KASP marker for rapid identification of a large population of cytoplasmic male sterile onions and use thereof

Abstract

This invention discloses a KASP marker for rapid identification of cytoplasmic fertility in large populations of onions and its applications, belonging to the field of molecular biotechnology. The nucleotide sequences of the primers used to amplify the KASP marker are shown in SEQ No: 1, SEQ No: 2, and SEQ No: 3. Using the KASP marker to assist in the selection of new cytoplasmic male-sterile onion lines features high throughput, low cost, and high accuracy, providing accurate and reliable results quickly and conveniently. It significantly improves selection efficiency, saves time and costs, and will play an important role in the detection of onion cytoplasmic genotypes and large populations. Therefore, it has good practical application value, can accelerate the selection of new cytoplasmic male-sterile onion lines, and establish a novel parental selection system for onion hybrids.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a KASP marker for rapid identification of cytoplasmic fertility in large populations of onion cells and its application. Background Technology

[0002] onion( Allium cepa Onions (Allium tuberosum), also known as round onions or bulb onions, belong to the genus Allium in the family Liliaceae. They are biennial plants with a cultivation history of over 5000 years. According to FAO statistics in 2020, my country has the world's largest onion production area and output, accounting for approximately 30% of global production. Global onion production has shown a long-term, stable, and significant growth trend over the past thirty years. Onions have become one of the world's most important vegetable crops, second only to tomatoes in terms of production scale. Global onion production is highly concentrated in Asia, particularly China and India, which contribute more than half of global production. China has long maintained its position as the world's first or second largest producer, accounting for approximately 27%-30% of global production. China is not only a major producer but also a major exporter, primarily exporting to Japan, South Korea, and Southeast Asia. Onions can be eaten fresh and are also widely used in processed products. They are rich in various sulfur compounds and sugars, which are the main components of their unique flavor. Onions have the effects of reducing and preventing thrombosis, lowering blood lipids, lowering blood pressure, resisting arteriosclerosis, and preventing myocardial infarction. Their nutritional and medicinal value is gradually being recognized worldwide.

[0003] my country has a relatively short history of onion cultivation and a scarcity of varietal resources. Currently, the main varieties cultivated are red, yellow, and white-skinned onions, which are conventional open-pollinating varieties. China lags far behind countries like Japan, the United States, and the Netherlands in hybrid breeding. Many high-end varieties currently require import, with seed prices 2-3 times, or even more, than domestically produced varieties. Therefore, my country lacks hybrid varieties with independent intellectual property rights. To change this backward situation in onion breeding, the key lies in extensively collecting varietal resources, combining traditional breeding with modern molecular biology techniques, shortening the breeding cycle, and accelerating research on molecular-assisted selection and the utilization of male-sterile lines.

[0004] Onion male sterility primarily follows the nucleocytoplasmic interaction (CMS) model, with fertility expression jointly regulated by the nuclear restoration / sterility gene (Ms / ms) and the cytoplasmic sterility factor (S-cytoplasm). Although previous studies have established a KASP typing system targeting nuclear genes, KASP markers targeting the cytoplasmic genome remain a technological gap, directly hindering high-throughput standardization across the entire onion breeding process. The purpose of gene markers is to achieve marker-assisted breeding. Assisted selection using markers linked to either cytoplasmic loci or nuclear genes can reduce workload and improve breeding efficiency. Using markers linked to cytoplasmic loci, the cytoplasmic type of individual plants can be identified, eliminating S-type cytoplasm from fertile materials and selecting maintainer lines only from N-type cytoplasmic plants, thereby reducing the number of testcross combinations and self-pollinated plants, and reducing workload.

[0005] Because the onion genome DNA is enormous (17.9 pg), with 15290 Mbp of nucleotides per chromosome, it is 6 times larger than that of maize, 16 times larger than that of tomato, and 107 times larger than that of Arabidopsis. Research progress on cytoplasmic male sterility markers for the CMS-S male sterility system has been slower compared to most other vegetable crops, but substantial progress has still been made. CN 104004828 A discloses a SCAR marker for onion cytoplasmic male sterility, which can amplify 2175 bp and 1053 bp in S-type cytoplasm, and 1053 bp in N-type cytoplasm. CN 119639943 A discloses an InDel marker based on HRM technology for identifying onion cytoplasmic genotypes and its application. This marker distinguishes onion cytoplasmic types by analyzing melting curves. If the DNA amplification of the onion material shows a melting curve peak at 85℃, the cytoplasmic type is S-type; if it shows a melting curve peak at 84℃, the onion material is N-type cytoplasm. These markers can all distinguish cytoplasmic types, but they also have shortcomings. Compared with SCAR markers, HRM markers are simpler to screen, and only the melting curve needs to be analyzed after the PCR reaction to determine the type of onion cytoplasm. Although HRM is sensitive, subtle differences in the melting curve may be affected by factors such as DNA quality, salt ion concentration, and instrument calibration. When the sample size is very large, subtle systematic errors may be amplified, making it difficult to interpret critical samples. This may require manual verification or sequencing, increasing costs and time. Summary of the Invention

[0006] The purpose of this invention is to address the problems existing in the prior art. Through long-term technical and practical exploration, this invention provides a KASP marker for rapid identification of cytoplasmic types in large populations of onions and its applications. This technology features high specificity, high repeatability, high throughput, and high accuracy, and will play an important role in the detection of onion cytoplasmic genotypes in large populations, thus possessing significant practical application value. It can accelerate the breeding of new onion cytoplasmic male-sterile lines and establish a novel parental selection system for onion hybrids.

[0007] The applicant downloaded the chloroplast genomes of onion N-type cytoplasm (GenBank: KF728080) and S-type cytoplasm (GenBank: KF728079) from an article published by Von Kohn C. The size difference between N-type and S-type chloroplast DNA is mainly due to small fragment insertions or deletions in intergenic regions. Furthermore, compared to S-type cytoplasm, N-type onions have a 45 bp deletion in the accD gene, thus providing a method for distinguishing between fertile and male-sterile cytoplasm in onions. Based on the single nucleotide polymorphisms and flanking sequences in the chloroplast genes of N-type and S-type onion cytoplasm, a unique set of KASP primers was designed. This invention is based on a KASP marker for rapidly identifying cytoplasmic types in large populations of onions. Results were validated on cytoplasmic types of 48 known onion materials. The results show that onion cytoplasmic types can be clearly and effectively distinguished, greatly improving selection efficiency and saving time and cost. It will play an important role in the large-scale detection of onion cytoplasmic genotypes and therefore has good practical application value.

[0008] This invention is achieved through the following technical solution: This invention provides a KASP marker for rapid identification of fertility in large numbers of onion cytoplasm cells. The primer nucleotide sequences for amplifying the KASP marker are as follows: SEQIDN0:1(KASP-N):5'-CATGTATGATACTAAATCTGGTTGGAG-3'; SEQIDN0: 2 (KASP-S): 5' -CATGTATGATACTAAATCTGGTTGGAA - 3'; SEQIDN0: 3 (KASP-C): 5' - GAATACTGATTTCAAAACGAAGATAAC - 3'; The 5' end of sequence SEQ IDN0:1 is designed with a first fluorescent tag, and the 5' end of sequence SEQ IDN0:2 is designed with a second fluorescent tag; the first fluorescent tag is FAM, and the second fluorescent tag is HEX. Therefore, the primer nucleotide sequences used to amplify the KASP-labeled sequence are as follows: SEQIDN0:4: The underlined portion is the FAM fluorescent tag sequence. 5'- GAAGGTGACCAAGTTCATGCT CATGTATGATACTAAATCTGGTTGGAG- 3'; SEQ ID NO: 5: The underlined portion is the HEX fluorescent tag sequence. 5'- GAAGGTCGGAGTCAACGGATT CATGTATGATACTAAATCTGGTTGGAA- 3'; SEQIDN0: 3 (KASP-C): 5' - GAATACTGATTTCAAAACGAAGATAAC - 3'; The KASP marker provided by this invention is used to identify the fertility of a large number of onion cytoplasm cells.

[0009] A rapid method for identifying the fertility of a large number of onion cytoplasm cells, the specific steps of which are as follows: (1) Extract total DNA from onion leaves; (2) Transfer the sample from the 96-well plate to the 384-well plate, ensuring that the final concentration of sample DNA is 10 ng / μl; (3) Establish a PCR reaction system and operate on ice to maintain enzyme activity.

[0010] (4) Seal the well plate containing the reaction system and centrifuge at low speed; (5) After centrifugation, PCR reaction was performed. The PCR reaction program included: 94℃ pre-denaturation for 20 min; 94℃ denaturation for 20 s, annealing at 65-57℃ for 1 min, with a decrease of 0.8℃ per cycle, for 10 cycles; and 94℃ denaturation for 20 s, annealing at 57℃ for 1 min, for 32 cycles. (6) After the PCR program is completed, the plate is read using an ELISA reader (TECAN Infinite M1000). The online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) is used to analyze the scan data and convert it into fluorescence signals to obtain a clear and intuitive genotyping diagram. The genotype results are output according to the different colors.

[0011] The above identification method is applied in the selection of onion cytoplasmic types.

[0012] A detection kit comprising amplification primers labeled with the KASP nucleotide sequence SEQ ID NO: 1-5.

[0013] The detection kit also includes fluorescent probes and reagents required for PCR system construction.

[0014] Beneficial effects: (1) Rapid, efficient and high-throughput: The KASP marker primers of this invention can be used to detect the genotype of onion cytoplasm. They can be used for high-throughput PCR in 96-well, 384-well and 1536-well plates. The cytoplasm type can be quickly and efficiently determined by reading the data after plate reading, which greatly improves the detection efficiency, reduces time and labor costs, and is very beneficial for high-throughput genotyping selection of onion field breeding materials. It is also particularly suitable for the operation of large numbers of samples.

[0015] (2) Stable and convenient labeling: The identification results of onion materials with known cytoplasmic genotypes were completely consistent with the phenotypes. Compared with existing SCAR and HRM labels, the KASP label primer screening method in the above technical solution is simple and easy to implement. After the PCR reaction, no electrophoresis or melting curve analysis is required to determine the type of onion cytoplasm. The onion cytoplasmic typing type can be determined by reading the fluorescence signal, with extremely high accuracy (>99.5%). During operation, the tube is closed (the cap is not opened after sample addition), which is not easily affected by primer dimers or non-specific amplification, greatly reducing human error and the risk of cross-contamination. This is crucial for verifying the effectiveness of a label. Attached Figure Description

[0016] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The explicit embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0017] Figure 1 This is a genotyping cluster diagram of the KASP molecular markers in this invention, where green fluorescent clusters represent S-type cytoplasm and blue fluorescent clusters represent N-type cytoplasm. Figure 2 This invention validates the detection results of KASP markers using mature SCAR molecular markers, where 1-24 are N-type cytoplasm and 25-48 are S-type cytoplasm. Detailed Implementation

[0018] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, the embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0019] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0020] The experimental materials used in this invention are shown in Table 1 below: Table 1 Experimental materials used in this invention

[0021] The reagents and instruments used in this invention are as follows: Reagents used: 0.3M sodium hydroxide (1L); 0.2M Tris-HCl (1L, pH 6.8-7.0); 2*PARMS mastermix (manufacturer: Wuhan Jingtai Biotechnology Co., Ltd., catalog number: GA01001); primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0022] Instruments used: Ultra-high throughput tissue homogenizer (JXFSTPRP-576) purchased from Shanghai Jingxin Industrial Development Co., Ltd.; high-speed centrifuge (5810) purchased from Eppendorf AG, Germany; water bath (WB100-4) purchased from Qun'an Scientific Instruments (Zhejiang) Co., Ltd.; dual-head 384-well PCR instrument (ABI GeneAmp9700) purchased from Thermo Fisher Scientific (China) Co., Ltd.; microplate reader (TECAN infinite M1000) purchased from Tecan (Shanghai) Trading Co., Ltd.

[0023] Example 1: Establishment of KASP Marking and Detection Method (a) Obtaining KASP-labeled primer sequences The applicant downloaded the chloroplast genomes of onion N-type cytoplasm (GenBank: KF728080) and S-type cytoplasm (GenBank: KF728079) from an article published by Von Kohn C. The size difference between N-type and S-type chloroplast DNA is mainly due to small fragment insertions or deletions in intergenic regions. Furthermore, compared to S-type cytoplasm, N-type onions have a 45 bp deletion in the accD gene, thus providing a clue for distinguishing between fertile and male-sterile cytoplasm in onions. Based on the single nucleotide polymorphisms and flanking sequences in the chloroplast genes of N-type and S-type onion cytoplasm, a unique set of KASP primers was designed. The primers consist of two upstream primers (F1, F2) and one downstream primer (R1), with the primer nucleotide sequences shown below: SEQIDN0.1 (KASP-N): 5' -CATGTATGATACTAAATCTGGTTGGAG - 3'; SEQIDN0.2 (KASP-S): 5' -CATGTATGATACTAAATCTGGTTGGAA - 3'; SEQIDN0.3 (KASP-C): 5' - GAATACTGATTTCAAAACGAAGATAAC - 3'; Both upstream primers have fluorescent tag sequences attached to their 5' ends and allelic variations of G or A at their 3' ends. Primer F1 has a FAM fluorescent tag sequence attached to its 5' end: 5'-GAAGGTGACCAAGTTCATGCT-3', and primer F2 has a HEX fluorescent tag sequence attached to its 5' end: 5'-GAAGGTCGGAGTCAACGGATT-3'. All primer sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0024] Therefore, the primer nucleotide sequence used for amplifying the KASP marker is as follows: SEQ ID NO.4: The underlined portion is the FAM fluorescent tag sequence. 5'- GAAGGTGACCAAGTTCATGCT CATGTATGATACTAAATCTGGTTGGAG- 3'; SEQ ID NO. 5: The underlined portion is the HEX fluorescent tag sequence. 5'- GAAGGTCGGAGTCAACGGATT CATGTATGATACTAAATCTGGTTGGAA- 3'; SEQIDN0.3 (KASP-C): 5' - GAATACTGATTTCAAAACGAAGATAAC - 3'; (ii) Detection of KASP markers 1. DNA extraction Onion leaves approximately 1 cm in length and width were placed in a 96-well deep plate. 100 μl of 0.3 M sodium hydroxide was added, and the sample was ground at 50 Hz for 2 minutes using a Shanghai Jingxin tissue homogenizer (until completely ground). After grinding, the sample was centrifuged at 3000 rpm for 1 minute and then placed in boiling water for 2 minutes. After the water bath, 200 µL of 0.2 M Tris-HCl (pH 6.8-7.0) was added and mixed well, then the sample was placed in boiling water again for 2 minutes. After the water bath, the sample was centrifuged at 3000 rpm for 1 minute. The supernatant was diluted 20-fold, and the purity and concentration of the extracted DNA were determined using a micro spectrophotometer. The DNA showed a significant absorption peak at OD260, with an OD260 / OD280 ratio between 1.7 and 1.9. This confirmed the reliability of the extracted total DNA sample. The sample was stored at -20℃ and used as a template for subsequent PCR amplification.

[0025] 2. PCR amplification PCR amplification was performed on a 384-well PCR instrument (ABI GeneAmp9700) from Thermo Fisher Scientific (China) Co., Ltd. The detection system consisted of a 10 μL volume: 5 μL of 2*PARMS master mix, 0.15 μL each of F1 and F2 (10 μM), 0.4 μL of R1, 1 μL of DNA template, and 3.3 μL of nuclease-free water. The reaction program was as follows: 94℃ pre-denaturation for 20 min; 94℃ denaturation for 20 s, annealing at 65-57℃ for 1 min, decreasing the temperature by 0.8℃ per cycle, for 10 cycles; 94℃ denaturation for 20 s, annealing at 57℃ for 1 min, for 32 cycles. PCR products were stored at 4℃.

[0026] 3. Detection and analysis of PCR products After the PCR procedure was completed, the plate was read using a microplate reader (TECAN Infinite M1000). The online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was used to analyze the scanned data and convert it into fluorescence signals, obtaining a clear and intuitive genotyping diagram. The genotype results were output based on the color. If the fluorescence signal data of the amplification product of the tested individual is marked with blue dots after analysis by snpdecoder, the genotype of the onion cytoplasm is N; if the fluorescence signal of the amplification product of the tested individual is marked with green dots, the genotype of the onion cytoplasm is S. Figure 1 ).

[0027] Example 2 uses SCAR molecular markers to verify the detection results of KASP molecular markers.

[0028] The results of the above-mentioned test materials were evaluated using the developed SCAR molecular marker, which can accurately identify the genotype of onion cytoplasm. The specific method for detecting onion cytoplasmic genotype using the SCAR molecular marker is described in the authorized invention patent ZL201410153951.2. Details are as follows: PCR amplification primers for identifying whether the material is an onion and labeled with SCAR: OC2175-F: 5'-ATGCCACTTCTCCTTCCTCATATGGT-3' (SEQ ID NO.6); OC2175-R:5'-CCAAGGATTGCCAAGCATTTGGCACTGAC-3' (SEQ ID NO.7); PCR products were separated by electrophoresis on a 1.5% agarose gel at a constant voltage of 130 V for 45 min. Ethidium bromide staining was performed, and images were taken and analyzed using a gel imaging system. Results are shown below. Figure 2 The results of gel imaging are as follows: if the PCR test results show both 2175bp and 1053bp target bands, the cytoplasmic genotype is S; if the PCR test results show only the 1053bp target band, the cytoplasmic genotype is N. It is evident that the judgment results of this invention are completely consistent with the KASP typing results of this invention.

[0029] Finally, it should be noted that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of them. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. Although the specific embodiments of the present invention have been described above in conjunction with the accompanying drawings, this is not a limitation on the protection scope of the present invention. Those skilled in the art should understand that various modifications or variations that can be made by those skilled in the art without creative effort based on the technical solutions of the present invention are still within the protection scope of the present invention.

Claims

1. A KASP molecular marker for rapid identification of cytoplasmic fertility in large populations of onion cells, characterized in that, The primer nucleotide sequences used to amplify the KASP molecular marker are shown in SEQ No: 1, SEQ No: 2 and SEQ No:

3.

2. The KASP molecular marker according to claim 1, characterized in that, The 5' ends of the sequences SEQ No: 1 and SEQ No: 2 are also designed with fluorescent tags; the 5' end of the sequence SEQ No: 1 is designed with a first fluorescent tag, and the 5' end of the sequence SEQ No: 2 is designed with a second fluorescent tag; the first fluorescent tag is FAM, and the second fluorescent tag is HEX.

3. The application of the KASP molecular marker amplification primers as described in claim 1 or 2 in the rapid identification of cytoplasmic fertility in large populations of onion.

4. A method for rapidly identifying the cytoplasmic fertility of a large population of onions, characterized in that, The method includes: The genomic DNA of the onion material to be tested was amplified by PCR using the amplification primers based on the KASP molecular marker described in claim 2; the genotype of the polymorphic sites in the PCR amplification product was detected and determined.

5. The method according to claim 4, characterized in that, The PCR amplification reaction program includes: 94℃ pre-denaturation for 20 min; 94℃ denaturation for 20 s, annealing at 65-57℃ for 1 min, decreasing by 0.8℃ per cycle, for 10 cycles; 94℃ denaturation for 20 s, annealing at 57℃ for 1 min, for 32 cycles.

6. The method according to claim 4 or 5, characterized in that, The method includes the following steps: a) Extract total DNA from the plant material to be tested; b) Transfer the sample from the 96-well plate to the 384-well plate, ensuring the final DNA concentration is 10 ng / μL; c) Establish a PCR reaction system and operate on ice to maintain enzyme activity. d) Seal the well plate containing the reaction mixture and centrifuge at low speed. e) After centrifugation, PCR reaction was performed. The PCR reaction program included: 94℃ pre-denaturation for 20 min; 94℃ denaturation for 20 s, annealing at 65-57℃ for 1 min, decreasing the temperature by 0.8℃ per cycle, for 10 cycles; and 94℃ denaturation for 20 s, annealing at 57℃ for 1 min, for 32 cycles. f) After the PCR procedure is completed, the plate is read using an ELISA reader. The online software snpdecoder is used to analyze the scanned data and convert it into fluorescence signals to obtain a clear and intuitive genotyping diagram. The genotype results are output according to the different colors.

7. The application of the identification method according to any one of claims 4-5 in the selection of onion cytoplasmic types.

8. A test kit, characterized in that, The detection kit contains the KASP-labeled amplification primers as described in claim 2.

9. The detection kit according to claim 8, characterized in that, The detection kit also includes fluorescent probes and reagents required for PCR system construction.

Images