RPA primers, probes, kits for detecting Pectobacterium actinidiae (Pa) and their applications

Abstract

This invention discloses RPA primers and probes, a kit, and their applications and detection methods for *Pectobacterium actinidiae* (Pa), belonging to the field of biodetection technology. The kit is an RPA-LFD kit, including primers RP-Pa-F5 and RP-Pa-R5-Biotin, and probe RP5t, whose 5' end is labeled with carboxyfluorescein (FAM) and whose 3' end has an extension blocking group C3Spacer. This RPA detection method for *Pectobacterium actinidiae* Pa exhibits high specificity, high sensitivity, high reproducibility, and rapid reaction speed. It requires simple equipment and conditions, making it particularly suitable for rapid diagnosis and port inspection and quarantine of this disease.

Description

Technical Field

[0001] This invention relates to the field of detection technology for Pectobacterium actinidiae (Pa), and particularly to an RPA primer, probe, kit, and detection method for rapid detection of Pectobacterium actinidiae at room temperature. Background Technology

[0002] Kiwifruit (Actinidia spp.) originated in China and has significant economic value worldwide. However, in recent years, bacterial canker caused by *Actinidia kiwifruit* has been reported globally, with symptoms remarkably similar to those caused by *Pseudomonas syringae* pv. *actinidiae*. Reported in my country in 2017, this pathogen primarily causes the disease in spring and summer. Typical symptoms include red exudate on infected branches and trunks, with stems gradually turning brown and dying. Infected leaves develop brown necrotic spots, wilt, and rapidly wither and die. Fruit softens and easily falls off; severe outbreaks can lead to death, posing significant challenges to control. This disease, characterized by its latent nature, rapid spread, wide distribution, and difficulty in prevention and control, has become a major devastating disease for the kiwifruit industry, impacting production and development and causing severe economic losses. Therefore, it is especially important to conduct regular testing for kiwifruit canker and take preventative measures in advance.

[0003] Traditional identification methods rely on pathogen isolation and morphological differences, requiring highly specialized knowledge and experience from laboratory personnel, and are time-consuming with low accuracy. While PCR combined with nucleic acid sequencing is currently the primary method for pathogen identification, it is time-consuming and unsuitable for on-site, immediate detection and rapid diagnosis. Quantitative real-time PCR (qPCR) can rapidly and accurately identify certain pathogens, but requires expensive equipment and highly skilled personnel. In recent years, the widespread adoption of recombinase polymerase amplification (RPA) technology has shown great potential for detecting various pathogens. Compared to PCR, it does not require complex temperature variations, achieving amplification within a specific temperature range of 36℃-42℃, thus reducing equipment dependence. Simultaneously, it retains the common characteristics of molecular detection methods such as high sensitivity and specificity. Summary of the Invention

[0004] The purpose of this invention is to provide RPA primers, probes, kits and detection methods for detecting Actinobacillus pectinophilus Pa in kiwifruit. The reaction time is short and the detection can be completed under constant temperature conditions of 25-45℃. It has the advantages of good flexibility and strong practicality.

[0005] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0006] Using a specific DNA fragment of *Actinidia kiwifruit* as the target, primers and probes were designed according to the RPA kit instructions. The designed primers included a pair of specific primers, RP-Pa-F5 and RP-Pa-R5-Biotin, and the designed probe was RP5t. The reaction system is shown in Table 1. After the RPA reaction system was mixed, it was reacted in a 38℃ water bath for 12 min. After the reaction, the reaction product was diluted 10-fold, and 80 μL of the diluted reaction product was dropped into the sample well. The detection results were recorded within 5 min.

[0007] Table 1. RPA System

[0008]

[0009] The specific DNA fragment of *Actinidia kiwifruit* is as follows:

[0010] TTCAGCAGGCATGGCAGCGACGGCTTCAAACCTCAGCTTCAAATCATCTTCCGGCTCAC

[0011] ATTCACCGGGTTCAAACAGCAGAAAATCAGATGAAACATGCAGCACAATGGTGAGCTTC

[0012] TTTAAGGCCTCGGCGGTAGGCTGTGAGCTACCGGCTTCGTAGCGTTTAATCTGTTGTACA

[0013] TGGATACCGGTGGCGTCAGAGAGGCTTTGTTGTGTCAAACCCGTGATCTGCATCCCGGTCAT.

[0014] Primer and probe sequences 5'→3':

[0015] RP-Pa-F5:

[0016] TTCAGCAGGCATGGCAGCGACGGCTTCAAACCT;

[0017] RP-Pa-R5-Biotin:

[0018] Biotin-ATGACCGGGATGCAGATCACGGGTTTGACACAAC;

[0019] RP5t:

[0020] FAM-GTACAACAGATTAAACGCTACGAAGCCGGTAGCTC-dSpacer-ACAGCCTACCGCCG A-C3spacer.

[0021] The RPA kit includes a lateral flow chromatography test strip. Compared with the prior art, the present invention has the following advantages: by screening for specific fragments of *Actinidia kiwifruit*, primers are designed according to the RPA kit instructions, and the designed primers are used to screen for sensitivity and specificity, ultimately obtaining a set of primers with high sensitivity and specificity, in order to provide technical support for rapid field detection of *Actinidia kiwifruit*. Attached Figure Description

[0022] Figure 1 This is an agarose gel electrophoresis image showing the specific detection of Pectinobacterium Pa using RPA primers according to the present invention.

[0023] Figure 2 This is a diagram showing the results of the RPA primer-specific test strip for Pectinobacterium Pa of the present invention;

[0024] Figure 3 This is a diagram showing the results of the RPA primer sensitivity test strip for Actinobacillus pectinophilus Pa of this invention; Detailed Implementation

[0025] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0026] Example 1: Extraction of genomic DNA from Actinobacillus kiwifruit Pa and other bacteria required for the experiment

[0027] (1) Activation of the required pathogenic fungi

[0028] Remove the cryovials of the pathogenic fungi required for the experiment from the -80℃ freezer, activate them on LB culture dishes, and incubate at 28℃ for 1 day. Use an inoculation loop to pick up a single colony from the culture dish and inoculate it into a test tube containing 5 mL of LB medium, and incubate overnight at 28℃ on a shaker at 200 rpm.

[0029] (2) Extraction of pathogen genomic DNA

[0030] Take 4 mL of bacterial culture medium, centrifuge at 12000 rpm for 1 min, and wash away the supernatant as much as possible. Add 200 μL of buffer GA to the bacterial pellet, vortex until the bacterial solution is completely resuspended, add 20 μL of Proteinase K solution to the tube, and mix well. Add 220 μL of buffer GB, vortex for 15 s, incubate at 70°C for 10 min, and centrifuge to remove water droplets from the inner wall. Add 220 μL of anhydrous ethanol, vortex thoroughly for 15 s; flocculent precipitate may form at this point, centrifuge to remove water droplets from the inner wall. Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, centrifuge at 12000 rpm for 30 s, discard the waste liquid, and place the adsorption column CB3 into a collection tube. Add 500 μL of buffer GD to the adsorption column CB3 (check that ethanol has been added before use), centrifuge at 12000 rpm for 30 s, discard the waste liquid, and place the adsorption column CB3 into a collection tube. Add 600 μL of wash buffer PW to the adsorption column CB3 (check that ethanol has been added before use), centrifuge at 12000 rpm for 30 s, discard the waste liquid, and transfer the adsorption column CB3 to a collection tube. Then repeat the previous step. Place the adsorption column CB3 in a collection tube, centrifuge at 12000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to dry any remaining wash buffer in the adsorption material. Transfer the adsorption column CB3 to a clean centrifuge tube, add 50 μL of ddH2O at 65℃ dropwise to the center of the adsorption membrane, incubate at room temperature for 5 min, centrifuge at 12000 rpm for 2 min, collect the solution in a centrifuge tube, measure its concentration, and store it at -20℃. The pathogenic bacteria from which genomic DNA was extracted are shown in Table 1.

[0031] Example 2: Screening and Validation of Pa-Specific RPA Primers for Actinobacillus kiwifruit

[0032] (1) Screening of specific fragments of Actinobacter kiwifruit pectinobacter

[0033] The genome sequences of *Actinidia kiwifruit* and the selected pathogenic bacteria were downloaded from the NCBI website. Comparative genomics analysis was used to screen for species-specific genes within *Actinidia kiwifruit* (https: / / orthovenn3.bioinfotoolkits.net / home). Differentially related gene fragments were compared using the NCBI website. Ultimately, six gene fragments showed no similarity in the sequence alignment results. These nine sequences (WP_006326554.1, WP_010448993.1, WP_006326554.1, WP_005968412.1, WP_011147857.1, WP_011147857.1, WP_013023785.1, WP_001401944.1, and WP_019844824.1) were selected for primer design.

[0034] (2) Design of RPA-specific primers

[0035] Primers were designed according to the primer design requirements in the RPA kit instructions. Primers were designed upstream and downstream of the target fragment, and different primer pairs were screened. The primers designed using the WP_011147857.1 fragment were finally selected. The pathogenic bacteria detected in the experiment are shown in Table 2, and the specificity screening results are shown in the appendix. Figure 1 (Results of agarose gel electrophoresis) and attached Figure 2 (Results of side-flow chromatography test strips)

[0036] Example 3: Specificity verification of *Actinidia kiwifruit* RPA primers

[0037] By performing specific detection of the genomes of different test bacteria using RPA primers, it was found that only *Actinidia kiwifruit* could be detected. The specificity was high; the results are shown in Table 2.

[0038] Table 2. RPA Specificity Detection

[0039]

[0040]

[0041] Example 4: Sensitivity verification of *Actinidia kiwifruit* RPA primers

[0042] Overnight cultured *Actinidia kiwifruit* Pectinobacterium var. kiwifruit* was serially diluted (Pa), with each dilution spread onto three plates. The number of single colonies on each plate was used to calculate the detection concentration. Sensitivity was validated using the screened specific primers, with the concentration gradients shown in Table 3. The experiments verified that the lowest detection concentration using the screened RPA-specific primers was 3.3 × 10⁻⁶. 2 CFU / mL, sensitivity detection results for RPA primers are shown in the appendix. Figure 3 (Results of side-flow chromatography test strips)

[0043] Table 3. RPA Sensitivity Detection

[0044]

[0045] The above description is merely a preferred embodiment of the present invention. The scope of protection of the present invention is not limited to the above embodiments. All technical solutions falling within the scope of the present invention's concept are within the scope of protection of the present invention. It should be noted that for those skilled in the art, any improvements and modifications made without departing from the principle of the present invention should also be considered within the scope of protection of this template. An embodiment of the present invention has been described in detail above, but the content is only a preferred embodiment of the present invention and should not be considered as limiting the scope of the present invention. All equivalent changes and improvements made within the scope of the present invention should fall within the patent coverage of the present invention.

Claims

1. A rapid isothermal detection method and primers for *Pectobacterium actinidiae* (Pa) at room temperature, characterized in that the upstream and downstream primer and probe sequences are as follows: Upstream primer RP-Pa-F5: TTCAGCAGGCATGGCAGCGACGGCTTCAAACCT; Downstream primer RP-Pa-R5-Biotin: Biotin-ATGACCGGGATGCAGATCACGGGTTTGACACAAC; Probe RP5t: FAM-GTACAACAGATTAAACGCTACGAAGCCGGTAGCTC-dSpacer-ACAGCCTACCGCCGA-C3spacer.

2. A kit for detecting Actinobacillus pectinophilus Pa in kiwifruit, characterized in that: The kit is an RPA-LFD kit, comprising the RPA primers and probes as described in claim 1.

3. According to the primers and probes described in claim 1, the RPA reaction system for Actinobacillus kiwifruit Pa consists of 29.4 μL of buffer A, 2.5 μL of buffer B, 2 μL each of 10 μM RP-Pa-F5 and RP-Pa-R5-Biotin primers, 0.6 μL of 10 μM probe RP5t, and 2 μL of Actinobacillus kiwifruit genomic DNA template, mixed and then ddH2O is added to bring the total volume to 50 μL to obtain the RPA reaction system.

4. The RPA reaction system according to claim 3, the subsequent detection method includes the following steps: After the RPA reaction system is mixed, it is reacted in a constant temperature water bath at 38℃ for 12 min. After the reaction is completed, the reaction product is diluted 20 times, and 80 μL of the diluted reaction product is dropped into the sample well. The detection results are recorded within 5 min.

5. The RPA detection method according to claim 4, wherein the identification result is judged as follows: when both the control line (blue) and the test line (red) appear, it indicates that the test sample contains Actinobacillus kiwifruit Pa; when the control line (blue) appears but the test line (red) does not appear, it indicates that the concentration of Actinobacillus kiwifruit Pa in the test sample is lower than the upper limit of RPA sensitivity; when no control line (blue) appears, it indicates that the data is unreliable.

6. The rapid detection method for RPA of Actinobacillus pectinophilus Pa according to claim 4, characterized in that, The pathogen is Actinobacillus kiwifruit.

Images