Application of hnrnpa2b1 in prognosis evaluation and targeted therapy of esophageal squamous cell carcinoma

Abstract

This invention discloses the application of HNRNPA2B1 in prognostic assessment and targeted therapy of esophageal squamous cell carcinoma. It reveals that HNRNPA2B1 is significantly highly expressed in esophageal squamous cell carcinoma tissues and is associated with poor patient prognosis. Functional experiments and transcriptome sequencing confirm that HNRNPA2B1 significantly inhibits apoptosis in esophageal squamous cell carcinoma cells by synergistically regulating the expression levels of apoptosis-related genes and alternative splicing events. Based on this, this invention provides the use of HNRNPA2B1 as a molecular marker in the prognostic assessment of esophageal squamous cell carcinoma, and its application as a target in screening anti-esophageal squamous cell carcinoma drugs. This invention provides a new and effective target for the precision diagnosis and treatment of esophageal squamous cell carcinoma and has significant clinical application value.

Description

Technical Field

[0001] This invention relates to the fields of biomedicine and molecular pathology diagnostics, specifically to the use of heterogeneous nucleoribonucleoprotein A2B1 (HNRNPA2B1) as a molecular marker in the prognostic assessment of esophageal squamous cell carcinoma, and its application as a target in screening anti-esophageal squamous cell carcinoma drugs. Background Technology

[0002] Esophageal squamous cell carcinoma (ESCC) is the most prevalent histological subtype of esophageal cancer, accounting for 85% of all esophageal cancer cases. Despite advancements in clinical treatment through the widespread use of novel therapies such as endoscopic treatment, surgical resection, neoadjuvant chemoradiotherapy combined with surgery, immunotherapy, and targeted therapy, the overall survival rate for ESCC patients remains unsatisfactory, with a local recurrence rate as high as 50% and a 5-year survival rate of less than 26%. Therefore, further elucidating the molecular mechanisms of ESCC development and progression is crucial for identifying new therapeutic targets and prognostic biomarkers.

[0003] Heterogeneous nucleoribonucleoprotein A2B1 (HNRNPA2B1) is an RNA-binding protein belonging to the hnRNP family, widely expressed in various tissues of the body. This protein recognizes and binds to specific RNA substrates and DNA motifs, participating in the regulation of mRNA transcription, splicing, transport, stability maintenance, and translation. Notably, HNRNPA2B1 has been identified as an m6A recognition protein involved in regulating primary microRNA processing and alternative splicing events.

[0004] Existing research evidence suggests that HNRNPA2B1 is closely related to tumorigenesis and development: this protein can mediate chemotherapy resistance in gastric and endometrial cancers, cetuximab resistance in colorectal cancers, and endocrine therapy resistance in breast cancers; simultaneously, it can promote tumorigenesis and metastasis in non-small cell lung cancer and serve as an independent prognostic factor for glioma patients. In the field of esophageal cancer, Zhang et al. (2015) found that HNRNPA2B1 was highly expressed in esophageal squamous cell carcinoma tissues and associated with lymph node metastasis using immunohistochemistry; Feng et al. (2023) confirmed that this protein can promote esophageal squamous cell carcinoma metastasis through the AGAP1 pathway. However, all existing techniques have only found that HNRNPA2B1 regulates the proliferation, migration, and invasion of esophageal squamous cell carcinoma, without revealing its regulatory role in apoptosis, let alone discovering the molecular network through which it synergistically regulates apoptosis via both transcription and splicing mechanisms.

[0005] Although existing studies have confirmed that HNRNPA2B1 participates in the progression of esophageal squamous cell carcinoma (ESCC) through multidimensional mechanisms, its global RNA regulatory network, particularly its regulatory mechanism on apoptosis and its correlation with clinical prognosis, has not yet been systematically elucidated. Chinese patent CN110393791B discloses the application of HNRNPA2B1 in anti-infection, but makes no mention of the oncology field. Therefore, thoroughly elucidating the molecular regulatory mechanism of HNRNPA2B1 in ESCC and applying it to clinical diagnosis and treatment is a pressing technical problem to be solved in this field. Summary of the Invention

[0006] This invention, based on analysis of the Cancer Genome Atlas (TCGA) database and in vitro cell experiments, confirms that HNRNPA2B1 is significantly overexpressed in esophageal squamous cell carcinoma tissues, and that its high expression is closely related to poor patient prognosis. By knocking down HNRNPA2B1 in KYSE150 cells, combined with RNA-seq transcriptome sequencing and flow cytometry, it was revealed that HNRNPA2B1 effectively inhibits apoptosis in esophageal squamous cell carcinoma cells and promotes tumor progression by systematically regulating the expression levels of a series of apoptosis-related genes (such as H1-2, KLF10, CXADR, ISG15, ERP29, ALDH1A3, CLDN4, and FGFBP1) and simultaneously regulating alternative splicing events of apoptosis-related genes (such as RPS24, IRF3, MFF, long non-coding RNA SNHG17, KIF23, IKBIP, and BAG6).

[0007] Based on the above findings, this invention provides the application of HNRNPA2B1 as a diagnostic marker, prognostic marker, and therapeutic target for esophageal squamous cell carcinoma.

[0008] This invention provides the application of a reagent for detecting HNRNPA2B1 expression level in the preparation of a diagnostic kit for prognostic assessment of esophageal squamous cell carcinoma. The reagent for detecting HNRNPA2B1 expression level includes: primers or probes that specifically amplify the HNRNPA2B1 gene; or antibodies that specifically bind to the HNRNPA2B1 protein.

[0009] Furthermore, the reagents also include reagents for detecting the expression levels of KLF10 and / or ERP29, and the combined detection of the expression levels of HNRNPA2B1, KLF10 and ERP29 can improve the accuracy of prognostic assessment of esophageal squamous cell carcinoma.

[0010] This invention also provides a method for screening candidate drugs for treating esophageal squamous cell carcinoma, specifically comprising the following steps: Step 1: Contact esophageal squamous cell carcinoma cells expressing HNRNPA2B1 with the test substance at a concentration of 0.1-100 μM for 24-72 hours; Step 2: Detect the expression level or activity of HNRNPA2B1 in the cells; Step 3: Select the test substance that can reduce the expression level or activity of HNRNPA2B1 as the initial screening positive substance; Step 4: Further examine the cells treated with the initial screening positive substance, selecting one or more indicators from the following: (1) Expression levels of apoptosis-related genes regulated by HNRNPA2B1, wherein the apoptosis-related genes are selected from H1-2, KLF10, CXADR, ISG15, ALDH1A3, CLDN4, ERP29 or FGFBP1; (2) Alternative splicing events of apoptosis-related genes regulated by HNRNPA2B1, wherein the alternative splicing events involve genes selected from RPS24, IRF3, MFF, SNHG17, KIF23, IKBIP or BAG6; Step 5: Select positive candidates for the treatment of esophageal squamous cell carcinoma by upregulating the expression levels of genes selected from H1-2, KLF10 or CXADR in (1); and / or downregulating the expression levels of genes selected from ISG15, ALDH1A3, CLDN4, ERP29 or FGFBP1 in (1); and / or altering alternative splicing events of apoptosis-related genes regulated by HNRNPA2B1 in (2).

[0011] Furthermore, the esophageal squamous cell carcinoma cells are KYSE150 cells.

[0012] The present invention also provides the use of HNRNPA2B1 inhibitors in the preparation of medicaments for the treatment or prevention of esophageal squamous cell carcinoma.

[0013] Furthermore, the inhibitor is selected from siRNA, short hairpin RNA (shRNA), antisense oligonucleotide, or small molecule compounds, antibodies, or antagonists that specifically bind to and block the function of HNRNPA2B1 protein, and the inhibitor can specifically reduce the expression level of the HNRNPA2B1 gene.

[0014] Furthermore, the drug also includes a pharmaceutically acceptable carrier, and its dosage form is an injection, an oral formulation, or an inhaler.

[0015] Furthermore, the target sequence of the shRNA is shown in SEQ ID NO:1, namely 5'-GCTGCAAGACCTCATTCAATT-3'.

[0016] The present invention also provides a kit for prognostic assessment of esophageal squamous cell carcinoma, the kit comprising an effective amount of reagent capable of detecting the expression level of HNRNPA2B1 in biological samples, and instructions for use.

[0017] Furthermore, the reagent is a real-time quantitative PCR reagent or an immunohistochemical detection reagent.

[0018] Furthermore, the biological sample is a tissue sample or blood sample from a patient with esophageal squamous cell carcinoma; the tissue sample is paraffin-embedded tissue or fresh frozen tissue.

[0019] Compared with existing technologies, the present invention has the following beneficial effects: 1. For the first time, the RNA regulatory network of HNRNPA2B1 in esophageal squamous cell carcinoma was systematically revealed at the whole transcriptome level, especially its novel mechanism of synergistic regulation of apoptosis-related genes through both transcription and splicing.

[0020] 2. It provides a diagnostic and prognostic assessment scheme for esophageal squamous cell carcinoma based on HNRNPA2B1. The combined detection of HNRNPA2B1, KLF10 and ERP29 can significantly improve the accuracy of prognostic prediction and help with patient stratification management and personalized treatment decisions.

[0021] 3. It was verified that knocking down HNRNPA2B1 can significantly induce apoptosis in esophageal squamous cell carcinoma cells, providing direct theoretical and experimental evidence for the development of anti-esophageal squamous cell carcinoma drugs targeting HNRNPA2B1.

[0022] 4. The conclusions of this invention are based on large-sample analysis of public databases and rigorous cell biology and sequencing experiments. The data are reliable and the conclusions are robust. Attached Figure Description

[0023] Figure 1 The expression characteristics and prognostic significance of HNRNPA2B1 in esophageal squamous cell carcinoma (ESCC); In the figure: A shows the relative expression level of HNRNPA2B1 in ESCC tumor tissue and normal esophageal tissue; B shows the relative expression level of HNRNPA2B1 in ESCC tissues of different differentiation grades (G1, G2, G3); C shows the Kaplan-Meier survival curve analysis of ESCC patients based on HNRNPA2B1 expression level. Figure 2 Verification results for the TCGA database; In the figure: A is a scatter plot showing the correlation between the expression levels of HNRNPA2B1 and ERP29; Figure 2 B represents the Kaplan-Meier survival curves for KLF10 and ERP29; Figure 3Knockdown of HNRNPA2B1 promotes apoptosis in KYSE150 cells; In the figure: A shows the efficiency of HNRNPA2B1 mRNA knockdown verified by RT-qPCR; B shows the efficiency of HNRNPA2B1 protein knockdown verified by Western Blot; C shows the cell apoptosis rate detected by flow cytometry. Figure 4 HNRNPA2B1 regulates the expression of apoptosis-related genes; In the figure: A is the principal component analysis (PCA) plot; B is the volcano plot of differentially expressed genes; C is the heatmap of differentially expressed gene clustering; D is the GO functional enrichment analysis plot of upregulated differentially expressed genes; E is the GO functional enrichment analysis plot of downregulated differentially expressed genes; F is the heatmap of key apoptosis-related differentially expressed genes. Figure 5 A panoramic analysis of variable splicing events regulated by HNRNPA2B1; In the figure: A is a statistical chart of the number of various alternative splicing events; B is a statistical chart of the number of genes corresponding to alternative splicing events; C is a distribution chart of the number of alternative splicing events on genes; D is a comparison chart of the splice ratio (PSI) of upregulated and downregulated differentially spliced ​​events; E is a comparison chart of the splice ratio changes between known splice sites and newly discovered splice sites; F is a distribution chart of transcript types of differentially spliced ​​events. Figure 6 HNRNPA2B1 regulates alternative splicing of apoptosis-related genes; In the figure: A is the GO enrichment analysis diagram of differentially spliced ​​genes; B is the visualization diagram of key apoptosis-related differential splicing events (sashimi plot). Figure 7 This study aimed to analyze the combined effects of differentially spliced ​​genes and differentially expressed genes under the regulation of HNRNPA2B1, and to elucidate the antagonistic regulatory pattern of ARHGDIB. In the figure: A is a Venn diagram of differentially expressed genes and differentially expressed alternative splicing-related genes; B is the effect of knocking down HNRNPA2B1 on the splicing ratio of the ARHGDIB gene at the alternative 5' splice site (A5SS); C is the effect of knocking down HNRNPA2B1 on the overall expression level (FPKM) of the ARHGDIB gene. Detailed Implementation

[0024] The present invention will be further described in detail below with reference to specific embodiments, so that those skilled in the art can fully understand the technical solution of the present invention and implement it. It should be understood that the specific embodiments described herein are only for explaining the present invention and are not intended to limit the scope of protection of the present invention.

[0025] Research background of the above scheme Heterogeneous ribonucleoprotein A2B1 (HNRNPA2B1) belongs to the hnRNP protein family and participates in various RNA regulatory processes, and is closely related to tumorigenesis and development. However, the global RNA regulatory network of this protein in esophageal squamous cell carcinoma (ESCC) remains unclear.

[0026] Research Methods Data on esophageal squamous cell carcinoma were downloaded from the Cancer Genome Atlas (TCGA) database to analyze the expression level and prognostic value of HNRNPA2B1. Flow cytometry was used to detect the effect of this protein on apoptosis. In the KYSE150 esophageal squamous cell carcinoma cell line, HNRNPA2B1 expression was interfered with using short hairpin RNA (shRNA), and RNA sequencing (RNA-seq) experiments were performed. At the same time, differentially expressed genes and alternative splicing events regulated by HNRNPA2B1 were analyzed in depth.

[0027] All experiments were independently repeated three times in the statistical analysis. Data are expressed as mean ± standard deviation (x ± s). Statistical analysis was performed using GraphPad Prism 9 software. Independent samples t-tests were used to compare two groups. P < 0.05 was considered statistically significant, and P < 0.01 was considered extremely statistically significant. The specific research process is detailed in the following examples.

[0028] Research Results and Conclusions HNRNPA2B1 is significantly overexpressed in esophageal squamous cell carcinoma tissues and is associated with poor patient prognosis. Knockdown of HNRNPA2B1 in KYSE150 cells significantly increased apoptosis levels; simultaneously, knockdown significantly altered intracellular gene expression levels and alternative splicing patterns, with a particularly pronounced effect on apoptosis-related genes. HNRNPA2B1 can inhibit the apoptosis process in KYSE150 cells by regulating the expression of apoptosis-related genes and alternative splicing. This provides a theoretical basis for elucidating the molecular mechanism by which HNRNPA2B1 participates in the development of esophageal squamous cell carcinoma and lays the foundation for developing targeted therapies for esophageal squamous cell carcinoma targeting HNRNPA2B1.

[0029] Example 1

[0030] Association analysis of HNRNPA2B1 expression and prognosis in clinical samples 1. Experimental Methods RNA sequencing data at the gene level for esophageal squamous cell carcinoma were downloaded from the Genome Data Sharing (GDC) database, including 96 tumor tissue samples and 3 normal tissue samples. The expression differences of HNRNPA2B1 were analyzed using R language, and its relationship with overall survival was analyzed using Kaplan-Meier survival curves. Furthermore, the correlation between HNRNPA2B1 and ERP29 expression levels, as well as the association between KLF10 and ERP29 expression levels and patient prognosis, were analyzed. All statistical analyses were performed using GraphPadPrism 9 software. Survival analysis was performed using the Log-rank test, and correlation analysis was performed using Pearson correlation analysis. A p-value < 0.05 was considered statistically significant.

[0031] 2. Experimental Results As attached Figure 1 As shown, HNRNPA2B1 was significantly overexpressed in ESCC tissues, and its high expression was observed across different tumor grades. Kaplan-Meier survival analysis revealed that patients in the HNRNPA2B1 high-expression group had shorter overall survival than those in the low-expression group, suggesting that high HNRNPA2B1 expression is associated with poor prognosis.

[0032] Analysis of RNA sequencing data from esophageal squamous cell carcinoma in the TCGA database showed (see appendix for details). Figure 2 The expression levels of HNRNPA2B1 and ERP29 were significantly positively correlated (see appendix for details). Figure 2 (See Appendix A). This result is consistent with RNA sequencing results after knocking down HNRNPA2B1 in KYSE150 cells. Prognostic analysis showed that low KLF10 expression was associated with poor patient survival (P=0.015), while high ERP29 expression was also associated with poor patient prognosis (P=0.04) (see Appendix A for details). Figure 2 (B)

[0033] 3. Conclusion HNRNPA2B1 is highly expressed in esophageal squamous cell carcinoma tissues and is associated with poor prognosis. Its expression level is positively correlated with ERP29, while the expression levels of KLF10 and ERP29 can predict patient prognosis. In summary, by regulating the differential expression of apoptosis-related genes, apoptosis in esophageal squamous cell carcinoma cells can be inhibited, thereby exerting a pro-cancer effect in esophageal squamous cell carcinoma.

[0034] Example 2

[0035] Functional verification of HNRNPA2B1 in promoting anti-apoptosis in KYSE150 cells To investigate the clinical significance and biological function of HNRNPA2B1 in esophageal squamous cell carcinoma, this invention analyzed clinical data and RNA sequencing profiles of esophageal squamous cell carcinoma patients in the TCGA database. To clarify the biological function of HNRNPA2B1 in esophageal squamous cell carcinoma, this invention knocked down the expression of HNRNPA2B1 in KYSE150 cells, and verified the result using real-time quantitative polymerase chain reaction and Western blotting.

[0036] 1. Experimental materials (1) Cell line: KYSE150 cells (Catalog No. CL-0638, Wuhan Pronosai Life Science Technology Co., Ltd.).

[0037] (2) Lentiviral vector: LV-3 (pGLVH1 / GFP+Puro), purchased from Gemma Gene Co., Ltd. (Suzhou, China).

[0038] (3) The shRNA positive strand sequence targeting HNRNPA2B1: 5'-GCTGCAAGACCTCATTCAATT-3' (SEQ ID NO: 1).

[0039] (4) Non-target control shRNA positive strand sequence: 5'-TTCTCCGAACGTGTCACGT-3' (SEQ ID NO:1).

[0040] (5) Cell culture: KYSE150 cells were cultured in a mixed medium of RPMI-1640 and Ham's F-12 containing 10% fetal bovine serum, 100 μg / mL streptomycin and 100 U / mL penicillin, under the conditions of 37℃ and 5% CO2 saturated humidity incubator.

[0041] (6) Main reagents: Annexin V-fluor647 / PI cell apoptosis detection kit (Catalog No. 40304ES60, Jiangsu Kaiji Biotechnology Co., Ltd.), TRIZOL reagent (Catalog No. 15596-018, Ambion), reverse transcription kit (Catalog No. R323-01, Nanjing Novizan), HNRNPA2B1 antibody (Catalog No. 14813-1-AP, Wuhan Sanying), GAPDH antibody (Catalog No. 60004-1-Ig, Wuhan Sanying), protease inhibitor mixture (Catalog No. 4693116001, Sigma), RIPA lysis buffer (Catalog No. PR20001, Wuhan Sanying), ECL chemiluminescence reagent (Catalog No. P0018FM, Shanghai Beyotime).

[0042] 2. Experimental Methods (1) Lentiviral infection and construction of stable transfected cell lines KYSE150 cells in logarithmic growth phase were seeded into 6-well plates at a density of 3 × 10⁶ cells per well. 5 Cells were cultured for 24 hours until cell confluence reached 70%-80%. KYSE150 cells were infected with a lentivirus with a multiplicity of infection (MOI) of 50. The experiment was divided into two groups: a negative control group (NC group, infected with a non-targeted control shRNA lentivirus) and an HNRNPA2B1 knockdown group (sh-HNRNPA2B1 group, infected with a HNRNPA2B1-targeting shRNA lentivirus). Fresh medium was added 24 hours after infection. 48 hours after infection, stable transfected cell lines were selected using 1 μg / mL puromycin. Cells were collected for real-time quantitative polymerase chain reaction (RT-qPCR) and Western blotting analysis.

[0043] (2) RT-qPCR detection cDNA was synthesized using a reverse transcription kit under the following conditions: 42°C for 5 minutes, 37°C for 15 minutes, and 85°C for 5 seconds. The real-time quantitative PCR program was: 95°C pre-denaturation for 10 minutes; 95°C denaturation for 15 seconds; and 60°C annealing and extension for 1 minute, for a total of 40 cycles, with three technical replicates per sample. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control gene. The relative expression levels of the target gene were calculated. The primer sequences for the real-time quantitative polymerase chain reaction are detailed in Table 1.

[0044] Table 1. Primer sets related to the experimental procedure, used for RT-qPCR detection of gene expression validation. (3) Western blot detection KYSE150 cells were placed on ice and lysed using radioimmunoprecipitation (RIPA) lysis buffer (Catalog No. PR20001, Wuhan Sanying Biotechnology Co., Ltd., China) containing a protease inhibitor mixture (Catalog No. 4693116001, Sigma, USA), and incubated on ice for 30 minutes. Protein loading buffer (Catalog No. P1040, Beijing Solarbio Science & Technology Co., Ltd., China) was added to the cell lysis buffer, and the mixture was boiled in a water bath for 10 minutes. The sample was then loaded onto a 10% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) for electrophoresis separation. After electrophoresis, the proteins were transferred to a 0.45 μm polyvinylidene fluoride (PVDF) membrane (Catalog No. ISEQ00010, Millipore, USA). After blocking the PVDF membrane at room temperature for 1 hour, it was incubated overnight at 4°C with HNRNPA2B1 primary antibody (rabbit antibody, dilution 1:2000, catalog number 14813-1-AP, Wuhan Sanying Biotechnology Co., Ltd., China) and GAPDH primary antibody (mouse antibody, dilution 1:5000, catalog number 60004-1-Ig, Wuhan Sanying Biotechnology Co., Ltd., China). The next day, the membrane was incubated at room temperature for 45 minutes with horseradish peroxidase-labeled secondary antibody (anti-rabbit secondary antibody, dilution 1:10000, catalog number SA00001-2, Wuhan Sanying Biotechnology Co., Ltd., China; or anti-mouse secondary antibody, dilution 1:10000, catalog number AS003, Abiotech Biotechnology Co., Ltd., China). Finally, the protein bands were observed by developing the membrane using enhanced chemiluminescence (ECL) reagent (catalog number P0018FM, Shanghai Beyotime Biotechnology Co., Ltd., China).

[0045] (4) Flow cytometry detection of apoptosis Apoptosis levels were detected using the Annexin V-fluorescein 647 / PI apoptosis detection kit (catalog number 40304ES60, Jiangsu Kaiji Biotechnology Co., Ltd., China). Cells were seeded in 6-well plates and treated according to experimental requirements. Treated cells and control cells were collected, and 5 μL of Annexin V-fluor647 was added to each, followed by incubation at room temperature in the dark for 15 minutes; then 10 μL of propidium iodide (PI) reagent was added, and incubation was continued at room temperature in the dark for 15 minutes. After incubation, the apoptosis rate was detected using a flow cytometer (FACSCanto, BD, USA).

[0046] 3. Experimental Results (1) HNRNPA2B1 knockdown efficiency verification RT-qPCR test results show (see attached) Figure 3Compared with the NC group, the relative mRNA expression level of HNRNPA2B1 in the shHNRNPA2B1 group was significantly reduced (see appendix for details). Figure 3 (See Appendix A) Western blot results showed that the HNRNPA2B1 protein band density in the shHNRNPA2B1 group was significantly lower than that in the NC group (see Appendix A for details). Figure 3 (Middle B). The above results indicate that HNRNPA2B1 was effectively knocked down at both the transcriptional and protein levels.

[0047] (2) Results of apoptosis detection Flow cytometry results showed that, compared with the NC group, the total apoptosis rate of cells in the shHNRNPA2B1 group was significantly increased, with a significant increase in both the proportion of early and late apoptotic cells (see details). Figure 3 (C) The difference between the two groups was statistically significant.

[0048] 3. Conclusion Knockdown of HNRNPA2B1 significantly induced apoptosis in KYSE150 cells, demonstrating that HNRNPA2B1 functions as an oncoprotein that inhibits apoptosis and promotes survival in esophageal squamous cell carcinoma cells.

[0049] Example 3

[0050] Mechanism analysis of HNRNPA2B1 regulating transcription and splicing of apoptosis-related genes To elucidate the molecular mechanism by which HNRNPA2B1 regulates apoptosis, this invention performed RNA sequencing on esophageal squamous cell carcinoma cells from the HNRNPA2B1 knockdown group and the negative control group. The filtered sequencing reads were aligned to the human reference genome GRCh38, and the data were normalized for gene length and sequencing depth to correct for inter-sample differences. Subsequently, the gene expression abundance of the two groups was compared.

[0051] 1. Experimental Methods (1) RNA extraction and sequencing Total RNA was extracted from KYSE150 cells in the shHNRNPA2B1 and NC groups using TRIZOL reagent (catalog number 15596-018, Ambion, USA) (3 biological replicates per group). RNA was purified by chloroform treatment, and DNA contamination was removed using RQ1 deoxyribonuclease (DNase) (catalog number M6101, Promega, Madison, USA) (if protein contamination was present, further purification was performed using phenol-chloroform-isoamyl alcohol). The absorbance ratio (A260 / A280) of RNA at 260 nm and 280 nm was measured using a micro spectrophotometer (model N50 touch, Implen, Germany) to determine RNA purity and concentration. RNA integrity was verified by 1.0% agarose gel electrophoresis.

[0052] RNA sequencing was performed by Wuhan Ruixing Biotechnology Co., Ltd. (website: http: / / www.rxbio.cc). 1 μg of total RNA was collected and DNA contamination was removed using RQ1 deoxyribonuclease (Catalog No. M6101, Promega, USA). A strand-specific RNA sequencing library was constructed using the Novizumab VAHTS® Universal V8 RNA-seq Library Prep Kit for Illumina (Catalog No. NR605, Novizumab Biotechnology Co., Ltd., China). Messenger RNA (mRNA) was enriched using Novizumab VAHTS mRNA capture magnetic beads (Catalog No. N401, Novizumab Biotechnology Co., Ltd., China). The enriched mRNA was fragmented and reverse transcribed to synthesize double-stranded cDNA. After end repair and A-tailing, the cDNA was ligated with the Novizumab VAHTS RNA Multiplex Oligos Set 1 for Illumina adapter (Catalog No. N323, Novizumab Biotechnology Co., Ltd., China). The ligation product was amplified, purified, quantified, and stored at -80℃ for later use. During library construction, the second cDNA strand labeled with deoxyuridine triphosphate (dUTP) is not amplified, thus enabling strand-specific sequencing.

[0053] High-throughput sequencing was performed strictly according to the kit instructions for library preparation, and paired-end 150bp sequencing was performed using the Illumina Novaseq Xplus sequencing platform.

[0054] (2) Sequencing data processing and alignment First, raw sequencing reads containing two or more N bases were removed. Then, the FASTX-Toolkit (version 0.0.13) was used to remove adapter sequences and low-quality bases from the sequencing reads, discarding short reads shorter than 16 bp. The filtered high-quality reads were aligned to the human reference genome GRCh38 using HISAT2 software, allowing for up to four mismatch sites. Gene counting was performed on the uniquely aligned reads, and the fragment number per million aligned reads per kilobase transcript (FPKM) was calculated to characterize gene expression levels.

[0055] (3) Differentially expressed gene analysis Differentially expressed genes were screened using the R language bioinformatics software (DESeq2). The screening criteria were: corrected P value < 0.05 and fold change > 2 or < 0.5.

[0056] (4) Variable splicing event analysis The ABLas analysis pipeline was used to identify and quantify alternative splicing events (ASEs) and regulated alternative splicing events (RASEs) among samples. Based on splice site linker reads, the ABLas analysis pipeline can detect 10 alternative splicing events, including exon skipping (ES), variable 5' splice site (A5SS), variable 3' splice site (A3SS), mutually exclusive exons (MXE), intron retention (IR), mutually exclusive 5' untranslated region (5pMXE), mutually exclusive 3' untranslated region (3pMXE), box exons, A3SS&ES complex splicing, and A5SS&ES complex splicing. To identify HNRNPA2B1-regulated alternative splicing events, Student's t-test was used to analyze the significance of changes in the ratio of alternative splicing events. The p-value corresponding to a false detection rate (FDR) of 5% was used as a threshold to screen for HNRNPA2B1-regulated alternative splicing events.

[0057] (5) Functional enrichment analysis KOBAS 2.0 online analysis tool was used to perform gene ontology (GO) functional annotation and KEGG pathway enrichment analysis on differentially expressed genes. The significance of enrichment for each functional item and pathway was determined by hypergeometric test and Benjamini-Hochberg false discovery rate control.

[0058] 2. Experimental Results (1) Overall changes in the transcriptome Principal component analysis (PCA) results based on all detected genes in the 6 samples showed (see appendix for details). Figure 4 The HNRNPA2B1 knockdown group and the negative control group samples could be clearly divided into two clusters. (See appendix for details) Figure 4 (A) indicates that knocking down HNRNPA2B1 can lead to significant transcriptomic reprogramming in cells.

[0059] (2) Screening of differentially expressed genes Differential expression analysis was performed using DESeq2, and a total of 491 significantly differentially expressed genes were identified (see appendix for details). Figure 4 (Middle B). Compared to the control group, the knockdown group showed 327 upregulated genes and 164 downregulated genes. Hierarchical cluster analysis of these differentially expressed genes showed that the experimental and control samples were clearly distinguishable, and the three biological replicates exhibited high reproducibility (see Appendix for details). Figure 4 (C)

[0060] (3) GO functional enrichment analysis of differentially expressed genes To further explore the biological functions of differentially expressed genes, this invention performs gene ontology functional enrichment analysis. GO functional enrichment analysis of upregulated differentially expressed genes shows (see appendix for details). Figure 4 The biological processes significantly enriched (see Table 2) include: signal transduction, lipopolysaccharide response, cell adhesion, bacterial defense response, intercellular signal transduction, cell response to interferon-gamma, negative regulation of cell proliferation, cell response to tumor necrosis factor, positive regulation of the ERK1 and ERK2 cascade, and positive regulation of apoptosis.

[0061] Table 2. Bioanalytical results of the most significant upregulation of GO. GO functional enrichment analysis of differentially expressed genes downregulated showed (see appendix for details). Figure 4 The significantly enriched biological processes (see Table 3) include: intermediate fibrous tissue formation, skin barrier establishment, viral response, negative regulation of viral genome replication, positive regulation of gene expression, negative regulation of RNA polymerase II transcription, keratinization, intercellular signal transduction, epithelial cell differentiation, and negative regulation of apoptosis.

[0062] Table 3. Bioanalytical results of the most significant downregulation of GO. (4) Identification of differentially expressed genes related to apoptosis In-depth analysis of apoptosis-related genes revealed (see appendix for details) Figure 4 In the case of HNRNPA2B1 knockdown, the following genes were upregulated (pro-apoptotic direction): H1-2, KLF10, CXADR; and the following genes were downregulated (anti-apoptotic direction): ISG15, ALDH1A3, CLDN4, ERP29, FGFBP1. All of these genes were confirmed to be involved in tumor-related apoptosis regulation.

[0063] (5) Panoramic analysis of variable splicing events Appendix Figure 5Using the ABLas analysis pipeline, the distribution of differentially occurring alternative splicing events detected between the shHNRNPA2B1 group and the NC group is as follows (see appendix for details). Figure 5 In the study (A), a total of 722 intron retention (IR), 356 variable 3' splice sites (A3SS), 267 variable 5' splice sites (A5SS), 174 box exons (CE), 137 exon skips (ES), 88 mutually exclusive 3' untranslated regions (3pMXE), 69 mutually exclusive 5' untranslated regions (5pMXE), 54 A5SS&ES complex splices, 51 mutually exclusive exons (MXE), and 41 A3SS&ES complex splices were detected.

[0064] The genes corresponding to these differentially spliced ​​events were classified and statistically analyzed (see appendix for details). Figure 5 (B) The results showed that intron retention events corresponded to the most genes (652), followed by variable 3' splicing site events (312) and variable 5' splicing site events (245). Most genes had only one significantly different alternative splicing event (see Appendix for details). Figure 5 (C)

[0065] Further analysis of the splicing ratios of up- and down-regulated differential alternative splicing events revealed distinct patterns for different event types: for mutually exclusive 5' untranslated regions, A3SS&ES complex splicing, variable 5' splicing sites, and exon skipping events, the median splicing ratio for down-regulated events was significantly higher than that for up-regulated events; while mutually exclusive exon events showed the opposite trend (see Appendix for details). Figure 5 (D). A comparison of the splicing ratio changes at known and newly discovered splicing sites revealed different characteristics for different event types: for variable 3' splicing sites and mutually exclusive exon events, the splicing ratio change at newly discovered splicing sites was greater than that at known splicing sites; while the opposite was true for intron retention events (see Appendix D for details). Figure 5 (Middle E). Furthermore, 81.9% of the significantly differentially occurring alternative splicing events occurred in mRNA transcripts, and 15.1% occurred in lncRNAs (see Appendix for details). Figure 5 (F). The above results indicate that HNRNPA2B1 can participate extensively in the splicing process of precursor RNA in esophageal squamous cell carcinoma cells by regulating multiple splicing mechanisms.

[0066] (6) Identification of apoptosis-related differential alternative splicing events To further elucidate the biological significance of differentially spliced ​​events, this invention performs gene ontology (GO) functional enrichment analysis on the relevant genes (see appendix for details). Figure 6The results showed that the top ten biological processes with the highest enrichment levels included signal transduction, lipopolysaccharide response, cell adhesion, bacterial defense response, intercellular signal transduction, cellular response to interferon-gamma, negative regulation of cell proliferation, cellular response to tumor necrosis factor, positive regulation of the ERK1 and ERK2 cascade, and positive regulation of apoptosis (see appendix for details). Figure 6 (See Table 4, section A).

[0067] Table 4. Results of the analysis of the most enriched GO organisms containing differentially spliced ​​events. Further investigation into alternative splicing changes in apoptosis-related genes revealed a significant enrichment of genes involved in differentially spliced ​​events (DSA) in apoptosis-related biological processes. Notably, both the CCNL2 gene (a variable 3' splicing event) and the MEAF6 gene (a cassette exon event) exhibited marked changes in splicing patterns. Literature review confirmed that several genes involved in DSA are involved in tumor apoptosis regulation, including RPS24 (exon skipping event), IRF3 (intron retention event), MFF (variable 5' splicing event), and long non-coding RNAs SNHG17, KIF23 (variable 3' splicing event), IKBIP (exon skipping event), and BAG6 (intron retention event). These genes all showed significant splicing pattern alterations upon knockdown of HNRNPA2B1. (See appendix for details) Figure 6 (B) To investigate whether genes undergoing alternative splicing are simultaneously regulated at the transcriptional level, a joint analysis was performed on differentially expressed genes and genes related to differential alternative splicing (see appendix for details). Figure 7 A total of 34 genes with significant differences at both the transcriptional and splicing levels were screened (see appendix for details). Figure 7 (See Appendix A). It is noteworthy that in the variable 5' splicing site events of the ARHGDIB gene, the splicing ratio is negatively correlated with the overall gene expression level (see Appendix A for details). Figure 7 (B, C). This antagonistic pattern suggests that alternative splicing of the ARHGDIB gene may be involved in regulating its total gene expression. In summary, HNRNPA2B1 may affect the apoptosis process of esophageal squamous cell carcinoma cells by synergistically regulating the alternative splicing process of apoptosis-related genes.

[0068] 3. Conclusion HNRNPA2B1 exerts a synergistic anti-apoptotic effect in esophageal squamous cell carcinoma cells through a dual mechanism. At the transcriptional level, it regulates the expression of apoptosis-related genes (H1-2, KLF10, CXADR, ISG15, ALDH1A3, CLDN4, ERP29, FGFBP1); at the RNA splicing level, it regulates alternative splicing events of key apoptosis genes (RPS24, IRF3, MFF, SNHG17, KIF23, IKBIP, BAG6). These results collectively construct a complex anti-apoptotic regulatory network mediated by HNRNPA2B1, thereby promoting the malignant progression of esophageal squamous cell carcinoma.

[0069] Example 4

[0070] qPCR kit for detecting HNRNPA2B1 expression 1. Reagent kit components The upstream primer for specifically amplifying the HNRNPA2B1 gene is: ATGGAGGAGGAAGAGGAGGAT (SEQ ID NO:2) and the downstream primer is: CGTAGTTAGAAGGTTGCTGGTT (SEQ ID NO:3). The internal reference GAPDH primer pair has the following upstream primers: GGTCGGAGTCAACGGATTTG (SEQ ID NO:4) and downstream primers: GGAAGATGGTGATGGGATTTC (SEQ ID NO:5). SYBR Green qPCR premix (2×); Reverse transcription reagent (5×); Positive control: Total RNA from KYSE150 cells with high HNRNPA2B1 expression; Negative control: Sterile water free of RNase; Instruction manual.

[0071] 2. Instructions for use Total RNA was extracted from the test samples, and cDNA was synthesized using a reverse transcription kit. Using the cDNA as a template, qPCR was performed with the aforementioned primers under the following conditions: 95°C pre-denaturation for 10 minutes; 95°C denaturation for 15 seconds; 60°C annealing and extension for 1 minute, for a total of 40 cycles. Three technical replicates were set up for each sample. The relative expression level of HNRNPA2B1 was calculated using a method. If the detection result was significantly higher than the threshold (e.g., twice the standard deviation of the mean in normal tissue), it indicated a poor prognosis for the patient.

[0072] Example 5

[0073] Immunohistochemical kit for detecting HNRNPA2B1 expression 1. Reagent kit components Rabbit anti-human HNRNPA2B1 monoclonal antibody (working concentration 1:2000). Horseradish peroxidase-labeled goat anti-rabbit secondary antibody (working concentration 1:10000). DAB colorimetric solution; Citrate antigen retrieval solution (10mM, pH 6.0); PBS buffer (0.01M, pH 7.2); Positive control sections: ESCC tissue sections with known high expression of HNRNPA2B1; Negative control sections: Normal esophageal tissue sections with known negative expression of HNRNPA2B1; Instruction manual.

[0074] 2. Instructions for use Paraffin sections of esophageal squamous cell carcinoma tissue were dewaxed to water, then subjected to high-temperature retrieval with citrate antigen retrieval solution for 10 minutes, followed by blocking of endogenous peroxidase with 3% hydrogen peroxide for 10 minutes. HNRNPA2B1 primary antibody was added and incubated overnight at 4°C. The next day, secondary antibody was added and incubated at room temperature for 45 minutes, followed by DAB staining for 3-5 minutes, hematoxylin counterstaining for 1 minute, and then dehydration and mounting. Staining results were observed under a microscope, and a comprehensive score (total score 0-12 points) was calculated based on staining intensity (0-3 points) and the proportion of positive cells (0-4 points). A comprehensive score ≥6 points was considered high expression, and <6 points was considered low expression. High expression indicated a poor prognosis.

[0075] Example 6

[0076] Preparation of HNRNPA2B1 shRNA liposome injection 10 mg of HNRNPA2B1 shRNA (SEQ ID NO:1) was dissolved in 1 mL of RNase-free sterile water to prepare a 10 mg / mL shRNA solution. 50 mg of cationic liposome DOTAP was dissolved in 9 mL of physiological saline to prepare a 5 mg / mL liposome solution. The shRNA solution was slowly added dropwise to the liposome solution with gentle stirring, and incubated at room temperature for 30 minutes to form a liposome complex with a particle size of approximately 100 nm. The solution was diluted to 0.5 mg / mL with physiological saline, filtered through a 0.22 μm filter for sterilization, aliquoted into sterile vials, and stored at 4°C for later use.

[0077] Although embodiments of the invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents.

Claims

1. The application of a reagent for detecting HNRNPA2B1 expression levels in the preparation of a diagnostic kit for prognostic assessment of esophageal squamous cell carcinoma, characterized in that... The reagents for detecting HNRNPA2B1 expression levels include: primers or probes that specifically amplify the HNRNPA2B1 gene; or antibodies that specifically bind to the HNRNPA2B1 protein; the reagents also include reagents for detecting KLF10 and / or ERP29 expression levels, and the combined detection of HNRNPA2B1, KLF10 and ERP29 expression levels improves the accuracy of prognostic assessment of esophageal squamous cell carcinoma.

2. A method for screening candidate drugs for the treatment of esophageal squamous cell carcinoma, characterized in that, Specifically, the following steps are included: Step 1: Contact esophageal squamous cell carcinoma cells expressing HNRNPA2B1 with the test substance at a concentration of 0.1-100 μM for 24-72 hours; Step 2: Detect the expression level or activity of HNRNPA2B1 in the cells; Step 3: Select the test substance that can reduce the expression level or activity of HNRNPA2B1 as the initial screening positive substance; Step 4: Further examine the cells treated with the initial screening positive substance, selecting one or more indicators from the following: (1) Expression levels of apoptosis-related genes regulated by HNRNPA2B1, wherein the apoptosis-related genes are selected from H1-2, KLF10, CXADR, ISG15, ALDH1A3, CLDN4, ERP29 or FGFBP1; (2) Alternative splicing events of apoptosis-related genes regulated by HNRNPA2B1, wherein the alternative splicing events involve genes selected from RPS24, IRF3, MFF, SNHG17, KIF23, IKBIP or BAG6; Step 5: Select positive candidates for the treatment of esophageal squamous cell carcinoma by upregulating the expression levels of genes selected from H1-2, KLF10 or CXADR in (1); and / or downregulating the expression levels of genes selected from ISG15, ALDH1A3, CLDN4, ERP29 or FGFBP1 in (1); and / or altering alternative splicing events of apoptosis-related genes regulated by HNRNPA2B1 in (2).

3. The method for screening candidate drugs for treating esophageal squamous cell carcinoma according to claim 2, characterized in that, The esophageal squamous cell carcinoma cells were KYSE150 cells.

4. The use of HNRNPA2B1 inhibitors in the preparation of medicaments for the treatment or prevention of esophageal squamous cell carcinoma, characterized in that, The inhibitor is selected from siRNA, shRNA, antisense oligonucleotides, or small molecule compounds, antibodies, or antagonists that specifically bind to and block the function of HNRNPA2B1 protein. The inhibitor can specifically reduce the expression of the HNRNPA2B1 gene or the activity of the protein.

5. The application according to claim 4, characterized in that, The drug also includes a pharmaceutically acceptable carrier, and its dosage form is an injection, an oral preparation, or an inhaler.

6. The application according to claim 4, characterized in that, The target sequence of the shRNA is shown in SEQ ID NO:1, namely 5'-GCTGCAAGACCTCATTCAATT-3'.

7. A kit for prognostic assessment of esophageal squamous cell carcinoma, characterized in that, The kit contains an effective amount of reagents capable of detecting HNRNPA2B1 expression levels in biological samples, along with instructions for use.

8. The reagent kit according to claim 7, characterized in that, The reagents are real-time quantitative PCR reagents or immunohistochemical detection reagents.

9. The reagent kit according to claim 7, characterized in that, The biological samples are tissue or blood samples from patients with esophageal squamous cell carcinoma.

10. The reagent kit according to claim 9, characterized in that, The tissue samples were paraffin-embedded tissue and fresh frozen tissue.

Images