A kit for detecting benzimidazole resistance in Haemonchus contortus.

Abstract

This invention discloses a kit for detecting benzimidazole resistance in Haemonchus contortus. The kit includes a β-tubulin resistance allele detection component, an insect species and template quality control component, an allele ratio calibration component, a PCR amplification reaction component, and a result determination component. The kit uses dual-channel real-time fluorescence PCR to quantitatively detect the proportions of F167Y, E198A, and F200Y mutant alleles in an egg population sample. Combined with standard curve correction, a three-level typing system is achieved: susceptible SS, heterozygous resistance risk RS, and resistance dominance RR. This system is used for population resistance risk assessment and early warning before benzimidazole-based drug control.

Description

Technical Field

[0001] This invention belongs to the field of parasite molecular detection technology, specifically relating to a kit for detecting benzimidazole resistance in Haemonchus contortus based on quantitative analysis of allele ratios. Background Technology

[0002] Nematode infection is one of the most important parasitic diseases affecting the development of ruminant animal husbandry. Among them, *Haemonchus contortus* has long been a key target for the prevention and control of gastrointestinal parasites in ruminants such as sheep and goats due to its high reproductive capacity, rapid spread, and the continuous blood loss it causes to the host. Currently, benzimidazoles (BZs) remain one of the important drugs for the prevention and treatment of *Haemonchus contortus* infection due to their broad-spectrum, high efficacy, and ease of use.

[0003] However, with the long-term and extensive use of benzimidazole drugs in aquaculture, varying degrees of drug resistance have gradually emerged in the population of Haemaphys contortus, leading to decreased drug control efficacy and increased difficulty in parasite control. Therefore, establishing rapid and accurate methods for detecting drug resistance is of great significance for the rational selection of anthelmintics and delaying the spread of drug resistance.

[0004] Existing research indicates that resistance of *Haemaphysema contortus* to benzimidazole drugs is mainly associated with specific site mutations in the coding region of the β-tubulin gene. Mutations at sites such as F167Y, E198A, and F200Y are considered to be closely related to reduced benzimidazole binding capacity. Currently, detection methods targeting these mutation sites mainly include allele-specific PCR (AS-PCR), real-time fluorescence PCR, and sequencing analysis.

[0005] However, existing detection technologies are mainly used to determine whether drug resistance-related mutations exist in the sample to be tested. They usually output a binary classification result of "mutation present" or "mutation absent", which is difficult to reflect the actual distribution of drug resistance genes in the insect population.

[0006] In fact, benzimidazole resistance in Haemonchus contortus exhibits a gradual evolutionary pattern, typically progressing from a susceptible homozygous genotype (SS) to a resistant heterozygous genotype (RS) and finally to a resistant homozygous genotype (RR). The RS heterozygous stage is a crucial transitional phase in the spread of resistance. During this stage, the proportion of resistant alleles in the population gradually increases, but a dominant RR homozygous resistant population has not yet formed. Traditional efficacy evaluation methods may still show high anthelmintic effects, leading to a failure to promptly detect resistance risks in aquaculture production.

[0007] On the other hand, existing molecular detection methods still have the following shortcomings in practical applications:

[0008] (1) It is difficult to apply to the detection of low proportion of drug resistance alleles in insect egg population samples.

[0009] Field monitoring typically focuses on detecting colonies of parasite eggs in the feces of infected animals, rather than individual parasites. Since egg samples often contain DNA from multiple parasites with different genetic backgrounds, when the proportion of resistant strains is low, mutant allele signals are easily interfered with by the wild-type background, making it difficult to accurately identify early resistance status.

[0010] (2) It is impossible to distinguish the different genetic stages in the process of drug resistance formation.

[0011] While existing AS-PCR or conventional fluorescent PCR methods can detect drug resistance-related mutations, they can usually only determine whether the mutation exists, but cannot further determine the proportion of the mutated allele in the population. Therefore, they cannot effectively distinguish between a low proportion of drug resistance risk status and a population that has already formed a drug resistance advantage.

[0012] (3) Lack of quantitative calibration system for early warning stage of drug resistance.

[0013] Because different detection systems exhibit variations in amplification efficiency, fluorescence signal intensity, and template ratio response, even if a mutation signal is detected, it is difficult to directly convert it into a reliable proportion of drug-resistant alleles. Therefore, a method is currently lacking that can establish a stable calibration relationship for insect egg population samples and achieve repeated detection of low-proportion drug-resistant alleles.

[0014] Therefore, although existing technologies can detect benzimidazole resistance-related mutations in Haemonchus contortus to some extent, they still cannot solve the following technical problems:

[0015] How can we stably and accurately quantify low-proportion drug-resistant alleles in a population sample of Haemonchus contortus eggs, in the early stage before drug resistance forms a dominant population, and identify drug resistance risk windows accordingly, so as to achieve drug resistance early warning before the use of benzimidazole drugs?

[0016] Based on the above technical requirements, it is necessary to develop a benzimidazole resistance detection product for Haemaphys contortus that is applicable to samples of worm egg populations, has allele ratio calibration capabilities, and can distinguish between susceptible, early resistance risk, and resistance advantage types. Summary of the Invention

[0017] To address the shortcomings of existing technologies, this invention provides a kit for detecting benzimidazole resistance in Haemaphysema contortus.

[0018] To achieve the above objectives, the present invention adopts the following technical solution:

[0019] A kit for detecting benzimidazole resistance in Haemonchus contortus, comprising:

[0020] (1) β-tubulin resistance allele detection component, including:

[0021] Mutant-specific amplification primers and mutant detection probes targeting benzimidazole resistance-related mutation sites in the β-tubulin gene of Haemonchus contortus;

[0022] And wild-type specific amplification primers and wild-type detection probes for the wild-type sequences corresponding to the mutation sites;

[0023] The mutant detection probe and the wild-type detection probe carry different fluorescent labels to distinguish mutant alleles and wild-type alleles in the same detection system.

[0024] (2) Insect species and template quality control components, including:

[0025] Internal reference detection primers and probes for amplifying specific conserved sequences of Haemonchus contortus.

[0026] Used to confirm the source of the template to be tested and to evaluate the quality of DNA extraction;

[0027] If the internal control amplification fails to meet the preset quality control requirements, the sample DNA is deemed unqualified, and the sample is reprocessed.

[0028] (3) Allele ratio calibration component, including:

[0029] A series of standard templates formed by mixing β-tubulin mutant templates and wild-type templates in known proportions;

[0030] The series of standard templates are used to simulate the genetic state of insect egg populations with different drug resistance allele frequencies and to establish the correspondence between the proportion of mutated alleles and the amplification detection signal.

[0031] The ratio calibration relationship is used to correct the detection bias caused by the difference in amplification efficiency and fluorescence response between mutant and wild-type templates, thereby enabling quantitative analysis of the proportion of drug-resistant alleles in the insect egg population sample.

[0032] (4) PCR amplification reaction components, including:

[0033] DNA polymerase, dNTP mixture, buffer solution, magnesium ions, and nucleic acid stabilizers;

[0034] (5) Detection result judgment component;

[0035] The kit detects the proportion of β-tubulin mutant alleles in the egg population sample and determines the benzimidazole resistance risk status of Haemaphys contortus according to preset judgment criteria.

[0036] Furthermore, the egg population sample is a mixed sample of Haemaphysema contortus eggs isolated from the feces of animals from the same source of infection. Each sample contains ≥100 eggs.

[0037] Preferably, the benzimidazole resistance-related mutation sites in the β-tubulin gene include:

[0038] F200Y mutation site;

[0039] F167Y mutation site;

[0040] One or more of the E198A mutation sites.

[0041] Preferably, the mutant detection probe and the wild-type detection probe are labeled with different fluorescent reporter groups.

[0042] The preferred probe markers are wild-type FAM and mutant probe markers HEX / VIC.

[0043] The mutant and wild-type detection signals were simultaneously acquired using dual-channel real-time fluorescence PCR. The dual-channel detection system includes a first fluorescence channel for detecting the wild-type β-tubulin sequence and a second fluorescence channel for detecting the mutant β-tubulin sequence.

[0044] Preferably, the proportion of mutant alleles in the series of standard templates includes: 0%, 10%, 20%, 30%, 50%, 75%, and 100%.

[0045] Furthermore, the standard template is obtained by mixing a recombinant template containing a β-tubulin wild-type sequence and a recombinant template containing a drug resistance-related mutant sequence in corresponding proportions.

[0046] Among them, the 0% and 100% proportion templates are used to establish reference baselines for sensitive and resistant drug types, respectively;

[0047] A 10%-50% template ratio is used to simulate the early risk stage of the gradual accumulation of drug resistance alleles.

[0048] The standard templates were obtained by constructing recombinant templates containing wild-type β-tubulin fragments and recombinant templates containing drug-resistant mutant β-tubulin fragments. Nucleic acid concentrations were measured and converted to copy numbers, and the samples were mixed in the following ratios: 0:100; 10:90; 20:80; 30:70; 50:50; 75:25; 100:0.

[0049] Preferably, the proportion of mutant alleles is obtained in the following manner:

[0050] The correspondence between amplification cycle threshold and template copy number was established based on mutant and wild-type standard templates, respectively;

[0051] Calculated based on the copy number of the mutant and wild-type templates in the sample to be tested:

[0052] Mutant allele ratio = mutant template copy number / (mutant template copy number + wild-type template copy number) × 100%.

[0053] Preferably, the drug resistance risk status includes:

[0054] (1) If the proportion of mutated alleles is <10%, it is determined to be a susceptible SS type;

[0055] (2) If the proportion of mutated alleles is less than 50%, it is judged to be in the RS risk stage;

[0056] (3) If the proportion of mutant alleles is ≥50%, it is determined to be the stage of drug resistance allele dominance.

[0057] The present invention also provides a method for detecting benzimidazole resistance in Haemonchus contortus using the kit, comprising the following steps:

[0058] (1) Collect samples of the egg population of Haemonchus contortus to be tested and extract genomic DNA;

[0059] (2) The internal reference sequence was detected using insect species and template quality control components to confirm the sample source and evaluate the quality of the DNA template;

[0060] (3) Using the β-tubulin resistance allele detection kit, mutant alleles and wild-type alleles were amplified in the same PCR reaction system, respectively;

[0061] (4) Establish the correspondence between amplification signals and mutation ratios using the allele ratio calibration component;

[0062] (5) Calculate the proportion of mutant alleles in the sample of the insect egg population to be tested;

[0063] (6) Determine the benzimidazole resistance risk status based on the proportion of the mutant alleles.

[0064] Preferably, the sample to be tested is a mixed sample of Haemaphyseudomonas contortus eggs from the same infected animal population or farmed population.

[0065] Preferably, the kit is capable of detecting a low proportion of drug resistance alleles. More preferably, the range is 5%-40%.

[0066] Furthermore, when the proportion of mutated alleles detected reaches 20% to 50%, the population to be tested is identified as being in an early warning state of benzimidazole resistance.

[0067] The mutant amplification primers are designed for allele-specific amplification: their 3' ends are located at the positions of drug-resistant mutant bases; and the selectivity of mutant amplification is improved through end mismatch.

[0068] Preferably, the test results are used to assess the drug resistance risk of the tested population before implementing benzimidazole drug control, so as to guide drug rotation or adjustment of control programs.

[0069] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0070] 1) Early sample acquisition: By targeting the egg population, there is no need to wait for adult worms to be released. The drug resistance risk assessment can be completed before medication, providing a time window for clinical decision-making;

[0071] 2) Precise quantification: Through dual-channel real-time fluorescence PCR combined with standard curve copy number correction, the proportion of mutant alleles can be accurately quantified, and the three genotypes SS / RS / RR can be distinguished.

[0072] 3) Comprehensive quality control system: The internal reference test has both insect species identification and template quality evaluation functions, ensuring that the test results are specific, reliable and traceable;

[0073] 4) Drug resistance risk stratification: Establish a three-level judgment standard (SS / RS / RR) and an early warning interval (20%-50%) to identify drug resistance transition stages and guide stratified intervention;

[0074] 5) Feasible for clinical translation: Based on the conventional real-time PCR platform, it is easy to operate and cost-controllable, making it suitable for on-site promotion and large-scale monitoring in farms.

[0075] In summary, this invention avoids the qualitative limitations of traditional fluorescent PCR that relies solely on Ct values ​​to determine the presence of mutations by constructing a series of calibration templates with known proportions of drug-resistant alleles. It achieves the conversion of detection signals into drug-resistant allele proportions, making it possible to stably identify low proportions of drug-resistant alleles in insect egg population samples. Attached Figure Description

[0076] Figure 1 This is a structural diagram of the reagent kit;

[0077] Figure 2 This is a schematic diagram illustrating the principle of β-tubulin allele detection.

[0078] Figure 3 This is a flowchart of the testing process;

[0079] Figure 4 The standard template calibration curve;

[0080] Figure 5 This is a dual-channel PCR amplification curve;

[0081] Figure 6 A correlation graph showing the relationship between theoretical and detected values;

[0082] Figure 7 This is a verification chart for low-proportion drug resistance testing;

[0083] Figure 8 This is a schematic diagram illustrating the principle of insect egg population detection. Detailed Implementation

[0084] The present invention will be further described below through specific embodiments. To make the inventive objectives, technical solutions, and beneficial technical effects of the present invention clearer, the present invention will be further described in detail below with reference to the embodiments. It should be understood that the embodiments described in this specification are merely for explaining the present invention and are not intended to limit the present invention.

[0085] Unless otherwise stated, all instruments and reagents used in the examples are commercially available or synthesized using conventional methods and can be used directly without further processing, and all instruments used in the examples are commercially available.

[0086] Reagents and Instruments

[0087]

[0088] Example 1: Construction of a kit for detecting benzimidazole resistance in Haemonchus contortus.

[0089] 1.1 Target sequence selection and primer / probe design

[0090] Based on the β-tubulin isotype-1 gene sequence of Haemaphysema contortus (accession number: X80046) in GenBank, which covers the regions containing codons 167, 198, and 200, an allele-specific detection system was designed.

[0091] Design principles:

[0092] The mutant amplification primer has the 3' end located at the position of the mutant base, which enhances the mutant selectivity by introducing a terminal mismatch.

[0093] Wild-type and mutant detection probes were labeled with different fluorescent reporter groups, and the quenching groups were BHQ1 (F200Y, E198A system) or BHQ2 (F167Y system).

[0094] The length of the amplified fragment should be controlled between 80-150 bp to ensure the efficiency of fluorescent PCR amplification.

[0095] F200Y site detection sequence:

[0096] Wild-type upstream primer GTGATGAGGTACAACGAGGC none Wild-type downstream primers CCTCCTTCATCGTCTTCCAG none Mutant upstream primer GTGATGAGGTACAACGAGGT none mutant downstream primer CCTCCTTCATCGTCTTCCAG none Wild-type probe CACGAGGAACGAGTGACG 5'-FAM, 3'-BHQ1 mutant probes CACGAGGAACGAGTGACA 5'-HEX, 3'-BHQ1

[0097] F167Y site detection sequence:

[0098] Wild-type upstream primer CGTATGTCGGCGACGGTTTC none Wild-type downstream primers GAGTTCTCGGTGAACTCCAT none Mutant upstream primer CGTATGTCGGCGACGGTTAC none mutant downstream primer GAGTTCTCGGTGAACTCCAT none Wild-type probe TGGGCCAAGGGCCACTAC 5'-ROX, 3'-BHQ2 mutant probes TGGGCCAAGGGCCACTAT 5'-Cy5.5, 3'-BHQ2

[0099] E198A site detection sequence:

[0100] Wild-type upstream primer TCTGCTGACCAGATGAGGAA none Wild-type downstream primers CTCCATGGTACCAGGCTCAT none Mutant upstream primer TCTGCTGACCAGATGAGGGC none mutant downstream primers CTCCATGGTACCAGGCTCAT none Wild-type probe CTCGTCGTGATGGAAAGT 5'-FAM, 3'-BHQ1 mutant probes CTCGTCGTGATGGAAAGC 5'-HEX, 3'-BHQ1

[0101] The three sites can each establish an independent detection system, or a combination of dominant sites can be selected for detection based on epidemiological data.

[0102] 1.2 Design of Internal Reference Detection System

[0103] The ITS2 sequence of Haemonchus contortus ribosomal DNA (GenBank accession number: X78803) was selected as an internal reference target for species identification.

[0104] ITS2 upstream primer GCGAGTGATCATTGCTTAAGTTC none ITS2 downstream primers CACGAGCCGAGTGATCCAC none ITS2 probe CCGCTGCGGTAGGTGAACCTGC 5'-CY5, 3'-BHQ2

[0105] Functions of the internal reference detection system:

[0106] Species identification: Only Haemonchus contortus showed positive amplification of the ITS2 sequence, while closely related species (such as Trichodina, hookworm, and Haemonchus placei) showed no cross-reaction;

[0107] Template quality control: If the internal control Ct value is ≤32, the DNA extraction quality is considered qualified; if the Ct value is >32 or amplification fails, the sample is considered unqualified and needs to be extracted again.

[0108] 1.3 Preparation of Standard Templates

[0109] Recombinant plasmid construction: Using the genomic DNA of susceptible strains of Haematococcus contortus as a template, the β-tubulin gene fragment (containing the F200Y wild-type sequence) was amplified by PCR and cloned into the pUC57 vector to construct the wild-type recombinant plasmid (pUC57-WT).

[0110] Using the genomic DNA of the drug-resistant strain as a template, a fragment containing the F200Y mutant sequence was amplified to construct a mutant recombinant plasmid (pUC57-MUT).

[0111] Sequencing was used to verify the correctness of the inserted sequence, and alignment with the X80046 reference sequence confirmed site consistency.

[0112] Plasmid quantification and mixing: Plasmid concentration was determined using NanoDrop One, and copy number concentration was calculated based on the plasmid molecular weight (3,215 bp).

[0113] pUC57-WT and pUC57-MUT were mixed at the following copy number ratios to prepare a series of standard templates, as shown in the table below:

[0114] Std-0 0:100 0% SS (Sensitive homozygous) Std-10 10:90 10% Early RS risk in the population Std-20 20:80 20% Lower limit of early warning interval for groups Std-30 30:70 30% Group RS risk in the medium term Std-50 50:50 50% RS (Hybrid) / Population Determination Criterion Std-75 75:25 75% transition from RS to RR in the population Std-100 100:0 100% RR (antidrug resistance homozygous)

[0115] Standard templates, after being packaged, should be stored at -20°C and have a shelf life of 12 months.

[0116] 1.4 Reagent Kit Assembly

[0117] Component A: Antimicrobial Resistance Site Detection Mixture Please select wild-type primer pairs, mutant primer pairs, double-labeled probes, and PCR buffer. 50 reactions / tube Component B: Internal control detection mixture ITS2 primer pair, CY5-labeled probe, PCR buffer 50 reactions / tube Component C: Standard Template Set One tube each for Std-0 to Std-100 100 μL / tube Component D: PCR premix <![CDATA[Taq DNA polymerase, dNTPs, MgCl2, stabilizer]]> 1 mL / tube Component E: Positive Control Egg genomic DNA containing 50% mutations 100 μL / tube Component F: Negative Control Template-free reactive water 500 μL / tube

[0118] Example 2: Establishment of Standard Curve and Validation of Reagent Kit Performance

[0119] 2.1 Fluorescent PCR Reaction System

[0120] Component D: PCR premix 10 μL Component A: Target site detection mixture (taking F200Y as an example) 4 μL Template DNA (or standard template) 2 μL (10-100 ng) Nuclease-free water Make up to 20 μL

[0121] Reaction program: 95°C pre-denaturation for 30 s; (95°C denaturation for 5 s; 60°C annealing / extension for 30 s) × 40 cycles, with FAM and HEX (or corresponding fluorescence channels) signals acquired per cycle.

[0122] 2.2 Establishment of Standard Curve

[0123] Using a series of standard templates (Std-0 to Std-100) as the detection targets, each template was repeated 3 times for dual-channel fluorescent PCR detection.

[0124] Data processing:

[0125] Ct value-copy number standard curves were established for wild-type and mutant types using Std-0 and Std-100, respectively;

[0126] Example of a standard curve equation: Ct = -3.321 × log 10 (Copy count) + 40.2;

[0127] The amplification efficiency E = 10^(-1 / slope) - 1, requiring the difference in amplification efficiency between wild type and mutant to be <5%.

[0128] Calculation of mutant allele ratio: Mutant copy number : Mutant copy number = ;

[0129] Wild-type copy number: Wild-type copy number = ;

[0130] Mutant allele ratio = mutant copy number / (mutant copy number + wild type copy number) × 100%.

[0131] 2.3 Linear Range and Precision Verification

[0132] Std-0 0% 0.3±0.2% — — Std-10 10% 10.2±0.8% 2.0% 7.8% Std-20 20% 19.6±1.1% -2.0% 5.6% Std-30 30% 30.5±1.3% 1.7% 4.3% Std-50 50% 49.8±1.5% -0.4% 3.0% Std-75 75% 74.2±1.8% -1.1% 2.4% Std-100 100% 99.5±0.5% -0.5% 0.5%

[0133] Conclusion: Within the range of 10%-100%, the relative deviation between the measured and theoretical values ​​is <5%, CV% <8%, and the linear relationship is good (R0). 2 >0.99). No mutation signal was detected in Std-0, indicating good specificity.

[0134] Example 3: Validation of the ability to detect low proportion of RS drug resistance risk

[0135] 3.1 Determination of the lower limit of detection

[0136] Additional standard templates with mutation ratios of 5%, 10%, and 15% were prepared, and each concentration was tested 20 times to evaluate the reliability of low-ratio detection.

[0137] 0% 0 / 20 0.2±0.1% — benchmark 5% 18 / 20 5.3±1.6% 30.2% Partial overlap 10% 20 / 20 10.1±0.9% 8.9% Complete distinction 15% 20 / 20 14.8±1.0% 6.8% Complete distinction

[0138] Judgment: The limit of detection (LOD) of this kit is 5%, and the limit of quantitation (LOQ) is 10%.

[0139] 3.2 Robustness Verification for the 50% Critical Value Determination

[0140] Standard templates with theoretical proportions of 46%, 48%, 50%, 52%, and 54% were prepared, and each concentration was tested 10 times in repeated assays.

[0141] 46% 45.6±1.4% 3.1% 10 / 10 RS 48% 47.9±1.6% 3.3% 10 / 10 RS 50% 49.9±1.7% 3.4% 6 / 10 RS, 4 / 10 RR 52% 52.1±1.5% 2.9% 10 / 10 RR 54% 54.3±1.3% 2.4% 10 / 10 RR

[0142] Conclusion: Within the 46%-54% range, the deviation between the kit's measured values ​​and theoretical values ​​was within ±4%, indicating good precision. Since 50% is the dividing threshold between the RS risk type and the RR advantage type, there is approximately a 20% chance of fluctuation in the single judgment of measured values ​​within the 48%-52% range (due to measurement error). Therefore, when the measured values ​​fall within the 45%-55% range, it is recommended to perform repeated testing (n=3), using the majority result (2 / 3 consistency) as the final judgment.

[0143] 3.3 Consistency of SS / RS / RR classification determination

[0144] Using Std-0, Std-10, Std-30, Std-50, and Std-100 as simulated samples, the genotyping criteria were determined according to the population allele frequency standard:

[0145] Std-0 0.3% <10% SS √ Std-10 10.2% 10%-50% RS Risk Type √ Std-30 30.5% 10%-50% RS Risk Type √ Std-50 49.8% 10%-50% RS Risk Type √ Std-100 99.5% ≥50% RR dominance √

[0146] Conclusion: The kit can accurately distinguish the frequency of drug resistance alleles in three populations: SS, RS risk type, and RR dominant type.

[0147] Example 4: Stability and applicability of insect egg population sample detection

[0148] 4.1 Isolation of insect eggs and extraction of DNA

[0149] Fecal samples were collected from sheep artificially infected with Haemonchus contortus. The eggs were separated by the saturated sucrose flotation method: feces and saturated sucrose solution (specific gravity 1.18) were mixed at a ratio of 1:10 and filtered through gauze; the eggs were collected by centrifugation (500×g, 5 min); the eggs were washed three times with sterile physiological saline and counted under a microscope.

[0150] DNA extraction: Use the QIAamp DNA Mini Kit (QIAGEN) according to the instructions. Each sample contains 100±10 eggs.

[0151] 4.2 Performance of Detection of Egg Population Samples

[0152] Three adult worms of known individual genotypes (SS, RS, and RR) were infected into experimental animals, and the eggs were collected and mixed to prepare the following simulated populations:

[0153] Pop-A 10 0 0 0% 0.5±0.3% Pop-B 8 2 0 10% 9.8±0.7% Pop-C 5 5 0 25% 24.2±1.5% Pop-D 0 10 0 50% 48.6±2.1% Pop-E 0 0 10 100% 99.2±0.8%

[0154] Conclusion: The results of the insect egg population detection were highly consistent with the theoretical expectations (relative deviation <5%), proving that the insect egg population sample can represent the population genetic structure.

[0155] 4.3 Precision of detection for different numbers of insect eggs

[0156] Using Pop-C (25% theoretical proportion) as a model, the detection stability for different numbers of insect eggs was compared:

[0157] 10 23.1±5.8% 25.1% 50 24.5±2.2% 9.0% 100 24.8±1.5% 6.0% 200 25.0±1.1% 4.4%

[0158] Judgment criteria: Each sample must contain ≥100 eggs to ensure CV% <10%.

[0159] Example 5: Comparison with AS-PCR method

[0160] 5.1 Comparison Method

[0161] The AS-PCR method reported in the literature (Kwa MS, et al. Molecular and Biochemical Parasitology, 1994, 63(1): 299-303; Silvestre A, Cabaret J. Molecular and Biochemical Parasitology, 2002, 120(2): 297-300.) was used to detect the F200Y site. The 3' end of the AS-PCR primers was designed at the mutation site, and only mutant templates could be amplified.

[0162] 5.2 Comparison Results

[0163] Parallel testing using a series of standard templates (Std-0, Std-10, Std-30, Std-50, Std-100):

[0164] Std-0 0% 0.3% (SS) Negative (SS) Std-10 10% 10.2% (RS risk type) Negative (misclassified as SS) Std-30 30% 30.5% (RS risk type) Weak positive (cannot be classified) Std-50 50% 49.8% (RS risk type) Positive (cannot distinguish between RS / RR) Std-100 100% 99.5% (RR dominance) Positive (RR)

[0165] Key differences:

[0166] AS-PCR showed false negatives at Std-10 (10% mutation), potentially missing early drug resistance risks.

[0167] AS-PCR cannot distinguish between RS and RR, thus losing information about the drug resistance stage;

[0168] This kit provides accurate quantification within the range of 10%-100% and can identify RS risk stages.

[0169] Example 6: Field Sample Validation and Clinical Applicability

[0170] 6.1 Sample Source

[0171] Fecal samples were collected from five sheep farms (farm A, farm B, farm C, farm D, and farm E) in Xinjiang and Inner Mongolia. Fecal samples from 20 infected animals were randomly collected from each farm and mixed into one population sample, for a total of five field samples.

[0172] 6.2 Reagent Kit Detection

[0173] The eggs were isolated according to the method in Example 4, and the DNA was extracted and the F200Y site was detected using this kit.

[0174] Field A 105 28.3 3.2% SS D Field 98 28.5 15.3% RS Risk Type B Field 112 27.8 35.6% RS Risk Type (Early Warning Range) E field 103 28.0 47.8% RS Risk Type (Early Warning Range) C Field 98 29.1 78.4% RR dominance

[0175] 6.3 Correlation Verification with FECRT

[0176] Five farms were treated with benzimidazole drugs (albendazole, 10 mg / kg), and FECRT assessment was performed 14 days later:

[0177] Field A SS 2,350 45 98.1% efficient D Field RS risk type (15.3%) 2,410 120 95.0% Effective Critical B Field RS risk type (35.6%) 2,680 420 84.3% Suspicious / Drug-resistant E field RS risk type (47.8%) 2,905 635 78.1% Drug resistance C Field RR dominance 3,120 2,890 7.4% Drug resistance

[0178] Conclusion: The kit's SS (Supervisory Sensitivity) criterion corresponds to FECRT efficacy (>95%); in the RS (Risk Sensitivity) criterion, <20% (Field D) is still close to the efficacy threshold (95.0%), while 20%-50% (Fields B and E) corresponds to FECRT suspicion to resistance (84.3%-78.1%); the RR (Resistant Sensitivity) criterion corresponds to FECRT resistance (<90%). Molecular determination and phenotypic efficacy are highly consistent.

[0179] 6.4 Stratified Validation of the 20%-50% Early Warning Interval

[0180] Within the RS risk stratum (10%-50%), compare clinical outcomes across different proportion ranges:

[0181] D Field 15.3% <20% (General RS risk) 95.0% As the effective boundary approaches, enhanced monitoring is needed. B Field 35.6% 20%-50% (Early Warning) 84.3% The efficacy of the medication has significantly decreased; intervention is recommended. E field 47.8% 20%-50% (Early Warning) 78.1% It is approaching drug resistance and requires immediate intervention.

[0182] Conclusion: Within the RS risk stratum, 20% can be used as the dividing line between general risk and key early warning. When the proportion reaches 20%-50%, the FECRT reduction rate is significantly lower than the 95% effective threshold (84.3%-78.1%), indicating that the population is in a stage of rapid drug resistance spread, with a clear urgency for intervention. This result supports considering 20%-50% as the early warning range requiring priority attention within the RS risk stratum.

[0183] Example 7: Verification of Internal Reference Quality Control Function

[0184] 7.1 Species-specific verification

[0185] Genomic DNA was extracted from the following insect species and detected using the internal control detection system of this kit:

[0186] Haemonchus contortus HC-1 25.3±1.2 Positive Haemonchus placei HP-1 No amplification Negative Trichostrongylus colubriformis TC-1 No amplification Negative Ostertagia ostertagi OO-1 No amplification Negative Oesophagostomum columbianum OC-1 No amplification Negative Haemonchus contortus (mixed sample) HC-Mix 26.8±0.9 Positive

[0187] Conclusion: The internal control detection system is species-specific for Haemonchus contortus.

[0188] 7.2 Template Quality Threshold Validation

[0189] Using a population of Haematococcus contortus eggs as a model, a series of degraded DNA samples were prepared by sonication. The relationship between the internal control Ct value and the detection rate of β-tubulin resistance sites was evaluated, and the quality control threshold was determined.

[0190] 0s 26.5 100% qualified 30s 29.8 95% qualified 60s 33.5 60% Unqualified 120s 37.2 15% Unqualified

[0191] Judgment criteria: When the internal reference Ct value is ≤32, the detection rate of β-tubulin is ≥90%; when the internal reference Ct value is >32, the detection rate of β-tubulin drops significantly to below 60%, and the risk of false negatives increases sharply.

[0192] Conclusion: The internal control Ct value ≤32 is experimentally supported as the qualified threshold for DNA extraction quality and can effectively eliminate false negative results caused by template degradation or extraction failure.

[0193] Example 8: Performance Validation of E198A Site Detection

[0194] 8.1 Establishment of Standard Curve and Linear Range

[0195] Using the E198A site series of standard templates (Std-0 to Std-100) as the detection targets, each template was replicated three times to establish a dual-channel fluorescent PCR standard curve.

[0196] Std-0 0% 0.4±0.3% — — Std-10 10% 9.8±0.9% -2.0% 9.2% Std-20 20% 20.3±1.2% 1.5% 5.9% Std-30 30% 29.6±1.4% -1.3% 4.7% Std-50 50% 49.5±1.4% -1.0% 2.8% Std-75 75% 74.8±1.9% -0.3% 2.5% Std-100 100% 99.2±0.6% -0.8% 0.6%

[0197] Standard curve equation: Ct = -3.298 × log 10 (Copy number) + 39.8 (mutant); Ct = -3.315 × log 10 (Copy number) + 40.1 (wild type). Amplification efficiency: mutant 100.2%, wild type 100.5%, difference 0.3% (<5%). Linear correlation coefficient R 2 =0.998.

[0198] Conclusion: The detection performance of the E198A site is comparable to that of the F200Y site, with good linearity in the range of 10%-100%, and accurate and reliable quantification.

[0199] 8.2 Low-proportion detection capability verification

[0200] Standard templates with 5%, 10%, and 15% mutation rates at the E198A site were prepared, and the assay was repeated 20 times.

[0201] 0% 0 / 20 0.3±0.2% — benchmark 5% 19 / 20 5.1±1.5% 29.4% Partial overlap 10% 20 / 20 10.3±0.9% 8.7% Complete distinction 15% 20 / 20 14.6±1.1% 7.5% Complete distinction

[0202] Conclusion: The LOD of the E198A site is 5%, and the LOQ is 10%, which is consistent with the detection limit of the F200Y site.

[0203] Example 9: Standard Template Interchangeability Verification

[0204] 9.1 Comparison of plasmid standard curve and genomic DNA standard curve

[0205] Standard curves for the E198A site were established using recombinant plasmid standard templates and genomic DNA extracted from insect eggs, respectively, and quantitative results of the same simulated population samples were compared.

[0206] Pop-A 0% 0.5% 0.8% 0.3% — Pop-B 10% 9.8% 10.2% 0.4% 4.1% Pop-C 25% 24.2% 25.1% 0.9% 3.7% Pop-D 50% 48.6% 49.3% 0.7% 1.4% Pop-E 100% 99.2% 99.5% 0.3% 0.3%

[0207] Conclusion: The absolute deviation of the quantitative results of the two standard curves is <1%, and the relative deviation is <5%. The plasmid standard template can be used for reliable quantitative calibration of insect egg population samples.

[0208] 9.2 Inter-batch precision verification

[0209] Batch-to-batch reproducibility was evaluated using Std-50 standard templates prepared in three independent batches:

[0210] Lot-1 49.2%, 50.1%, 48.8%, 49.5%, 50.3% 49.6±0.6% 1.2% Lot-2 50.2%, 49.6%, 48.9%, 50.5%, 49.8% 49.8±0.6% 1.2% Lot-3 49.5%, 50.3%, 49.1%, 50.0%, 49.7% 49.7±0.5% 1.0% Batch merging — 49.7±0.6% 1.2%

[0211] Conclusion: The batch-to-batch CV% of the standard template is <2%, demonstrating good production stability and detection reproducibility. Comparative Example 1: Fluorescence signal ratio method without standard curve correction.

[0212] The standard templates from Std-10 to Std-75 were detected according to the reaction system of this kit, but no standard curve was established. The ratio of HEX signal intensity to FAM signal intensity was calculated directly as shown in the table below:

[0213] Std-10 10% 4.2% -58% Std-30 30% 18.5% -38% Std-50 50% 35.2% -30% Std-75 75% 58.6% -22%

[0214] Conclusion: The signal intensity ratio systematically underestimates the proportion of abrupt changes (deviation 22%-58%), and cannot be used for accurate quantification. This demonstrates the necessity of copy number correction for the standard curve.

[0215] Comparative Example 2: Testing without internal control parameters

[0216] We used field samples of poor quality (internal reference Ct=38.5, exceeding the quality control threshold) for testing:

[0217] Internal Reference ITS2 Weak positive (Ct=38.5) F200Y Wild Type Negative F200Y mutant Negative

[0218] Risk of misjudgment: Without internal control, the sample may be identified as "Haemaphysalis non-contortionus infection" or "SS type", but it is actually a false negative caused by DNA degradation.

[0219] This kit specifies that if the internal control Ct > 32, the sample is deemed unqualified and requires re-extraction. This demonstrates the necessity of internal control quality control.

[0220] Comparative Example 3: Single Egg Detection vs. Population Detection

[0221] Using RS heterozygous adults (individual genotype, theoretical mutation rate 50%) as a model, the results of single eggs and egg population tests are shown in the table below:

[0222] single egg 20 eggs were tested separately. 0%-100% great Mixing 10 eggs 2 copies 35%-65% 30.2% 100 eggs mixed 2 copies 48%-52% 4.1%

[0223] Conclusion: Single-egg detection results are extremely volatile (0% or 100%) due to random segregation during meiosis, failing to reflect the true state of the population. This demonstrates the necessity of mixed detection of egg populations.

[0224] In Comparative Example 1, the signal ratio method without standard curve correction systematically underestimated the mutation rate by 22%-58%; Examples 2 and 8 achieved deviations of <5% and CV% <10% within the range of 10%-100% through standard curve copy number correction.

[0225] Examples 2, 3, and 8 reduce LOD to 5% and LOQ to 10%, which can stably identify early drug resistance risks.

[0226] In Comparative Example 2, the degraded samples without internal control were easily misjudged as negative; Example 7 effectively eliminated false negatives by verifying the species specificity of the ITS2 internal control and the Ct≤32 quality control threshold.

[0227] In Comparative Example 3, the detection results of single insect eggs showed extreme fluctuations (0%-100%); in Example 4, the detection of a population of ≥100 insect eggs showed a CV% <6%, which stably reflected the genetic structure of the population.

[0228] Example 6 demonstrates that the molecular determination is consistent with the FECRT gold standard (SS efficacy rate 98.1%, RR resistance 7.4%), and the detection time is 2.5 hours, which shifts the assessment time point from 14 days after medication to before medication, providing a window for early intervention.

[0229] In summary, the kit of this invention solves the key bottlenecks of existing technologies in four dimensions: early drug resistance identification, quantitative accuracy, sample applicability, and clinical timeliness through the integration of technologies such as "egg population sampling - dual-channel quantitative detection - standard curve correction - three-level risk typing - internal reference quality control assurance". It provides a standardized molecular tool for population monitoring and precise control of benzimidazole resistance in Haemaphys contortus.

[0230] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A kit for detecting benzimidazole resistance in Haemonchus contortus, characterized in that, include: (1) β-tubulin resistance allele detection component, including: mutant-specific amplification primers and mutant detection probes for benzimidazole resistance-related mutation sites in the β-tubulin gene of Haemaphysema contortus; and wild-type-specific amplification primers and wild-type detection probes for the wild-type sequence corresponding to the mutation sites; The mutant detection probe and the wild-type detection probe carry different fluorescent labels to distinguish mutant alleles and wild-type alleles in the same detection system. (2) Insect species and template quality control components, including: Internal reference detection primers and probes for amplifying specific conserved sequences of Haemonchus contortus. Used to confirm the source of the template to be tested and to evaluate the quality of DNA extraction; (3) Allele ratio calibration component, including: A series of standard templates formed by mixing β-tubulin mutant templates and wild-type templates in known proportions; Used to establish a calibration relationship between the proportion of mutant alleles and the amplification detection signal; (4) PCR amplification reaction components, including: DNA polymerase, dNTP mixture, buffer, magnesium ions and nucleic acid stabilizer; (5) Detection result determination component, wherein the kit detects the proportion of β-tubulin mutant alleles in the egg population sample and determines the benzimidazole resistance risk status of Haemaphys contortus according to the preset determination criteria.

2. The kit for detecting benzimidazole resistance in Haemonchus contortus according to claim 1, characterized in that, The benzimidazole resistance-related mutation sites in the β-tubulin gene include one or more of the following: F200Y mutation site, F167Y mutation site, and E198A mutation site.

3. The kit for detecting benzimidazole resistance in Haemonchus contortus according to claim 1, characterized in that, The mutant detection probe and the wild-type detection probe are labeled with different fluorescent reporter groups; the mutant detection signal and the wild-type detection signal are simultaneously acquired by dual-channel real-time fluorescent PCR.

4. The kit for detecting benzimidazole resistance in Haemonchus contortus according to claim 1, characterized in that, The allele ratio calibration component includes a series of standard templates formed by mixing β-tubulin wild-type template and drug-resistant mutant template at different copy number ratios, which are used to establish a calibration model between the drug-resistant mutant allele ratio and the real-time fluorescent PCR detection signal. The proportions of mutant alleles in the series of standard templates include: 0%, 10%, 20%, 30%, 50%, 75%, and 100%.

5. The kit for detecting benzimidazole resistance in Haemonchus contortus according to claim 1, characterized in that, The proportion of mutant alleles was obtained by establishing the correspondence between the amplification cycle threshold and the template copy number based on the mutant standard template and the wild-type standard template, respectively. The proportion of mutant alleles is calculated based on the copy number of mutant and wild-type templates in the sample to be tested: Mutant allele ratio = Mutant template copy number / (Mutant template copy number + Wild-type template copy number) × 100%.

6. The kit for detecting benzimidazole resistance in Haemonchus contortus according to claim 1, characterized in that, The drug resistance risk status includes: (1) If the proportion of mutated alleles is <10%, it is determined to be a susceptible SS type; (2) If the proportion of mutated alleles is less than 50%, it is determined to be a heterozygous drug-resistant RS; (3) If the proportion of mutant alleles is ≥50%, it is determined to be the drug-resistant dominant type RR.

7. A method of using a kit for detecting benzimidazole resistance in Haemonchus contortus as described in any one of claims 1 to 6, characterized in that, Includes the following steps: (1) Collect samples of the egg population of Haemonchus contortus to be tested and extract genomic DNA; (2) The internal reference sequence was detected using insect species and template quality control components to confirm the sample source and evaluate the quality of the DNA template; (3) Using the β-tubulin resistance allele detection kit, mutant alleles and wild-type alleles were amplified in the same PCR reaction system, respectively; (4) Establish the correspondence between amplification signals and mutation ratios using the allele ratio calibration component; (5) Calculate the proportion of mutant alleles in the sample of the insect egg population to be tested; (6) Determine the benzimidazole resistance risk status based on the proportion of the mutant alleles.

8. The method of using the kit for detecting benzimidazole resistance in Haemonchus contortus according to claim 7, characterized in that, The sample to be tested is a mixed sample of Haemaphyseudomonas contortus eggs from the same infected animal or farmed population.

9. The method of using the kit for detecting benzimidazole resistance in Haemonchus contortus according to claim 7, characterized in that, When the proportion of mutated alleles detected reaches 20% to 50%, the population to be tested is identified as being in an early warning state of benzimidazole resistance.

10. The method of using the kit for detecting benzimidazole resistance in Haemonchus contortus according to claim 7, characterized in that, The test results are used to assess the drug resistance risk of the tested population before implementing benzimidazole drug control, so as to guide drug rotation or adjustment of control programs.

Images