as... Figure 5 As shown in AD. Meanwhile, qRT-PCR and western blot analysis revealed that SENP1 and SENP1 expression in head and neck squamous cell carcinoma (HNSCC) tissues were significantly higher than in adjacent tissues, such as... Figure 5 As shown in EG.

[0077] In summary, the above results indicate that SENP1 is overexpressed in head and neck squamous cell carcinoma (HNSCC).

[0078] 6. SENP1 promotes the proliferation, migration, and invasion of head and neck squamous cell carcinoma (HNSCC) cells.

[0079] This invention first established stable knockout or overexpression cell lines using shrna or SENP1-overexpressing lentiviruses, and then investigated the biological role of SENP1 in head and neck squamous cell carcinoma (HNSCC). (See attached text.) Figure 6 A. This invention used RIPA lysis buffer to obtain total RNA from head and neck squamous cell carcinoma (HNSCC) cells, and further analyzed the expression of SENP1 at the transcriptional level in head and neck squamous cell carcinoma (HNSCC) cells using qRT-PCR, see [link to PCR analysis]. Figure 6C. This invention also used protein lysates to obtain protein lysates from the control group and the SENP1 knockout or overexpression group, and used Western blot experiments to analyze the expression of SENP1 in different groups, see [link to article]. Figure 6 DE validated the SENP1 knockout efficiency at both the protein and transcriptional levels.

[0080] This invention also used the Cell Counting Kit-8 (CCK8) to detect the effect of SENP1 on cell proliferation. The CCK8 results showed that overexpression of SENP1 increased the proliferation of CAL27 cells. Figure 6 B; Conversely, knocking out SENP1 significantly reduced the viability of CAL27 cells.

[0081] The above results indicate that SENP1 is an important regulator of the proliferation of head and neck squamous cell carcinoma (HNSCC) cells.

[0082] To evaluate the migration and invasion abilities of SENP1 in head and neck squamous cell carcinoma (HNSCC) cells, we analyzed the effects of SENP1 on HNSCC cell migration and invasion using cross-well and wound healing assays. Transell results showed that overexpression of SENP1 significantly improved cell migration and invasion, while knockout of SENP1 decreased these abilities. Figure 6 As shown in FG. Wound healing assays showed that SENP1 positively regulates the wound healing rate of CAL27 cells, such as... Figure 6 As shown in Figure HI, these results indicate that ALKBH5 plays an important role in the development and progression of head and neck squamous cell carcinoma (HNSCC).

[0083] 7. SENP1 is an important regulator of the ferroptosis pathway in head and neck squamous cell carcinoma (HNSCC).

[0084] Erastin is a common ferroptosis inducer. This invention investigated the SENP1 level in head and neck squamous cell carcinoma (HNSCC) cells when ferroptosis was activated by Erastin. The specific results are as follows:

[0085] First, qRT-PCR and Western blot experiments revealed that SENP1 expression was significantly reduced in Erstin-treated cells compared to DMSO-treated cells. Figure 7 As shown in AC.

[0086] Then, to further determine whether cell growth was induced by ferroptosis, we examined the levels of ferroptosis-related markers (cellular iron, glutathione, and malondialdehyde) in head and neck squamous cell carcinoma (HNSCC) cells under ferroptosis-activated conditions using Erastin (10 pM, 24 h).

[0087] The study found that the activity and glutathione levels of head and neck squamous cell carcinoma (HNSCC) cells were reduced to low levels, such as Figure 7 D, Figure 7 As shown in F, iron content and malondialdehyde levels increased significantly, such as Figure 7 E, Figure 7 As shown in G. Simultaneously, this invention also investigates the effect of SENP1 on ferroptosis, such as... Figure 8 As shown in AC. The results showed that, compared with the NC group, knocking out SENP1 significantly increased the final products of cellular iron and lipid peroxidation malondialdehyde, while significantly decreasing endogenous glutathione, such as... Figure 8 D, Figure 8 As shown in E. Overexpression of SENP1 resulted in a decrease in corresponding levels of ferroptosis, as... Figure 8 As shown in F. The above results indicate that SENP1 can act as an important regulator of ferroptosis.

[0088] 8. Silencing SENP1 promotes ferroptosis by reducing its sumo-oxidation of ACSL4, thereby enhancing its stability.

[0089] ACSL4 is a key enzyme in the lipid peroxidation process of iron poisoning, and its high expression promotes the occurrence of iron poisoning. The above-mentioned results of this invention indicate that SENP1 can also regulate ferroptosis. However, the relationship between SENP1 and ACSL4 is not fully elucidated. This study suspects a sumo-like association between head and neck squamous cell carcinoma (HNSCC) cells transfected with SENP1 lentivirus and ACSL4. Therefore, this invention performed a COIP experiment on SENP1 and ACSL4 in CAL27 cells.

[0090] The research results indicate that there is a significant direct correlation between the two, such as Figure 9 As shown in Figure A. Furthermore, TCGA and Western blot analyses showed a negative correlation between SENP1 and ACSL4, as... Figure 9 As shown in BC.

[0091] To further verify this hypothesis, this invention performed IP experiments on SUMO1 in ACSL4 in both the control and gene knockout groups. The results showed that SUMO1 levels in ACSL4 decreased in the gene knockout group, such as... Figure 9 As shown in D.

[0092] Building upon the aforementioned research, this invention further investigated the effect of SENP1 knockdown on the ferroptosis pathway. Western blotting was used to analyze the levels of the key ferroptosis proteins GPX4 (glutathione peroxidase 4) and SLC7A11 in samples from each group after SENP1 gene knockout. The study found that GPX4 levels increased, while SLC7A11 levels remained unchanged. Figure 9 As shown in EG.

[0093] In summary, there is a direct correlation between SENP1 and ACSL4. Knocking out SENP1 may promote SUMO1 in ACSL4, improve ACSL4 stability, further deplete GPX4 levels, and promote ferroptosis.

[0094] This invention is the first to utilize the TCGA database to explore FRGs associated with ferroptosis in head and neck squamous cell carcinoma (HNSCC). Using lasso regression combined with clinical prognostic data, a 7-mRNA model incorporating seven differentially expressed ferroptosis genes was established, which was validated as prognostic biomarkers for HNSCC. The accuracy of the model was verified based on the AUC values ​​of the ROC curves of the training and testing groups. The results showed that the 7-mRNA model was closely associated with patient survival. Simultaneously, this invention validated and established a key FRGSENP1 using the GSE132474 dataset, which significantly increased with the progression of HNSCC. Furthermore, this invention used qRT-PCR and Western blot analysis to detect the expression of SENP1 in the CAL27 cell line and HNSCC tissues. The study found that SENP1 is overexpressed in HNSCC.

[0095] This study also explored the relationship between protein biomarkers and ferroptosis, and elucidated a possible mechanism of cancer development in head and neck squamous cell carcinoma (HNSCC). Small ubiquitin-like modifier (SUMO)-specific peptidase 1 (SENP1) regulates cellular activity by removing SUMO protein coupling from substrate proteins. SENP1 is regulated in tumors by targeting several SUMO1-modified proteins, cell proliferation, migration, and inducing macrophage inflammation. The results showed that SENP1 promotes cell migration, invasion, and proliferation by regulating e-cadherin DNA methylation in osteosarcoma. Similarly, SENP1 is highly expressed in melanoma, liver cancer, gastric cancer, and pancreatic cancer.

[0096] Unfortunately, to date, no studies have investigated the expression and function of SENP1 in head and neck squamous cell carcinoma (HNSCC). This invention reveals that SENP1 may be an important oncogene in HNSCC. The relative expression level of SENP1 was significantly upregulated. High SENP1 expression was positively correlated with poor survival outcomes. SENP1 effectively promoted the proliferation, invasion, and migration of HNSCC cells.

[0097] This invention also found that the ferroptosis inducer Erastin can significantly induce SENP1 in head and neck squamous cell carcinoma (HNSCC) cells. Cells expressing high levels of SENP1 can inhibit ACSL4 expression, thereby enhancing the GSH elimination of oxidized phospholipids, while simultaneously inhibiting ferroptosis, reducing the final iron products iron and malondialdehyde (MDA), and increasing glutathione expression, thus suppressing the ferroptosis process. However, this study only discussed the effect of SENP1 on head and neck squamous cell carcinoma (HNSCC) cells; its effects on other cancer cells remain unclear and require further investigation.

[0098] SENP1 plays a crucial role in tumor progression through multiple mechanisms. SENP1 can reduce PTEN protein stability by regulating PTEN sumoylation and ubiquitination. Other studies have shown that SENP-1 overexpression regulates glycolysis in prostate cancer cells by stabilizing HIF-α. Furthermore, SENP1 has been found to be an important deSUMO enzyme that actively regulates the stability and activity of c-Myc in breast cancer. SENP1 has also been found to regulate ferroptosis in lung cancer cells by modulating A20 stability through deSUMO modification. This invention reveals that SENP1 plays a significant role in head and neck squamous cell carcinoma (HNSCC) through deSUMO modification of ACSL4. SENP1-mediated ASCL4 phosphorylation affects ACSL4 activity, thereby promoting GPX4 expression and inhibiting ferroptosis in HNSCC.

[0099] In summary, the findings of this invention demonstrate that SENP1 is a newly discovered oncogene in head and neck squamous cell carcinoma (HNSCC) and plays a crucial role in the progression of HNSCC and ferroptosis. SENP1 significantly disrupts the stability of the ACSL4 protein through deSUMO and indirectly inhibits its influence on downstream phospholipid metabolism pathways of ferroptosis. It is also an important biomarker affecting patient prognosis.

[0100] Based on this, the present invention provides the application of the biomarkers of head and neck squamous cell carcinoma in the preparation of a kit for ferroptosis of HNSCC via the SENP1 pathway, the kit comprising the biomarkers of head and neck squamous cell carcinoma: SENP1, ACSL4 and GPX4.

[0101] The kit was prepared as follows: SENP1 expression in CAL-27 cell line and normal human oral mucosa was detected by qRT-PCR (real-time quantitative PCR) and Western blot (immunoblotting). Simultaneously, SENP1 expression in HNSCC tissue was analyzed by qRT-PCR and Western blot, indicating SENP1 overexpression in HNSCC. Stable knockout or overexpressing cell lines were established using shrna or SENP1-overexpressing lentivirus, and their invasion and migration were investigated. CCK8 and Transwell assays showed that SENP1 plays an important role. Furthermore, qRT-PCR and Western blot experiments revealed that SENP1 expression was significantly reduced in erstin-treated cells compared to DMSO-treated cells. Subsequently, to further determine whether cell growth was caused by ferroptosis, the levels of ferroptosis-related markers (cellular iron, glutathione, and malondialdehyde) in HNSCC cells were measured under ferroptosis-activated conditions using erastin (10 pM, 24 h). In HNSCC cells, cell viability and glutathione levels were reduced to low levels, while the final products of lipid peroxidation, iron content, and malondialdehyde levels were significantly increased. Simultaneously, we verified the overexpression and knockout efficiency of SENP1 at both the protein and transcript levels. Furthermore, TCGA and Western blot analyses showed a negative correlation between SENP1 and ACSL4. IP experiments were performed on ACSL4 SUMO1 in both the control and knockout groups. Results showed that SUMO1 levels in ACSL4 decreased in the knockout group. Finally, the effect of SENP1 knockdown on the ferroptosis pathway was analyzed. We used Western blotting to analyze the levels of the key ferroptosis proteins GPX4 and SLC7A11. GPX4 levels increased, while SLC7A11 levels remained unchanged. In conclusion, there is a direct correlation between SENP1 and ACSL4. Knockout of SENP1 may promote SUMO1 in ACSL4, enhance ACSL4 stability, further deplete GPX4 levels, and promote ferroptosis.

[0102] To illustrate the effectiveness of this kit, we conducted the following study:

[0103] (1) CCK8 detection

[0104] Cell proliferation was assessed using the CCK-8 assay. CAL27 cells were seeded in 96-well culture plates. 10 μL of CCK-8 reagent was added, and the cells were incubated for 1 h. Absorbance was measured at 450 nm using a SpectraMax 190 enzyme marker (molecular device). CAL27 cells were sourced from Corning Life Sciences, Inc.

[0105] (2) Scratch test

[0106] Up to 5×10 5 One CAL27 cell line (per well) was seeded into six wells of culture medium. After 48 hours of culture, when cell confluence reached approximately 90%, the cells were scraped off using a 200 μL sterile pipette for nine weeks. The medium was then washed three times with PBS and cultured in fresh DMEM containing 2% fetal bovine serum. Imaging was performed at two time points, 0 hours and 24 hours. Pipette distance was quantitatively evaluated using ImageProPlus 6.0.

[0107] (3) Lipid peroxidation test

[0108] The relative levels of malondialdehyde (MDA) were determined using a lipid peroxidation kit. Prepared MDA standard dilutions and test samples (cell lysates) at the optimal dilution were used. 600 μL of LTA (thiobarbituric acid) solution was added, followed by 200 μL of standard solution. 200 μL of test sample was incubated at 95 °C for 60 min. The samples were then cooled to room temperature in an ice bath for 10 min. 200% of each mixed solution volume was then added to 96-well microplates, and colorimetric determination was performed immediately at an OD value of 532 nm. Finally, the MDA concentration was calculated based on the standard curve.

[0109] (4) Analysis of Invasion Experiments

[0110] For cell migration analysis, LSCC cells were starved for 24 hours. 200 μL of serum-free medium diluted to a concentration of 1 × 10⁻⁶ was added to the upper chamber. 5 A single-cell suspension of 1 / mL was added to the lower chamber with 600 μL of culture medium containing 15% fetal bovine serum. The cells were fixed in 3.7% formaldehyde for 15 minutes, washed with PBS, stained with crystal violet for 10 minutes, and then the migrating cells were wiped off in the upper chamber and allowed to stand for 24 hours at 37°C. In three replicate experiments, the number of cells was assessed to quantify their invasion or migration.

[0111] (5) Iron determination method

[0112] The relative levels of intracellular iron were evaluated using an iron assay kit. Prepared iron probes, iron reducing agent, iron standard diluent (8 nmol / well), and test samples (cell lysis buffer) were used. Then, 5 μL of iron reducing agent was added to each standard well and incubated at 37°C for 30 min. 100 μL of iron probe was added to each well and incubated at 37°C in the dark for 60 min. The samples were then immediately measured using a colorimetric plate with enzyme-labeled iron (OD value of 593 nm). The total iron content of the test samples was obtained from a standard curve.

[0113] (6) Glutathione assay

[0114] The relative levels of GSH were determined using a GSH colorimetric assay kit. This experiment used 5% SSA (5-thiosalicylic acid) solution, glutathione standard solution, working mixture, NADPH (nicotinamide adenine dinucleotide phosphate) solution, and test samples (cell extracts). 5% SSA was used as a reagent blank. 10 μL of glutathione standard solution was added to each well, and 10 μL of test sample was added to each well. 150 μL of working mixture was added to each well, and the mixture was incubated at room temperature for 5 min. Finally, 50 μL of NADPH solution was added to each well. The absorbance of each well was measured at an OD value of 412 nm. The GSH concentration was calculated based on a standard curve. The GSH colorimetric assay kit used was CS0260, Sigma-Aldrich, St. Louis, USA.

[0115] (7) Lentiviral transfection

[0116] GeneChem (China) has developed a SENP1-resistant shRNA lentivirus, shSENP1. The constructed lentiviral vector was transfected into cells, followed by puromycin intervention. To identify stably transfected cells, Western blot analysis was used to determine transfection efficiency.

[0117] (8) Immunoprecipitation (IP)

[0118] Protein stock solution, combined with anti-SENP1 or ACSL4 antibody, was incubated overnight with magnetic beads. The beads were washed three times at 4°C. The sample was then boiled in sodium dodecyl sulfate (SDS) for 5 min using a pyrolysis method, and the protein was separated from the SDS gel at 8-12% sdspage. Immunoblot detection was performed using an appropriate antibody.

[0119] The above results indicate that the kit prepared in this invention can be used for the diagnosis of ferroptosis in head and neck squamous cell carcinoma via the SENP1 pathway.

[0120] This invention provides a biomarker for head and neck squamous cell carcinoma (HNSCC). The invention establishes a prognostic model for HNSCC by detecting the expression of frg, which is associated with prognosis. Further research revealed SENP1 as an important biomarker and validated that it can inhibit the ferroptosis pathway in HNSCC by regulating ACSL4 expression through deSUMOylation, thereby promoting the proliferation and invasion of HNSCC cancer cells. This invention provides a novel ferroptosis pathway in HNSCC, leading to the discovery of functional molecules involved in the initiation and development of HNSCC. Using the biomarker provided by this invention for the treatment of HNSCC does not induce drug resistance, offers multiple treatment options, and does not result in poor prognosis.

[0121] It should be noted that when numerical ranges are mentioned in the claims of this invention, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, the present invention describes preferred embodiments.

[0122] Although preferred embodiments of the invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including both the preferred embodiments and all changes and modifications falling within the scope of the invention.

[0123] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A biomarker for head and neck squamous cell carcinoma, characterized in that, The biomarker is SUMO-specific peptidase 1.

2. Primers for amplifying the markers of head and neck squamous cell carcinoma as described in claim 1, characterized in that, The primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

2.

3. The use of the reagent for detecting the marker of head and neck squamous cell carcinoma as described in claim 1 in the preparation of a kit for diagnosing head and neck squamous cell carcinoma.

4. The application according to claim 3, characterized in that, The kit includes the SUMO-specific peptidase 1 as described in claim 1.

5. The application according to claim 4, characterized in that, The kit also includes an upstream primer and a downstream primer, the nucleotide sequence of which is shown in SEQ ID NO.1; the nucleotide sequence of which is shown in SEQ ID NO.

2.

6. The application according to claim 3, characterized in that, The kit also includes long-chain acyl-CoA synthase 4, glutathione peroxidase 4, and CCK-8 reagent.

7. The application according to claim 6, characterized in that, The kit also includes 2% fetal bovine serum, DMEM, thiobarbituric acid solution, PBS, iron standard diluent, iron reducing agent, iron probe, thiosalicylic acid solution, nicotinamide adenine dinucleotide phosphate solution, and sodium dodecyl sulfate.

8. The application according to claim 7, characterized in that, The expression of SUMO-specific peptidase 1 was detected by real-time quantitative PCR and Western blotting.

9. The application according to claim 3, characterized in that, The biomarker inhibits the ferroptosis pathway in head and neck squamous cell carcinoma by regulating ACSL4 expression through desumolation.

10. The application according to claim 3, characterized in that, The biomarkers are used to promote the proliferation and invasion of head and neck squamous cell carcinoma tumor cells.

Images