Single nucleotide polymorphism site located on chromosome 6 of a corn genome and its use in analyzing corn pollen shedding at high temperatures

Abstract

This invention provides a single nucleotide polymorphism (SNP) site located on chromosome 6 of the maize genome and its application in analyzing anther exposure rate in maize under high temperatures. It reveals a SNP molecular marker associated with anther exposure trait in maize tassels under high temperatures, located at Chr6_150,678,093 on chromosome 6 (Chr6) of the maize genome, with the corresponding bases being C / T. The technical solution of this invention provides a new basis for marker-assisted breeding of heat tolerance in maize, effectively improving breeding efficiency.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and botany. More specifically, this invention relates to a single nucleotide polymorphism site located on chromosome 6 of the maize genome and its application in analyzing the pesticide exposure rate of maize under high temperature. Background Technology

[0002] As one of the world's most important food crops, maize's yield is affected by a variety of environmental factors, among which high-temperature stress has the most significant impact. High temperatures reduce maize pollen viability and fertility, hinder silk emergence, and ultimately lead to a decrease in seed setting rate and a severe impact on yield.

[0003] High temperatures affect maize fertility in several ways, including but not limited to the development of tassels and ears and various stages of pollination. When temperatures exceed 32°C during the silking stage of the ear, pollen tube elongation is hindered, making fertilization difficult. If high temperatures are combined with drought, the pollination success rate is further reduced.

[0004] After the florets of the tassel differentiate, the anthers emerging from the glumes (i.e., anther exposure) is a prerequisite for pollen shedding. When anthers are normally exposed, they are plump, golden in color, and contain mature pollen. Anther exposure in maize tassels is closely related to fertility. High temperatures inhibit anther exposure. When the temperature remains above 35℃, the florets degenerate, manifested as: thickened anther walls, difficulty in normal dehiscence and pollen shedding, pollen grain dehydration and shriveling, decreased viability, and in severe cases, the tassel completely fails to flower, with the anthers remaining trapped inside the glumes. Normally exposed pollen can maintain its viability for 6-8 hours, but at high temperatures (such as 38-39℃), the proportion of highly viable pollen decreases significantly, and pollen tube elongation is hindered, thus preventing fertilization.

[0005] When the anthers fail to emerge properly or the pollen viability is insufficient, the amount of effective pollen per ear decreases sharply, causing the stigma of the female ear to fail to receive pollen in time, resulting in sterility phenomena such as barren tips and empty kernels.

[0006] Anther exposure rate refers to the proportion of anthers emerging from the husk when the maize tassel begins to shed pollen. Varieties with a high anther exposure rate at high temperatures have anthers that emerge normally, thus not affecting normal pollen shedding. Traditional methods for assessing maize heat tolerance mainly rely on trait observation, which suffers from drawbacks such as long cycles, low efficiency, and significant environmental influence. Molecular marker-assisted selection can overcome the shortcomings of traditional breeding methods and improve breeding efficiency. Among these methods, single nucleotide polymorphisms (SNPs) have become the most widely used marker type in molecular marker-assisted breeding. Currently, no SNP molecular markers related to anther exposure rate in maize at high temperatures have been reported. Therefore, this field needs to explore the relationship between high temperature and anther exposure rate in order to provide support for maize stress resistance breeding or to develop strategies for regulating the anther exposure trait (phenotype) in maize. Summary of the Invention

[0007] The purpose of this invention is to provide a single nucleotide polymorphism site located on chromosome 6 of the maize genome and its application in analyzing the pesticide exposure rate of maize under high temperature.

[0008] In a first aspect of the invention, the application of a maize chromosome Chr6_150,678,093 polymorphic site or a polynucleotide fragment (genomic fragment) containing such site is provided; the polymorphic site is C / T (CC (homozygous C) or TT (homozygous T)); the application includes:

[0009] (a) Used for analyzing (including identifying or predicting) the anther exposure trait of maize (including maize populations) under high temperatures; or

[0010] (b) Analytical reagents, kits or apparatus for the preparation of analysis (including identification or prediction) of anther exposure characteristics of maize (including maize populations) at high temperatures.

[0011] In another aspect of the invention, analytical reagents, kits, or apparatuses are provided for analyzing the anther exposure trait of maize tassels at high temperatures using a maize chromosome Chr6_150,678,093 polymorphic site or a polynucleotide fragment containing that site; the analytical reagents, kits, or apparatuses are for single nucleotide polymorphisms at the Chr6_150,678,093 site; the polymorphic site is C / T.

[0012] In one or more embodiments, during analysis, the single nucleotide polymorphism at the Chr6_150,678,093 site of the maize chromosome in the maize sample (including the maize population) is determined.

[0013] In one or more embodiments, when preparing the analytical reagent, the reagent is targeted at the single nucleotide polymorphism at the Chr6_150,678,093 site on maize chromosome 6.

[0014] In one or more embodiments, based on the genotype of the polymorphic site:

[0015] When the genotype is TT, the average anther exposure rate of the corresponding maize tassel is high (relatively high), for example, 1.52±0.2 (preferably 1.52±0.1, more preferably 1.52±0.05);

[0016] When the genotype is CC, the average anther exposure rate of the corresponding maize tassel is low (relatively low), for example, 1.18±0.2 (preferably 1.18±0.1, more preferably 1.18±0.05).

[0017] In one or more embodiments, when the corn is a corn population, the anther exposure ratio is the average exposure ratio.

[0018] In one or more embodiments, the anther exposure rate (anther exposure rate) is calculated using Formula I (see Example 2).

[0019] In one or more embodiments, the anther exposure trait of the maize tassel is the anther exposure trait under high temperature conditions, wherein the high temperature is above 35°C.

[0020] In one or more embodiments, the high temperature can be above 36°C, 38°C, 40°C, or 42°C.

[0021] In one or more embodiments, the analytical reagent, kit, or device includes (but is not limited to): primers (sets), probes (sets), primer-probe sets, and chips that detect specific primers (sets), probes, and bases containing the Chr6_150,678,093 site region; restriction enzymes that specifically recognize the base type of the Chr6_150,678,093 site; electrophoresis reagents; and gene sequencing instruments.

[0022] In one or more embodiments, the analytical reagent is a primer(set) for PCR amplification, the nucleotide sequence of which is shown in SEQ ID NO:2 and SEQ ID NO:3.

[0023] In one or more embodiments, after determining the genotype of the maize chromosome Chr6_150,678,093 locus and analyzing the anther exposure trait of maize tassels, the tassel reproductive capacity of maize lines is further predicted or analyzed for maize germplasm resource identification or for targeted breeding / selection of maize.

[0024] In another aspect of the present invention, a method is provided for analyzing (including identifying or predicting) the anther exposure trait of maize tassels at high temperatures, including analyzing the Chr6_150,678,093 polymorphic locus on the chromosome of the maize to be tested (including the maize population); according to the analysis results, when the genotype is TT, the average anther exposure rate of the corresponding maize tassel is high; when the genotype is CC, the average anther exposure rate of the corresponding maize tassel is low.

[0025] In one or more embodiments, nucleotide sequence analysis is performed using methods selected from (but not limited to): sequencing, PCR amplification, restriction enzyme digestion, polymerase chain reaction-restriction enzyme digestion (PCR-RFLP), amplified fragment length polymorphism (AFLP), loop-mediated isothermal amplification, electrophoresis, probe method, hybridization method, microarray method, flow cytometry, high-performance liquid chromatography, laser scanning, and mass spectrometry.

[0026] In one or more embodiments, analysis is performed using specific amplification primers by PCR amplification, wherein the primers have the nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:3.

[0027] In another aspect of the present invention, a method for regulating the anther exposure trait of maize (including maize populations) under high temperature is provided, comprising: analyzing the anther exposure trait of maize tassels under high temperature using any of the methods described above; when the analysis results show that the base at the Chr6_150,678,093 site of the chromosome of the maize to be tested is CC, mutating the Chr6_150,678,093 site in the chromosome of the maize to modify the base to TT, thereby increasing the anther exposure ratio of maize and promoting maize pollination.

[0028] In one or more embodiments, the mutation method includes (but is not limited to): site-directed mutagenesis, gene editing (such as CRISPR-based techniques).

[0029] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0030] Figure 1 We used genome-wide association analysis (GWAS) to analyze markers related to pesticide exposure rate in maize under high temperature conditions, and obtained the marker (Chr6_150,678,093).

[0031] Figure 2 A schematic diagram illustrating different levels of anther exposure in natural maize populations. During pollen shedding, the anther exposure of each inbred line was graded into five levels: A, E, and F.

[0032] Figure 3 We analyzed and statistically analyzed the genotypes at the Chr6_150,678,093 loci, and the average pesticide exposure rate of maize with CC and TT genotypes. Detailed Implementation

[0033] Through extensive and in-depth research and screening, the inventors have provided a single nucleotide polymorphism (SNP) molecular marker associated with the anther exposure trait of maize tassels under high temperatures. This SNP marker is located at Chr6_150,678,093 on maize chromosome 6 (Chr6), with the corresponding base sequence C / T (CC (homozygous C) / TT (homozygous T)). This technical solution fills a technological gap in this field, provides a novel basis for marker-assisted breeding of maize heat tolerance, and effectively improves breeding efficiency.

[0034] As used in this invention, the term "genotype" refers to a specific allele carried at a locus.

[0035] As used in this invention, the terms "anther exposure (proportion / rate)," "anther protrusion (proportion / rate)," and "anther protrusion (proportion / rate)" can be used interchangeably and refer to the plant physiological phenomenon of anther protrusion in the tassel of maize.

[0036] As used in this invention, "polymorphism" refers to a mutation at a specific site, and mutations that occur at a frequency of 1% or higher in a population are specifically referred to as "polymorphisms". Among polymorphisms, those consisting of substitutions, insertions, or deletions of single nucleotides are specifically referred to as single nucleotide polymorphisms (SNPs). This invention relates to substitutional SNPs.

[0037] As used in this invention, a "polynucleotide fragment (genomic fragment) containing the Chr6_150,678,093 site" is a nucleotide sequence containing the polymorphic site to be tested. Specifically, the nucleotide sequence surrounded by the region annealed with the primers of this invention contains the target nucleotide site of this invention. The polynucleotide fragment of this invention includes not only the sense strand but also its complementary strand, i.e., the antisense strand, of the nucleotide sequence. As a preferred embodiment of this invention, the polynucleotide fragment containing the Chr6_150,678,093 site, i.e., SEQ ID NO:4, was analyzed using specific primers.

[0038] In the prior art, those skilled in the art have not had a clear understanding of which genes(s) control the anther exposure trait of maize tassels, and there is a lack of technical solutions for identifying the anther exposure trait of maize tassels. In this invention, based on genome-wide association analysis (GWAS), SNP markers related to the anther exposure rate of maize tassels under high temperatures are screened. Then, candidate genes within 50kb upstream and downstream of significant SNP sites are analyzed, and some candidate genes related to the anther exposure rate of maize under high temperatures are screened. Based on the candidate genes, it is determined that the SNP site at position 150,678,093 on chromosome 6 of the maize genome is closely linked to the anther exposure rate of maize under high temperatures.

[0039] This invention also includes a method for isolating and identifying allele-specific nucleic acid molecules, which can be used for any nucleic acid molecule, preferably DNA molecules.

[0040] According to a new discovery of the present invention, a method for specifically identifying the anther exposure trait of maize tassels is provided, comprising targeting the single nucleotide polymorphism (SNP) at the Chr6_150,678,093 site on chromosome 6 of the maize to be tested (including maize populations); when the genotype is TT, the average anther exposure rate of the corresponding maize tassel is high (relatively high), for example, 1.52±0.2; when the genotype is CC, the average anther exposure rate of the corresponding maize tassel is low (relatively low), for example, 1.18±0.2.

[0041] This invention overcomes the shortcomings of existing methods that cannot identify the anther exposure trait of maize tassels, and provides a simple and effective identification method and its preferred primers. This provides a feasible method for early or rapid identification of the anther exposure trait of maize tassels, and provides a powerful tool for plant breeding and screening.

[0042] The ability to identify the anther exposure trait of maize tassels early in the planting process or even before planting can greatly facilitate plant breeding work.

[0043] A wide variety of analytical techniques can be applied to identify isolated sequence sites and determine alleles. These techniques are well-known in the art or are under development. Such methods include, but are not limited to: sequencing, PCR amplification, restriction enzyme digestion analysis, polymerase chain reaction-restriction enzyme digestion (PCR-RFLP), amplified fragment length polymorphism (AFLP), loop-mediated isothermal amplification, electrophoresis, probe methods, hybridization, microarray methods, flow cytometry, high-performance liquid chromatography, laser scanning, mass spectrometry, etc.

[0044] The methods for obtaining DNA from the sample to be tested are well known to those skilled in the art, such as the traditional phenol / chloroform / isoamyl alcohol method, or commercially available DNA extraction kits, which are well known to those skilled in the art.

[0045] Polymerase chain reaction (PCR) is a technique well-known to those skilled in the art, and its basic principle is the in vitro enzymatic synthesis of specific DNA fragments. The method of this invention can be performed using conventional PCR techniques.

[0046] Based on the above, the present invention also relates to a kit for identifying the anther exposure trait of maize tassels, said kit containing reagents for specifically detecting the SNPs of interest described above or specific genes containing such SNP sites. Examples include one or more sets of site-specific amplification primers, polymerase chain reaction buffers, nucleic acid amplification reagents, reagents for generating single-stranded nucleic acid fragments, etc. In some optional embodiments, the kit may also include a restriction endonuclease capable of recognizing changes in the SNP site. It should be understood that the reagents that can be used for identification according to the present invention are not limited thereto.

[0047] In addition, the kit may also contain an instruction manual and / or standard operating procedures, including instructions on performing the above methods. The kit enables rapid, batch detection of anther exposure characteristics in maize tassels under high temperatures.

[0048] After understanding the role of the Chr6_150,678,093 site, it can be used as a molecular marker for targeted plant screening. This new discovery can also be used to screen for substances or potential substances that can target and regulate the anther exposure trait of maize tassels by altering / regulating this site or its adjacent regions.

[0049] Furthermore, this invention also provides a method for optimizing the breeding of maize (including maize populations), comprising: analyzing and identifying (including predicting) the anther exposure trait of maize tassels using the aforementioned method; when the analysis results show that the base at the Chr6_150,678,093 site of the chromosome of the maize to be tested is CC, mutating the Chr6_150,678,093 site in the chromosome of the maize to modify the base to TT, thereby increasing the anther exposure ratio of maize and promoting maize pollination.

[0050] The SNP markers associated with the exposure rate of maize under high temperature conditions can be used for marker-assisted breeding of maize heat resistance, effectively accelerating the process of maize heat resistance breeding, improving breeding efficiency, and shortening the breeding cycle, which is of great significance to maize breeding.

[0051] This invention has promising applications in molecular design breeding of anther exposure traits in maize tassels and in crop variety improvement using genetic engineering technology.

[0052] The invention will be better understood from the following examples. However, those skilled in the art will understand that the specific methods and results are merely for illustrating the invention and not for limiting it. Experimental methods in the following examples that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Science Press, or according to the manufacturer's recommendations.

[0053] Example 1: Screening of markers related to pesticide exposure rate in maize under high temperature

[0054] In this embodiment, genome-wide association analysis (GWAS) technology was used to mine SNP markers associated with the pesticide exposure rate of maize under high temperature.

[0055] 1. Acquisition and quality control of maize whole-genome resequencing data

[0056] 562 natural maize populations were grown at the Shangzhuang Base of China Agricultural University (Haidian District, Beijing). Young leaf tissues were selected, and complete genomic DNA was extracted (using the CTAB method). The extracted genomic DNA was quality-tested using a spectrophotometer (Nanodrop ND 1000). The following conditions were considered to meet the quality standards: an A260 / 280 ratio of approximately 1.8-2.0, and an A260 / 230 ratio of approximately 1.7-1.9.

[0057] DNA samples meeting the standards were used for library construction and sequencing. Each DNA sample was resequencing (10X sequencing depth) using an Illumina sequencing platform. The raw sequencing data was filtered to obtain high-quality sequencing data (Q20 ≥ 90%, Q30 ≥ 85%) with GC between 37% and 39%, which was used for subsequent analysis. The high-quality sequencing data was aligned to the maize reference genome using BWA software (https: / / download.maizegdb.org / Zm-B73-REFERENCE-NAM-5.0 / Zm-B73-RE FERENCE-NAM-5.0.fa.gz).

[0058] All paired-end and single-end alignments of reads were analyzed for variants using GCTA software. The SNP filtering criteria were set as follows: minor allele frequency (MAF) > 0.05; heterozygosity < 0.05; and deletion rate < 0.4. After filtering, genotyping was performed using Beagle software.

[0059] 2. Genome-wide association analysis

[0060] Using a mixed linear model (MLM) in GEMMA 0.98.1 software, with the Q matrix and phylogenetic matrix as covariates, a genome-wide association analysis was performed on the anther exposure rate (antennae exposure rate) of tassels in natural maize populations. Manhattan plots were constructed using R software, and -log 10 (P) = 5 is used as the threshold line for screening significant SNP sites, and potential candidate SNPs are screened out.

[0061] The filtering results are as follows Figure 1 .

[0062] 3. Obtaining markers related to drug exposure rate

[0063] SNPs above the threshold were extracted, and the expression levels and gene functions of candidate genes within 50kb upstream and downstream of significant SNP sites were analyzed.

[0064] Through in-depth screening and analysis, the inventors located a GWAS signal (P-value = 6.1058E-08) associated with pesticide exposure rate at position 150.68 Mb on maize chromosome 6, and detected a linkage disequilibrium region of 45 kb in size, identifying the candidate gene Zm00001eb285960 associated with pesticide exposure rate in maize under high temperature. The significant SNP site is located at position 150,678,093 on chromosome 6 of the maize genome (e.g., ...). Figure 1 Chr6_150,678,093).

[0065] The maize B73 reference genome contains approximately 400 bp sequences around sites Chr6_150, 678, and 093. The sequences containing the target nucleotide sites are as follows:

[0066] AGTCCACGCTAGCACCCCTATTGAACACAAATATATTGTCCCCGGTTTTCAAAACCACGATGCTCGTCGTCATCGGTTTATGAAACCCCATGTTTAAAAGCTTAATCATACATCT GTAATTGTCACTTTACTTGAGTTGC GTCTTATCTTATTACCGCTTCTGTCACAGTAGGGAGTAGCCTTCTCGGCAAGATCAACCTGATTGTGATTTTGTCAATAAGCAGAAGAGATGTGATGCTAAGGTTGTTGGGTTCGAGTCTTTTGATCTAA AGCTGGATCGATGTGTCACTTTCTAAAGCTGGATCGATGTATCATGTATCGCTCTACAACCAAATCGGTAGTTATCTTCATAGGATAAAAGATCAGGGCCCGATCCCATCATATACCACACTATTGAGGA C GCTATAACGACACTACAATCGC

[0067] TATTTAGTACCATGGACCAAAGATGCCTAGAAAATTCGAAAAACTCACAAAT

[0068] TCGTGCATGACTAGGTGAGTACCCGTGAGTTGCAACAGGAACATATAATACC

[0069] ATGATAACTTATATATAAAATGTGTCTTATATTGTTATAAGAAAATGTTTCAT

[0070] AATCATTTGTGATCCTAGCCATATATAAATTTTGATATTTTAATTTAGTTGTT

[0071] TCACTACTACATTGCAACCATCAATATCATGCAGACTTCGATATATATCATGA

[0072] TTTGCATGGTCTCATCATTGGAGAGCACGTGCCAACCTG CTGGTAGAAGTTG

[0073] CGTCGT ACATCGTTAGTCATCAGACACGCACCACCATACACGCTTTGCTTAAAC

[0074] AAAAAGGC(SEQ ID NO:1)

[0075] Example 2: Analysis of herbicide exposure rate in natural maize populations

[0076] 562 natural maize populations were planted at the Crop Cultivation and Breeding Base of the Institute of Plant Physiology and Ecology, Chinese Academy of Sciences (Songjiang District, Shanghai). Continuous high-temperature treatment (above 40℃) was initiated when the maize entered the reproductive development stage. At pollen shedding, the exposure of the tassel anthers in each inbred line was graded according to the following criteria:

[0077] A: Anther exposure is 0%-5%, which is grade 1;

[0078] B: Anthers exposed 5%-25%, grade 2;

[0079] C: Anthers exposed 26%-50%, grade 3;

[0080] D: Anthers exposed 51%-75%, grade 4;

[0081] E: Anther exposure >75%, grade 5.

[0082] A diagram illustrating different degrees of anther exposure in the male spike, as shown below. Figure 2 As shown.

[0083] The anther exposure score (AES) is used as the final anther exposure rate (anther exposure percentage) of the inbred line. The formula is as follows:

[0084] AES = (1×x1+2×x2+3×x3+4×x4+5×x5) / (x1+x2+x3+x4+x5) Formula I;

[0085] in:

[0086] x1: Number of plants with grade 1 herb exposure rate;

[0087] x2: Number of plants with level 2 seed exposure rate;

[0088] x3: Number of plants with level 3 seed exposure rate;

[0089] x4: Number of plants with level 4 pesticide exposure rate;

[0090] x5: Number of plants with 5-level drug exposure rate.

[0091] We analyzed the target SNPs in the genomes of maize lines with different anther exposure levels using sequencing methods, and then performed correlation analysis between SNP loci and anther exposure rate.

[0092] The results are as follows Figure 3 As shown, at this locus (Chr6_150,678,093), compared with the average herbicide exposure rate of 1.18 in maize with the CC genotype (n=264 plants), the average herbicide exposure rate in maize with the TT genotype (n=285 plants) was significantly higher, at 1.52.

[0093] Therefore, the SNP marker associated with pesticide exposure in maize under high temperatures is located at nucleotide 150,678,093 on chromosome 6 of the maize genome (https: / / download.maizegdb.org / Zm-B73-REFERENCE-NAM-5.0 / Zm-B73-RE FERENCE-NAM-5.0.fa.gz), and it is either C or T.

[0094] The SNPs described are applicable to analyzing the exposure rate of maize under high temperatures and further determining its ability to effectively reproduce tassels, thereby helping to assess the fertility of maize populations under high temperatures and providing new criteria for stress-resistant breeding.

[0095] Example 3: Design and preparation of a label suitable for detecting chr6_150,678,093

[0096] Primers were designed based on the sequence approximately 400 bp to the left and right of positions 150,678,093 on chromosome 6 of the maize B73 reference genome. The specific nucleotide sequences are shown in SEQ ID NO:1, and the primer sequences are as follows:

[0097] Primer F: 5'-GTAATTGTCACTTTACTTGAGTTGC-3' (SEQ ID NO: 2);

[0098] Primer R: 5'-ACGACGCAACTTCTACCAG-3' (SEQ ID NO:3);

[0099] PCR amplification was performed. The PCR reaction mixture consisted of: 2 μl DNA template, 15 μl PCR mix, 0.6 μl forward primer, 0.6 μl reverse primer, and 11.8 μl ddH2O, for a total of 30 μl. The PCR reaction program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 15 sec, 56℃ annealing for 25 sec, 72℃ extension for 25 sec, 35 cycles; 72℃ extension for 5 min; and storage at 4℃.

[0100] The amplified product was recovered and sequenced to obtain a base sequence containing the SNP (chr6_150,678,093(C / T)) site, as shown in SEQ ID NO:4.

[0101] GTAATTGTCACTTTACTTGAGTTGC GTCTTATCTTATTACCGCTTCTGTCACAGTAGGGAGTAGCCTTCTCGGCAAGATCAACCTGATTGTGATTTTGTCAATAAGCAGAAGAGATGTGATGCTAAGGTTGTTGGGTTCGAGTCTTTTGATCTAA AGCTGGATCGATGTGTCACTTTCTAAAGCTGGATCGATGTATCATGTATCGCTCTACAACCAAATCGGTAGTTATCTTCATAGGATAAAAGATCAGGGCCCGATCCCATCATATACCACACTATTGAGGA C GCTATAACGACACTACAATCGCTATTTAGTACCATGGACCAAAGATGCCTAGAAAATTCGAAAAACTCACAAATTCGTGCATGACTAGGTGAGTACCCGTGAGTTGCAACAGGAACATATAATACCATGATAACTTATATATAAAATGTGTCTTATATTGTTA TAAGAAAATGTTTCATAATCCATTTGTGATCCTAGCCATATATAAATTTTGATATTTTAATTTAGTTGTTTCACTACTACATTGCAACCATCAATATCATGCAGACTTCGATATATATCATGATTTGCATGGTCTCATCATTGGAGAGCACGTGCCACACCTG CTGGTAGAAGTTGCGTCGT (SEQ ID NO:4)

[0102] The SNP site is located at the 286 bp position from the 5' end of the sequence shown in SEQ ID NO:4. After amplifying the maize plant and obtaining the amplification product, the genotype can be accurately determined based on the SNP site, the herbicide exposure rate of the maize can be assessed, and the obtained herbicide exposure information can guide maize breeding.

[0103] In summary, this invention identified SNP markers associated with maize pesticide exposure rate under high temperatures using genome-wide association analysis (GWAS). Subsequently, candidate genes within 50 kb upstream and downstream of significant SNP sites were analyzed to determine these candidate genes. Based on these candidate genes, SNP site 150,678,093 on maize chromosome 6 (Chr6) was ultimately determined to be closely linked to maize pesticide exposure rate under high temperatures. The SNP markers associated with maize pesticide exposure rate under high temperatures identified in this invention can accelerate marker-assisted selection for maize pesticide exposure rate under high temperatures, expedite the process of heat-resistant maize breeding, and improve breeding efficiency, which is of great significance for heat-resistant maize breeding.

[0104] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. Application of the maize chromosome Chr6_150,678,093 polymorphic site or a polynucleotide fragment containing this site; the polymorphic site is C / T; the application includes: (a) Used to analyze the anther exposure characteristics of maize tassels under high temperature; or (b) Analytical reagents, kits or apparatus for preparing the anther exposure trait of maize tassels at high temperatures.

2. The application of analytical reagents, kits, or devices for analyzing the Chr6_150,678,093 polymorphic site on maize chromosome or polynucleotide fragments containing this site in the analysis of anther exposure trait in maize tassels under high temperature; wherein the analytical reagents, kits, or devices are for single nucleotide polymorphisms at the Chr6_150,678,093 site; wherein the polymorphic site is C / T.

3. The application as described in claim 1 or 2, characterized in that, Based on the genotype of the polymorphic site: When the genotype is TT, the average anther exposure rate of the corresponding maize tassel is high, for example, 1.52±0.

2. When the genotype is CC, the average anther exposure rate of the corresponding maize tassel is low, for example, 1.18±0.

2.

4. The application as described in claim 1 or 2, characterized in that, The anther exposure trait of the maize tassel refers to the anther exposure trait under high temperature conditions, where high temperature is above 35℃.

5. The application as described in claim 1 or 2, characterized in that, The analytical reagents, kits, or devices include: specific primers, probes, primer-probe sets, and chips for detecting the region containing the Chr6_150,678,093 site; restriction enzymes that specifically recognize the base type of the Chr6_150,678,093 site; electrophoresis reagents; and gene sequencing instruments. Preferably, the analytical reagents are primers for PCR amplification, and their nucleotide sequences are shown in SEQ ID NO:2 and SEQ ID NO:

3.

6. The application as described in claim 1 or 2, characterized in that, After determining the genotype of the maize chromosome Chr6_150,678,093 locus and analyzing the anther exposure trait of maize tassels, the tassel reproductive capacity of maize lines can be further predicted or analyzed for maize germplasm resource identification or targeted breeding / selection of maize.

7. A method for analyzing the anther exposure trait of maize tassels under high temperature, comprising analyzing the polymorphic sites of chromosome Chr6_150,678,093 of the maize to be tested; according to the analysis results, when the genotype is TT, the average anther exposure rate of the corresponding maize tassel is high; when the genotype is CC, the average anther exposure rate of the corresponding maize tassel is low.

8. The method as described in claim 7, characterized in that, Nucleotide sequence analysis was performed using methods selected from the following: sequencing, PCR amplification, restriction enzyme digestion, polymerase chain reaction-restriction enzyme digestion, amplified fragment length polymorphism, loop-mediated isothermal amplification, electrophoresis, probe method, hybridization method, microarray method, flow cytometry, high-performance liquid chromatography, laser scanning, and mass spectrometry.

9. The method as described in claim 7 or 8, characterized in that, The primers were analyzed by PCR amplification using specific amplification primers, and the primers had the nucleotide sequences shown in SEQ ID NO:2 and SEQ ID NO:

3.

10. A method for regulating the anther exposure trait of maize tassels under high temperature, comprising: The method described in any one of claims 7 to 9 is used to analyze the anther exposure trait of maize tassels under high temperature. When the analysis results show that the base at the Chr6_150,678,093 site of the chromosome of the maize to be tested is CC, a mutation is made at the Chr6_150,678,093 site of the maize chromosome to modify the base to TT, thereby increasing the anther exposure ratio of maize and promoting maize pollination.

11. The method as described in claim 10, characterized in that, The mutation methods include: site-directed mutagenesis and gene editing.

Images