A detection system based on crisper / cas12a and metal-enhanced fluorescence effect and application thereof in detection of foodborne pathogenic bacteria

Abstract

This invention discloses a detection system based on CRISPR / Cas12a and metal-enhanced fluorescence effect and its application in the detection of foodborne pathogens, belonging to the field of foodborne pathogen analysis and detection technology. This invention uses a SiO2 coating to control the distance between metal particles and fluorescent groups to 7 nm, and combines this with CRISPR / Cas12a technology for the detection of Salmonella typhimurium, achieving high sensitivity (10⁻¹⁰) without amplification. 1 CFU·mL ‑1 The technical effectiveness of the detection.

Description

Technical Field

[0001] This invention belongs to the field of foodborne pathogen analysis and detection technology, specifically relating to a detection system based on CRISPR / Cas12a and metal-enhanced fluorescence effect and its application in detecting foodborne pathogens. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Salmonella is one of the leading causes of foodborne illnesses worldwide. It is a Gram-negative bacterium with over 2,500 serotypes identified, capable of contaminating various foods such as meat, raw vegetables, dairy products, fruits, and eggs. Among the many Salmonella serotypes, *Salmonella typhimurium* has the highest incidence rate. After infection, *Salmonella typhimurium* secretes various toxins, including endotoxins and enterotoxins, leading to gastroenteritis, sepsis, and other illnesses. Furthermore, *Salmonella typhimurium* has a high survival rate and requires extremely low infectious doses; even 1 CFU in food can cause infection in humans. Most countries require a negative test result for *Salmonella typhimurium* in food. Therefore, developing more sensitive and convenient detection methods for *Salmonella typhimurium* is of great significance for ensuring food safety.

[0004] In recent years, CRISPR / Cas12a has emerged as a novel detection method for detecting pathogens in food. However, the sensitivity of CRISPR / Cas12a systems alone is relatively low, and Cas12a is susceptible to the influence of food matrices, thus limiting its detection sensitivity. Therefore, CRISPR / Cas12a systems are often used in conjunction with nucleic acid amplification technology, but amplification increases detection time and cost, making it unsuitable for large-scale on-site testing.

[0005] Therefore, how to provide a new detection method for Salmonella Typhimurium to achieve amplification-free and highly sensitive detection is an urgent technical problem to be solved. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to provide a detection system based on CRISPR / Cas12a and metal-enhanced fluorescence effect and its application in the detection of foodborne pathogens. The system employs a SiO2 coating to control the distance (5-10 nm) between metal particles and fluorescent groups, and combines it with CRISPR / Cas12a technology for the detection of Salmonella typhimurium, thereby achieving a lower detection limit and reducing costs.

[0007] Metal-enhanced fluorescence (MEF) refers to the phenomenon where the fluorescence intensity of fluorophores near the surface of metal nanoparticles is enhanced compared to their free-state fluorescence intensity. When the distance between the metal nanoparticle and the fluorophore is greater than 5 nm, the fluorescence signal of the fluorophore can be enhanced, aiding fluorescence detection. When the distance is less than 5 nm, the metal nanoparticle quenches the fluorescence signal of the fluorophore. When the distance is greater than 10 nm, the fluorescence enhancement effect weakens accordingly. The schematic diagram of the detection method of this invention is shown below. Figure 1 First, SiO2 was coated onto the surface of AuNPs, with the distance between the AuNPs and the fluorescent group controlled to 7 nm by adjusting the SiO2 layer thickness. Then, the fluorescent group FAM, ssDNA, and the quencher group BHQ were sequentially linked onto the SiO2 layer to prepare the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ. When this probe was added to a CRISPR / Cas12a detection system, the system emitted fluorescence in the presence of Salmonella typhimurium. Due to the MEF effect, the fluorescence signal caused by the trans-cleavage activity was significantly higher than that of the ordinary FAM fluorescent group. Furthermore, this invention uses multiple crRNAs in the CRISPR / Cas12a system, which can activate more Cas12a trans-cleavage functions, thereby cleaving more fluorescent probes and further enhancing the fluorescence signal, thus improving detection sensitivity.

[0008] To achieve the above objectives, the technical solution of the present invention is as follows:

[0009] In a first aspect, the present invention provides a detection system for CRISPR / Cas12a and metal-enhanced fluorescence effect, wherein the metal-enhanced fluorescence effect is a metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ, and the detection system is composed of the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ and CRISPR / Cas12a.

[0010] The metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ is prepared by coating AuNPs with SiO2, then linking them with ssDNA, so that the fluorescent group FAM and the quenching group BHQ are sequentially linked on the SiO2 layer.

[0011] AuNPs@SiO2-FAM-BHQ.

[0012] In one or more embodiments, the SiO2 layer has a thickness of 5-10 nm. The distance between the metal particles and the fluorescent group is controlled to 5-10 nm by encapsulating the SiO2 coating, and this is combined with CRISPR / Cas12a technology for the detection of Salmonella typhimurium.

[0013] In one or more embodiments, the specific steps for preparing the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ include:

[0014] (1) AuNPs solution was prepared by citric acid reduction method, and amino groups were bound to the surface of AuNPs to obtain aminated AuNPs solution;

[0015] (2) Active SiO2 polymerizes into a SiO2 layer on the surface of aminated AuNPs;

[0016] (3) Increase the thickness of the SiO2 layer to obtain AuNPs@SiO2;

[0017] (4) Amination of AuNPs@SiO2;

[0018] (5) The metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ was prepared by linking the amination AuNPs@SiO2 to ssDNA.

[0019] In one or more embodiments, in step (1), the average particle size of the gold nanoparticles (AuNPs) is between 10-30 nm. The specific preparation method of the citric acid reduction method is as follows: Chloroauric acid solution is diluted with water to 100 ml, heated at 250-300 °C, and continuously stirred until the solution boils. After boiling, time for 2-4 minutes, then rapidly add sodium citrate solution all at once, continuing heating and stirring until the solution turns a clear, bright wine-red color. After the wine-red color stabilizes, continue heating and stirring for 5-15 minutes. Then stop heating and allow the solution to cool naturally to room temperature. The cooled solution is the AuNPs solution. The concentration of the chloroauric acid solution is 0.5-2%, and the concentration of the sodium citrate solution is 0.5-2%. The volume ratio of the chloroauric acid solution to the sodium citrate solution is 1:2-4.

[0020] In one or more embodiments, the specific steps of obtaining an aminated AuNPs solution by binding the amino group to the AuNPs surface in step (1) are as follows:

[0021] Under stirring conditions, a solution of (3-aminopropyl)trimethoxysilane (APS) was added to the AuNPs solution and allowed to stand to ensure that the amino groups were bound to the AuNPs surface, thus obtaining an aminated AuNPs solution.

[0022] Furthermore, the stirring conditions are 600-900 rpm·min. -1 .

[0023] Furthermore, the concentration of the (3-aminopropyl)trimethoxysilane solution was 0.5-2 mmol·L⁻¹. -1 Preferably, it is 0.5-1.5 mmol·L⁻¹-1 .

[0024] Furthermore, the volume ratio of (3-aminopropyl)trimethoxysilane solution to AuNPs solution is 1-5 ml: 500 ml.

[0025] Furthermore, the settling time is 10-30 minutes, preferably 10-20 minutes.

[0026] In one or more embodiments, the specific steps of polymerizing the active SiO2 onto the surface of aminated AuNPs to form a SiO2 layer in step (2) are as follows:

[0027] Under stirring conditions, active SiO2 is added to an aminated AuNPs solution, and the mixture is allowed to stand, allowing the surface of the aminated AuNPs to polymerize into a SiO2 layer.

[0028] Furthermore, the stirring conditions are 600-900 rpm·min. -1 .

[0029] Furthermore, in step (2), the thickness of the SiO2 layer is approximately 2-4 nm.

[0030] Furthermore, the concentration of active SiO2 is 0.1-2 g·L⁻¹. -1 Preferably 0.5-1 g·L -1 .

[0031] The volume ratio of active SiO2 to aminated AuNPs solution is 10-20:400-600.

[0032] Furthermore, the settling time is 12-36 hours, preferably 22-26 hours.

[0033] In one or more embodiments, in step (3), the thickness of the SiO2 layer is increased by the Stuber method to obtain AuNPs@SiO2, and the specific steps are as follows:

[0034] Under stirring conditions, tetraethoxysilane (TEOS) and ammonia were added to the water / alcohol solution, allowed to stand, and the addition was repeated multiple times until the desired SiO2 shell thickness was achieved.

[0035] Furthermore, the stirring conditions are 100-500 rpm·min. -1 .

[0036] Furthermore, the alcohol is ethanol.

[0037] The volume ratio of water to alcohol solution is 1:3-5.

[0038] The volume ratio of water / alcohol solution, tetraethoxysilane, and ammonia is 400-600 ml: 1-3 μL: 1-3 ml.

[0039] The settling time is 10-14 hours.

[0040] In AuNPs@SiO2, the thickness of the SiO2 layer is 5-10 nm.

[0041] In one or more embodiments, the specific steps of amination of AuNPs@SiO2 in step (4) are as follows:

[0042] Ammonium hydroxide solution was added to the prepared AuNPs@SiO2 solution and allowed to stand. After the reaction was completed, 3-aminopropyltriethoxysilane (APTES) was added and stirred. The mixture was then heated. After the reaction was completed, the mixture was centrifuged and the supernatant was removed to obtain amination-modified AuNPs@SiO2.

[0043] Furthermore, the mass concentration of the ammonium hydroxide solution is 25-30%.

[0044] Furthermore, the volume ratio of AuNPs@SiO2 solution, ammonium hydroxide solution, and 3-aminopropyltriethoxysilane is 1-5 mL: 5-20 mL: 1-3 μL.

[0045] Furthermore, the settling time is 20-60 minutes, preferably 20-40 minutes.

[0046] Furthermore, the reaction is stirred at 20-40°C for 1-5 hours, preferably at 30-40°C for 2-4 hours.

[0047] Furthermore, the mixture is heated to 50-70°C and reacted for 0.5-4 hours, preferably to 60-70°C and reacted for 0.5-1.5 hours.

[0048] Furthermore, the centrifugation conditions were as follows: multiple centrifugations at 8000-15000 rpm.

[0049] In one or more embodiments, in step (5), the amination-treated AuNPs@SiO2 is linked to ssDNA to prepare a metal-enhanced fluorescent probe.

[0050] The specific steps for AuNPs@SiO2-FAM-BHQ are as follows:

[0051] ssDNA was added to aminoated AuNPs@SiO2 and mixed thoroughly. The mixture was then stirred in the dark. After the reaction was completed, the mixture was centrifuged, washed, and the supernatant was removed to obtain the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ.

[0052] Furthermore, the reaction is carried out under dark conditions at 20-40°C for 10-24 hours, preferably under dark conditions at 25-35°C for 10-14 hours.

[0053] Furthermore, the centrifugation conditions were as follows: multiple centrifugations at 8000-15000 rpm.

[0054] Furthermore, the ssDNA sequence has a COOH-modified fluorescent group FAM attached to the 5' end and a quenching group BHQ attached to the 3' end, so the ssDNA sequence is COOH(dTFAM)-TTATT-BHQ1.

[0055] Secondly, the present invention provides an application of the above-mentioned CRISPR / Cas12a detection system with metal-enhanced fluorescence effect in the detection of foodborne pathogens.

[0056] The foodborne pathogens include Salmonella Typhimurium, Listeria monocytogenes, Staphylococcus aureus, and Escherichia coli.

[0057] When detecting foodborne pathogens, simply replace the crRNA with the specific sequence of the target pathogen.

[0058] Thirdly, the present invention provides a non-diagnostic method for detecting foodborne pathogens using the aforementioned CRISPR / Cas12a and metal-enhanced fluorescence detection system, comprising the following steps:

[0059] Buffer, CRISPR / Cas12a, AuNPs@SiO2-FAM-BHQ and crRNA were added to the solution of the foodborne pathogens to be detected, and the reaction was carried out at an isothermal temperature. The fluorescence signal value was then measured.

[0060] In one or more embodiments, the buffer is a nuclear extraction buffer (NE Buffer) with a concentration of 10 × NE Buffer r2.1.

[0061] The concentration of CRISPR / Cas12a is 5-20 μM, preferably 8-12 μM.

[0062] The concentration of AuNPs@SiO2-FAM-BHQ is 1-5 μM, preferably 2-4 μM.

[0063] The concentration of crRNA is 5-20 μM, preferably 8-12 μM.

[0064] The concentration of the foodborne pathogen solution to be tested was 10. 1 -10 8 CFU·mL-1 .

[0065] The volume ratio of buffer, CRISPR / Cas12a, AuNPs@SiO2-FAM-BHQ, crRNA, and the foodborne pathogen solution to be detected is 1-5 μL: 1-5 μL: 6-15 μL: 1-5 μL: 4-10 μL, preferably 1-3 μL: 1-3 μL: 8-12 μL: 1-3 μL: 5-7 μL.

[0066] The conditions for the isothermal reaction are: react at a constant temperature of 25-40℃ for 20-40 minutes.

[0067] crRNA includes one or more of crRNA1, crRNA2, and crRNA3.

[0068] The sequence of crRNA1 is as shown in SEQ ID NO.1, and the sequence of crRNA1 is UAAUUUCUACUAAGUGUAGAUAAGCACAGCCUGAUCUGGCG G.

[0069] The sequence of crRNA2 is shown in SEQ ID NO.2, and the sequence of crRNA2 is UAAUUUCUACUAAGUGUAGAUUGGGGUCGUUCUACAUUGAC.

[0070] The sequence of crRNA3 is shown in SEQ ID NO.3, and the sequence of crRNA3 is UAAUUUCUACUAAGUGUAGAUUGAACUUUAUUGGCGGUAUU U.

[0071] In one or more embodiments, the foodborne pathogens include Salmonella Typhimurium, Listeria monocytogenes, Staphylococcus aureus, and Escherichia coli.

[0072] One or more of the above technical solutions have the following advantages or beneficial effects:

[0073] (1) This invention successfully prepared a novel method for detecting Salmonella typhimurium, namely, using the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ to assist in the detection of Cas12a. The detection can achieve high sensitivity (10) without the need for amplification. 1 CFU·mL -1 This detection method solves the problem that existing technologies have low sensitivity when CRISPR / Cas12a is used alone, and that it needs to be combined with amplification technology for detection.

[0074] (2) The present invention successfully prepared AuNPs@SiO2-FAM-BHQ composite probe with better fluorescence performance, wherein the fluorescence signal of AuNPs@SiO2-FAM-BHQ is stronger than that of single FAM.

[0075] (3) The basis for the quantitative detection of Salmonella Typhimurium using fluorescence signal values ​​in this invention is that the fluorescence signal value of the metal-enhanced fluorescent probe is proportional to the concentration of Salmonella Typhimurium (the higher the concentration of Salmonella Typhimurium, the higher the fluorescence signal value). By measuring the fluorescence signal value of the metal-enhanced fluorescent probe using a fluorescence spectrometer, the concentration of Salmonella Typhimurium can be deduced, thus achieving quantitative detection of Salmonella Typhimurium. This invention uses a fluorescence spectrometer to directly read the fluorescence signal value of the metal-enhanced fluorescent probe, resulting in simple results, no need for complex data calculations, and sensitive and reliable detection results. Attached Figure Description

[0076] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0077] Figure 1 A schematic diagram of the amplification-free detection method based on CRISPR / Cas12a and metal-enhanced fluorescence in an embodiment of the present invention is shown.

[0078] Figure 2 Characterization images of AuNPs and AuNPs@SiO2 of the present invention are shown below; (A) TEM electron microscope image of AuNPs, (B) TEM electron microscope image of AuNPs@SiO2, and (C) UV spectra of AuNPs and AuNPs@SiO2.

[0079] Figure 3 The results are from the sensitivity experiment; (A) is the sensitivity fluorescence result diagram, and (B) is the linear range.

[0080] Figure 4 The results are for actual sample testing; among them, (A) tap water, (B) milk, (C) bread, and (D) eggs. Detailed Implementation

[0081] All raw materials and reagents in the embodiments of this application were purchased from the market or prepared according to conventional methods known to those skilled in the art.

[0082] This invention primarily aims to establish an amplification-free detection method for Salmonella Typhimurium based on CRISPR / Cas12a and metal-enhanced fluorescence. This method includes CRISPR / Cas12a, a fluorescence spectrometer, and a constant-temperature metal bath. The Cas12a reaction system and probe preparation conditions were optimized. Under optimal conditions, adding AuNPs@SiO2-FAM-BHQ to the Cas12a reaction system enables the detection of Salmonella Typhimurium, and the fluorescence signal value is recorded using a fluorescence spectrometer.

[0083] The crRNA and ssDNA used in this invention were synthesized by Beijing Qingke Biotechnology Co., Ltd., and their specific sequences are as follows:

[0084]

[0085] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0086] Example 1

[0087] (1) Synthesis of AuNPs@SiO2-FAM-BHQ

[0088] AuNPs were prepared using the citric acid reduction method. First, 1 mL of 1% chloroauric acid solution was placed in a volumetric flask and diluted to 100 mL with ultrapure water. The resulting solution was pale golden yellow. The solution was transferred to a 250 mL beaker and heated to 280°C on a hot plate, with continuous stirring until boiling. After boiling, timed for 3 minutes, and then quickly added 3 mL of 1% sodium citrate solution in one go. At this point, the solution turned a clear purplish-red. Heating and stirring continued until the solution became a clear, bright wine-red. After the wine-red color stabilized, heating and stirring continued for 10 minutes. Heating was then stopped, and the solution was allowed to cool naturally to room temperature. The cooled solution was the AuNPs solution and was stored in a refrigerator at 4°C, protected from light.

[0089] At 700 rpm·min -1 Under strong magnetic stirring, 2.5 mL of the newly prepared 1 mmol·L⁻¹ solution was added. -1 A solution of (3-aminopropyl)trimethoxy-silane (APS) was added to 500 mL of AuNPs solution and allowed to stand for 15 min to ensure that the amino groups were bound to the AuNPs surface.

[0090] At 700 rpm·min -1 Under strong magnetic stirring, 15 mL of 0.54 g·L⁻¹ was added. -1Active SiO2 was added to 500 mL of aminated AuNPs solution, and the mixture was allowed to stand for one day to allow the active SiO2 to polymerize on the AuNPs surface. After standing for 24 hours, the SiO2 thickness was approximately 2-4 nm.

[0091] Subsequently, the thickness of the SiO2 shell was increased using the Stuber process. (300 rpm·min) -1 Under magnetic stirring, 2 μL of tetraethoxysilane (TEOS) and 2 mL of ammonia were added to 500 mL of water / ethanol (1:4) solution and allowed to stand for 12 h. This process can be repeated as needed until the desired SiO2 shell thickness is achieved (7 cm in Example 1).

[0092] Add 10 mL of 28% ammonium hydroxide solution to the prepared 2 mL AuNPs@SiO2 solution and let stand for 30 min. After the reaction is complete, add 2 μL of 3-aminopropyltriethoxysilane (APTES), stir at 35 °C for 3 h, and then heat the mixture to 65 °C for 1 h. After the reaction is complete, centrifuge three times at 10000 rpm, remove the supernatant to obtain amination-modified AuNPs@SiO2.

[0093] Subsequently, ssDNA (COOH(dTFAM)-TTATT-BHQ1) was added to the amination of AuNPs@SiO2 and mixed thoroughly. The mixture was then stirred and reacted in the dark at 30°C for 12 h. After the reaction was completed, the sample was centrifuged and washed three times at 10,000 rpm. The supernatant was removed to obtain the fluorescent probe AuNPs@SiO2-FAM-BHQ.

[0094] (2) Characterization of AuNPs@SiO2-FAM-BHQ

[0095] AuNPs and AuNPs@SiO2-FAM-BHQ were observed using TEM, and the maximum absorption wavelength was measured using ultraviolet absorption spectroscopy.

[0096] (3) Preparation of Cas12a detection system

[0097] Mix 2μL 10×NE Buffer r2.1, 2μL Cas12a (10μM), 10μL AuNPs@SiO2-FAM-BHQ (3μM), 2μL crRNA (10μM), 6μL 10 1 -10 8 CFU·mL -1 The Salmonella typhimurium bacterial suspension was added to an EP tube and mixed thoroughly. The mixture was then reacted at a constant temperature of 37°C for 30 minutes.

[0098] Among them, crRNA2 and crRNA3 were used.

[0099] (4) Determination of the detection limit of Salmonella typhimurium

[0100] The concentration of Salmonella typhimurium culture was determined using NanoDrop, and 10-fold serial dilutions were performed with DEPC water to set up 10... 1 -10 7 CFU·mL -1 Salmonella typhimurium was used as a template for Cas12a detection reaction. After the reaction, the fluorescence signal value was measured by fluorescence spectrometry to determine the detection limit.

[0101] (5) Actual sample testing

[0102] Tap water, milk, eggs, and bread were pretreated, and then the test solution was added to the Cas12a detection system according to the above detection steps. The samples were then tested using the traditional culture method, and the accuracy of the established method was determined by comparison.

[0103] The AuNP characterization results are as follows: Figure 2 As shown in Figure A, the synthesized AuNPs particles are uniform in size, have smooth surfaces, are approximately 20 nm in size, and exhibit good dispersibility.

[0104] The characterization results of AuNPs@SiO2 are as follows: Figure 2 As shown in Figure B, it can be seen that the AuNPs@SiO2 are uniform in size, the SiO2 layer is uniformly coated, and the dispersion is good. The UV-Vis absorption spectra of AuNPs and AuNPs@SiO2 are shown below. Figure 2 As shown in Figure C, the maximum absorption peak of AuNPs is 520 nm, and the maximum absorption peak of AuNPs@SiO2 is located at 525 nm, with no obvious impurity peaks around it, indicating that AuNPs and AuNPs@SiO2 were successfully prepared.

[0105] To evaluate the minimum detection concentration of the system, 10 0 -10 7 CFU·mL -1 The Salmonella typhimurium bacterial suspension was added to a CRISPR / Cas12a system for detection, and the results were as follows: Figure 3 As shown, when the bacterial concentration is 10... 1 CFU·mL -1 At that time, its fluorescence value differed significantly from that of the negative control. At 10 1 -10 6 CFU·mL -1 Within the specified concentration range, bacterial concentration and fluorescence intensity showed a good linear correlation, with the regression equation being Y = 446.7X + 3671, R0. 2=0.9509. This indicates that the detection limit of the established method is 10. 1 CFU·mL -1 .

[0106] To evaluate the detection effectiveness of this method in real samples, tap water, milk, bread, and eggs artificially laced with Salmonella typhimurium were tested. The results are as follows: Figure 4 As shown, the test results of actual samples with different concentrations of Salmonella Typhimurium were all positive, indicating that this method can be used for the detection of actual samples.

[0107] In addition, the target analyte in this invention can be other foodborne pathogens such as Listeria monocytogenes, Staphylococcus aureus, Escherichia coli, etc., simply by replacing the crRNA with the specific sequence of the target pathogen.

[0108] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A detection system for CRISPR / Cas12a and metal-enhanced fluorescence effect, characterized in that, The metal-enhanced fluorescence effect is achieved by using the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ, and a detection system is composed of the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ and CRISPR / Cas12a. The metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ is prepared by coating SiO2 on the surface of AuNPs and then connecting ssDNA, so that the fluorescent group FAM and the quenching group BHQ are sequentially connected on the SiO2 layer.

2. The detection system according to claim 1, characterized in that, The thickness of the SiO2 layer is 5-10 nm.

3. The detection system according to claim 1, characterized in that, The preparation method of the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ includes the following specific steps: (1) AuNPs solution was prepared by citric acid reduction method, and amino groups were bound to the surface of AuNPs to obtain aminated AuNPs solution; (2) Active SiO2 polymerizes into a SiO2 layer on the surface of aminated AuNPs; (3) Increase the thickness of the SiO2 layer to obtain AuNPs@SiO2; (4) Amination of AuNPs@SiO2; (5) The metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ was prepared by linking the amination AuNPs@SiO2 to ssDNA.

4. The detection system according to claim 3, characterized in that, In step (1), the average particle size of AuNPs is between 10 and 30 nm; Preferably, in step (1), the specific steps for obtaining an aminated AuNPs solution by binding the amino group to the AuNPs surface are as follows: Under stirring conditions, a (3-aminopropyl)trimethoxysilane solution was added to an AuNPs solution and allowed to stand to ensure that the amino groups were bound to the AuNPs surface, thus obtaining an aminated AuNPs solution. Preferably, the stirring speed is 600-900 rpm·min -1 ; Preferably, the concentration of the (3-aminopropyl)trimethoxysilane solution is 0.5-2 mmol·L⁻¹. -1 The preferred concentration is 0.5-1.5 mmol·L⁻¹. -1 ; Preferably, the volume ratio of (3-aminopropyl)trimethoxysilane solution to AuNPs solution is 1-5:500; Preferably, the settling time is 10-30 minutes.

5. The detection system according to claim 3, characterized in that, In step (2), the specific steps for the polymerization of the active SiO2 onto the surface of aminated AuNPs to form a SiO2 layer are as follows: Under stirring conditions, active SiO2 is added to the aminated AuNPs solution, and the mixture is allowed to stand, so that the surface of the aminated AuNPs polymerizes into a SiO2 layer. Preferably, the stirring conditions are 600-900 rpm·min -1 ; Preferably, the thickness of the SiO2 layer is approximately 2-4 nm; Preferably, the concentration of active SiO2 is 0.1-2 g·L⁻¹. -1 ; Preferably, the volume ratio of active SiO2 to aminated AuNPs solution is 10-20:400-600; Preferably, the settling time is 12-36 hours, and more preferably 22-26 hours.

6. The detection system according to claim 3, characterized in that, In step (3), the thickness of the SiO2 layer is increased by the Stuber method to obtain AuNPs@SiO2. The specific steps are as follows: Under stirring conditions, tetraethoxysilane and ammonia were added to the water / alcohol solution, allowed to stand, and the addition was repeated multiple times until the desired SiO2 shell thickness was achieved. Preferably, the stirring conditions are 100-500 rpm·min -1 ; Preferably, the alcohol is ethanol; Preferably, the volume ratio of water to alcohol solution is 1:3-5; Preferably, the volume ratio of water / alcohol solution, tetraethoxysilane and ammonia is 400-600 mL: 1-3 μL: 1-3 mL; Preferably, the settling time is 10-14 hours.

7. The detection system according to claim 3, characterized in that, In step (4), the specific steps for amination of AuNPs@SiO2 are as follows: Ammonium hydroxide solution was added to the prepared AuNPs@SiO2 solution and allowed to stand. After the reaction was completed, 3-aminopropyltriethoxysilane was added and stirred. The mixture was then heated. After the reaction was completed, the mixture was centrifuged and the supernatant was removed to obtain amination-modified AuNPs@SiO2. Preferably, the mass concentration of the ammonium hydroxide solution is 25-30%; Preferably, the volume ratio of AuNPs@SiO2 solution, ammonium hydroxide solution and 3-aminopropyltriethoxysilane is 1-5 mL: 5-20 mL: 1-3 μL; Preferably, the settling time is 20-60 minutes, more preferably 20-40 minutes; Preferably, the reaction is carried out by stirring at 20-40°C for 1-5 hours, and more preferably by stirring at 30-40°C for 2-4 hours. Preferably, the mixture is heated to 50-70°C and reacted for 0.5-4 hours; more preferably, it is heated to 60-70°C and reacted for 0.5-1.5 hours. Alternatively, in step (5), the specific steps for preparing the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ by linking the amination-treated AuNPs@SiO2 to ssDNA are as follows: ssDNA was added to the amination of AuNPs@SiO2 and mixed evenly. The reaction was then stirred in the dark. After the reaction was completed, the sample was centrifuged, washed, and the supernatant was removed to obtain the metal-enhanced fluorescent probe AuNPs@SiO2-FAM-BHQ. Preferably, the reaction is carried out under dark conditions at 20-40°C for 10-24 hours with stirring, and more preferably under dark conditions at 25-35°C for 10-14 hours with stirring. Preferably, the ssDNA sequence is COOH(dTFAM)-TTATT-BHQ1.

8. The application of the CRISPR / Cas12a detection system with metal-enhanced fluorescence effect as described in any one of claims 1-7 in the detection of foodborne pathogens.

9. A method for detecting foodborne pathogens without amplification using a detection system based on any one of claims 1-7, specifically the CRISPR / Cas12a and metal-enhanced fluorescence effect, for non-diagnostic purposes, characterized in that... Includes the following steps: Buffer, CRISPR / Cas12a, AuNPs@SiO2-FAM-BHQ and crRNA were added to the solution of the foodborne pathogens to be detected, and the reaction was carried out at an isothermal temperature. The fluorescence signal value was then measured.

10. The method according to claim 9, characterized in that, The buffer solution is a nuclear extraction buffer with a concentration of 10 × NE Buffer r2.1; Preferably, the concentration of CRISPR / Cas12a is 5-20 μM, and more preferably 8-12 μM; Preferably, the concentration of AuNPs@SiO2-FAM-BHQ is 1-5 μM, and more preferably 2-4 μM; Preferably, the concentration of crRNA is 5-20 μM, and more preferably 8-12 μM; Preferably, the foodborne pathogens include Salmonella Typhimurium, Listeria monocytogenes, Staphylococcus aureus, and Escherichia coli; Preferably, the volume ratio of buffer, CRISPR / Cas12a, AuNPs@SiO2-FAM-BHQ, crRNA and the foodborne pathogen solution to be detected is 1-5 μL: 1-5 μL: 6-15 μL: 1-5 μL: 4-10 μL, and more preferably 1-3 μL: 1-3 μL: 8-12 μL: 1-3 μL: 5-7 μL; Preferably, the isothermal reaction conditions are: isothermal reaction at 25-40℃ for 20-40 min; Preferably, the crRNA includes one or more of crRNA1, crRNA2, and crRNA3; Preferably, the sequence of crRNA1 is as shown in SEQ ID NO.1; Preferably, the sequence of crRNA2 is as shown in SEQ ID NO.2; Preferably, the sequence of crRNA3 is as shown in SEQ ID NO.3.

Images