Application of a molecular marker closely linked to relative maximum root length under salt stress in wheat breeding

Abstract

This invention discloses the application of a molecular marker closely linked to the relative maximum root length under salt stress in wheat breeding, belonging to the field of wheat molecular marker breeding technology. This molecular marker can be amplified using a KASP marker primer set consisting of SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. Different fluorescent markers are set at the 5' ends of SEQ ID NO:3 and SEQ ID NO:4. When the fluorescence of the PCR product is consistent with the fluorescent markers of SEQ ID NO:3 / SEQ ID NO:4, the wheat haplotype is... TaPHR1‑6A‑Hap Ⅰ / TaPHR1‑6A‑Hap ⅠI , TaPHR1‑6A‑Hap Ⅰ Haplotype wheat possesses a gene that increases the relative maximum root length under salt stress, and it is predicted that the relative maximum root length of this haplotype wheat under salt stress will be longer than that of another haplotype wheat.

Description

Technical Field

[0001] This invention relates to the application of a molecular marker, specifically to the application of a molecular marker closely linked to the relative maximum root length under wheat salt stress in wheat breeding, belonging to the field of wheat molecular marker breeding technology. Background Technology

[0002] As one of the world's major food crops, wheat's yield and quality are directly related to food security. Soil salinization is a significant factor limiting wheat production, affecting approximately 20% of irrigated farmland globally and leading to a significant decline in wheat yields. Therefore, developing salt-tolerant wheat varieties is an important way to address the challenges of salinization and increase wheat production.

[0003] Salt tolerance in wheat is a complex quantitative trait regulated by multiple genes. These genes are involved in various physiological processes, including ion balance, osmotic regulation, and antioxidant defense. Traditional breeding methods rely on phenotypic selection, but because salt tolerance is greatly influenced by the environment, phenotypic selection is inefficient and time-consuming. Therefore, developing molecular markers related to wheat salt tolerance can accelerate the breeding process of salt-tolerant wheat varieties.

[0004] Molecular marker technology is an important tool in modern agricultural breeding, enabling the direct detection of genes or genomic regions associated with target traits. Commonly used molecular markers include SSRs (simple sequence repeats), SNPs (single nucleotide polymorphisms), and AFLPs (amplified fragment length polymorphisms). These marker technologies have been widely applied in wheat genetic diversity analysis, gene mapping, and marker-assisted selection.

[0005] In recent years, with the rapid development of genomics and bioinformatics technologies, researchers have identified numerous QTLs (quantitative trait loci) and candidate genes related to salt tolerance in wheat. However, the number of existing molecular markers is limited, and the stability and applicability of most markers still require further validation. Therefore, developing molecular markers related to wheat salt tolerance traits can not only provide efficient and stable molecular tools for wheat salt tolerance breeding, but the application of these markers will also significantly improve the efficiency and accuracy of wheat salt tolerance breeding, making an important contribution to addressing the global challenge of soil salinization and ensuring food security. Summary of the Invention

[0006] The purpose of this invention is to provide a molecular marker closely linked to the relative maximum root length of wheat under salt stress and its application in wheat breeding. This molecular marker can be used to predict the relative maximum root length trait of wheat under salt stress or to breed wheat with genes that increase the relative maximum root length under salt stress, thereby accelerating the breeding process of salt-tolerant new wheat varieties.

[0007] To achieve the above objectives, the present invention adopts the following technical solution: The application of a molecular marker closely linked to the relative maximum root length of wheat under salt stress in wheat breeding, wherein the molecular marker can be amplified by a KASP marker primer set consisting of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, wherein the 5' ends of the two primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 are respectively set with different fluorescent markers; The application involves selecting wheat varieties with genes that increase relative maximum root length under salt stress or predicting the relative maximum root length trait in wheat under salt stress. Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the aforementioned KASP-labeled primer set. After amplification, the fluorescence signal of the PCR amplification product is detected. When the fluorescence emitted by the PCR amplification product matches the fluorescent label carried by the primers shown in SEQ ID NO: 3, the wheat to be tested... TaPHR1-6A The base at 358bp of the gene is A, and the haplotype is TaPHR1-6A-Hap I When the fluorescence emitted by the PCR amplification product matches the fluorescent label carried by the primers shown in SEQ ID NO: 4, the wheat to be tested... TaPHR1-6A The base at 358bp of the gene is G, and the haplotype is TaPHR1-6A-Hap II ; TaPHR1- 6A-Hap I Haplotype wheat possesses a gene that increases the relative maximum root length under salt stress. TaPHR1-6A-Hap II Haplotype wheat does not possess genes that increase relative maximum root length under salt stress, predicting... TaPHR1-6A-Hap I The relative maximum root length of haploid wheat under salt stress was relatively lower TaPHR1-6A-Hap II Haploid wheat is long.

[0008] The advantages of this invention are: (1) This invention is based on chromosome 6A in natural wheat populations. TaPHR1-6A Genetic variation analysis revealed a SNP locus associated with the relative maximum root length trait in wheat under salt stress, and a molecular marker closely linked to this SNP locus was developed. This molecular marker can quickly and accurately determine whether wheat has a gene that increases the relative maximum root length under salt stress, accurately predict the relative maximum root length trait in wheat under salt stress, and provide excellent gene resources and selection tools for molecular breeding of wheat salt tolerance traits. (2) Applying the molecular markers developed in this invention to wheat molecular breeding can greatly reduce the workload of phenotypic identification and can be used in wheat seedling stage, which saves breeding costs and improves breeding efficiency. Attached Figure Description

[0009] Figure 1 This invention is used to analyze some materials from natural wheat populations based on the molecular markers developed in this invention. TaPHR1-6AThe haplotype typing results are shown in the image, where red dots represent wheat. TaPHR1-6A The haplotype of the gene is TaPHR1-6A-Hap I (The SNP site has base A, and the genotype is AA). Blue dots represent wheat. TaPHR1-6A The haplotype of the gene is TaPHR1-6A- Hap II (The SNP site has a base of G, and the genotype is GG). Figure 2 The figure shows the results of single-marker analysis of relative maximum root length under salt stress during the seedling stage for all materials in the natural wheat population based on the molecular markers developed in this invention. ** indicates extremely significant differences (p≤0.01). Detailed Implementation

[0010] The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0011] I. Obtaining SNP loci The wheat genome variation joint database (http: / / wheat.cau.edu.cn / WheatUnion / b_4 / ) was used to analyze wheat... TaPHR1-6A Haplotype network prediction analysis was performed on the gene (gene ID: TraesCS6A02G108800.1, chromosome location: 6A, functional region: 77536825:77540134), revealing two haplotypes. Based on sequence differences, the two haplotypes were named... TaPHR1-6A-Hap I , TaPHR1-6A-Hap II ,in, TaPHR1-6A-Hap I The sequence of the haplotype is shown in SEQ ID NO: 1. TaPHR1-6A-Hap II The sequence of the haplotype is shown in SEQ ID NO: 2.

[0012] TaPHR1-6A-Hap I , TaPHR1-6A-Hap II There is one SNP variation in both haplotypes, specifically an A / G base variation at 358bp.

[0013] II. Verifying the SNP differences between the two haplotypes To verify the natural population polymorphism of the above SNP sites, 16 wheat natural population materials preserved in the laboratory were randomly selected, and the target fragments were amplified by PCR under the PCR amplification system listed in Table 1 and the PCR amplification program listed in Table 2.

[0014] Table 1 PCR amplification system

[0015] The nucleotide sequences of the upstream and downstream primers are as follows: Upstream primer (5'→3'): TTTGCCTTTCCTGCCTCAT (SEQ ID NO: 8); Downstream primer (5'→3'): TGCTCACTGAAATCCATGGAA (SEQ ID NO: 9).

[0016] Table 2 PCR amplification program

[0017] After PCR amplification, all PCR products were recovered, purified, and sequenced.

[0018] The actual sequence was compared with the sequence in the Ensembl Plants database (https: / / plants.ensembl.org / Triticum_aestivum / Info / Index) and the results confirmed that the above SNP sites do indeed have A / G base variations in the tested natural population.

[0019] III. Development of Molecular Markers Based on the A / G base variations at the aforementioned SNP sites, and in conjunction with the Chinese spring wheat reference genome sequence RefSeq v2.1, a KASP marker primer set was designed using the Wheat Alliance. This KASP marker primer set consists of two front primers (denoted as Allele 1 and Allele 2, respectively) and one back primer (denoted as Common), all of which are single-stranded DNA molecules. The nucleotide sequence of Allele 1 (5'→3') is as follows: GAAGGTGACCAAGTTCATGCTCTGCTGATCACAGCGATGGTA (SEQ ID NO: 3); The nucleotide sequence of Allele 2 (5'→3') is as follows: GAAGGTCGGAGTCAACGGATTCTGCTGATCACAGCGATGGTG (SEQ ID NO: 4); The nucleotide sequence of Common (5'→3') is as follows: GGAAGTCCTTGAGATCATGTGAA (SEQ ID NO: 5).

[0020] The 5' ends of the two preprimes, Allele 1 and Allele 2, are respectively marked with different fluorescent labels. In this specific embodiment, the 5' end of Allele 1 is marked with FAM (5-carboxyfluorescein, a green fluorescent dye), and the 5' end of Allele 2 is marked with HEX (hexachlorofluorescein, a yellow-green fluorescent dye).

[0021] The nucleotide sequences (5'→3') of the products obtained by PCR amplification using the Allele 1 front primer and the Common back primer are as follows: GAAGGTGACCAAGTTCATGCTCTGCTGATCACAGCGATGGTAGTCAAGGTCATGATGAACATTCACATGATCTCAAGGACTTCC (SEQ ID NO: 6).

[0022] The nucleotide sequences (5'→3') of the products obtained by PCR amplification using the Allele 2 primer and the Common primer are as follows: GAAGGTCGGAGTCAACGGATTCTGCTGATCACAGCGATGTGGTCAAGGTCATGATGAACATTCACATGATCTCAAGGACTTCC (SEQ ID NO: 7).

[0023] IV. Genotypic Analysis of Natural Wheat Populations Using Molecular Markers 1. PCR amplification Using genomic DNA from 124 wheat samples as templates, PCR amplification was performed using the aforementioned KASP primer set (Allele 1, Allele 2, and Common) with fluorescent labels.

[0024] PCR amplification system: 1.0 μL of wheat genomic DNA (100 ng / μL), 5.0 μL of HiGeno 2x ProbeMix (Beijing Jiacheng Biotechnology Co., Ltd.), 0.4 μL of primer mixture, and ddH2O to bring the total volume to 10 μL.

[0025] The primer mixture was prepared as follows: 12 μL of Allele 1 (with FAM at the 5' end), 12 μL of Allele 2 (with HEX at the 5' end) and 30 μL of Common were mixed. The concentrations of Allele 1, Allele 2 and Common were all 100 μM. ddH2O was added to bring the total volume to 100 μL.

[0026] PCR amplification program: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 s, annealing and extension at 61-55℃ for 40 s, 10 cycles, decreasing by 0.6℃ per cycle; 95℃ denaturation for 20 s, annealing and extension at 55℃ for 40 s, 28 cycles; store at 4℃.

[0027] 2. Fluorescence signal scanning and analysis After PCR amplification, the fluorescence signals of the PCR amplification products were collected using a real-time fluorescence quantitative instrument (Bio-Rad C1000 TouchThermal Cycler). The excitation wavelength of FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength of HEX was 535 nm and the emission wavelength was 556 nm; the excitation wavelength of the system reference fluorescence ROX was 575 nm and the emission wavelength was 610 nm.

[0028] Based on the collected fluorescence signals, the wheat samples were genotyped, and the genotyping data was read using commonly used fluorescence genotyping software (Bio-Rad CFX Maestro software). Specifically: (1) When the fluorescence emitted by the PCR amplification product is green (consistent with the fluorescent dye carried by the preprime Allele 1), the base of the wheat sample at the above SNP site is A, the genotype is AA, and the corresponding haplotype is TaPHR1-6A-Hap I (abbreviated as) Hap I The fluorescence typing software reads the typing data and displays it as a red dot.

[0029] (2) When the fluorescence emitted by the PCR amplification product is yellow-green (consistent with the fluorescent dye carried by the preprime Allele 2), the base of the wheat sample at the above SNP site is G, the genotype is GG, and the corresponding haplotype is TaPHR1-6A-Hap II (abbreviated as) Hap II The fluorescence typing software reads the typing data and displays it as blue dots.

[0030] Using the 124 natural wheat populations listed in Tables 3-1 to 3-3 as experimental materials, the above-mentioned KASP-labeled primer sets (Allele 1, Allele 2, and Common) with fluorescent labels were used to... TaPHR1-6A Gene haplotype typing was performed; haplotype typing results for some materials are shown below. Figure 1 .

[0031] The results show that wheat based on the KASP marker developed in this invention... TaPHR1-6A The haplotype typing results were good.

[0032] All materials from natural wheat populations (124 accessions) were analyzed based on the KASP markers developed in this invention. TaPHR1-6A The results of haplotype typing are shown in Tables 3-1 to 3-3.

[0033] Table 3-1 Natural wheat populations TaPHR1-6A Haplotype typing results (Part 1)

[0034] Table 3-2 Natural wheat populations TaPHR1-6A Haplotype typing results (Part 2)

[0035] Table 3-3 Natural wheat populations TaPHR1-6A Haplotype typing results (Part 3) The typing results above show that the KASP-labeled primer set (Allele 1, Allele 2, and Common) with fluorescent labels can be used to genotype different wheat materials. TaPHR1-6A The gene was clearly divided into two haplotypes, indicating that the KASP marker developed in this invention was successfully developed and can be further applied to the detection of wheat breeding materials.

[0036] V. Correlation Analysis between Molecular Markers and Relative Maximum Root Length in Wheat under Salt Stress Using the 124 natural wheat populations listed in Tables 3-1 to 3-3 as experimental materials, 30 plump seeds from each population were placed in petri dishes lined with moistened germination paper. An equal amount of distilled water was added to each dish to ensure germination rate and uniformity. The petri dishes were placed in a 4℃ refrigerator for 3 days, then placed in the dark at room temperature until germination. After germination, the petri dishes were placed in an artificial climate chamber for 2 days (the artificial climate chamber was set as follows: 23℃ + light for 16 hours; 18℃ + darkness for 8 hours). Seedlings with uniform growth after 2 days of germination were transferred to hydroponic boxes, with 1 / 2 Hoagland nutrient solution added. A control group and a salt treatment group were set up. The nutrient solution was changed every 2 days. On day 7 of germination, the salt treatment group was treated with 250 mM NaCl, while the control group continued normal cultivation. On day 7 of salt treatment, seedlings of similar growth in both the control and salt-treated groups were selected for root length phenotyping. The relative maximum root length for each sample was then calculated (relative maximum root length under salt stress = mean maximum root length in the salt-treated group / mean maximum root length in the control group) to assess the impact of salt stress on wheat growth. Based on the previously calculated phenotypic data of relative maximum root length in the natural wheat population under salt stress, [further details are needed]. TaPHR1-6A-Hap I , TaPHR1-6A-Hap II The relative maximum root length of the two haplotype wheat under salt stress was analyzed for significance (SPSS software was used to perform correlation analysis on the relative maximum root length data of the two haplotypes to determine whether there was a significant difference; if the difference was significant, a box plot was drawn).

[0037] The results of the significance analysis of the relative maximum root length differences under salt stress in all wheat natural population materials (124 accessions) based on the molecular markers developed in this invention are shown in Table 4 and . Figure 2 .

[0038] Table 4. Significance analysis of the relative maximum root length differences between the two haplotype wheat varieties under salt stress.

[0039] From Table 4 and Figure 2 It can be seen that, TaPHR1-6A-Hap I Haploid wheat ( TaPHR1-6A The gene with base A at the SNP site and genotype AA) had a significantly higher relative maximum root length after salt stress during the seedling stage than... TaPHR1-6A-Hap II Haploid wheat ( TaPHR1-6A The gene has a base of G at the SNP site and a genotype of GG), p≤0.01.

[0040] The above results demonstrate that the molecular marker developed in this invention is closely linked to the relative maximum root length of wheat under salt stress, and this molecular marker can be effectively applied to the molecular marker-assisted selection breeding program for the relative maximum root length of wheat under salt stress.

[0041] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.

Claims

1. The application of a molecular marker tightly linked to the relative maximum root length under wheat salt stress in wheat breeding, characterized by: The molecular marker can be amplified by the KASP marker primer set consisting of SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, wherein the 5' ends of the two primers shown in SEQ ID NO: 3 and SEQ ID NO: 4 are respectively set with different fluorescent markers. The application involves selecting wheat varieties with genes that increase relative maximum root length under salt stress or predicting the relative maximum root length trait in wheat under salt stress. Using the genomic DNA of the wheat to be tested as a template, PCR amplification is performed using the aforementioned KASP-labeled primer set. After amplification, the fluorescence signal of the PCR amplification product is detected. When the fluorescence emitted by the PCR amplification product matches the fluorescent label carried by the primers shown in SEQ ID NO: 3, the wheat to be tested... TaPHR1-6A The base at 358bp of the gene is A, and the haplotype is TaPHR1- 6A-Hap Ⅰ When the fluorescence emitted by the PCR amplification product matches the fluorescent label carried by the primers shown in SEQ ID NO: 4, the wheat to be tested... TaPHR1-6A The base at 358bp of the gene is G, and the haplotype is TaPHR1-6A-Hap ⅠⅠ ; TaPHR1-6A-Hap Ⅰ Haplotype wheat possesses a gene that increases the relative maximum root length under salt stress. TaPHR1-6A-Hap ⅠI Haplotype wheat does not possess genes that increase relative maximum root length under salt stress, predicting... TaPHR1-6A-Hap Ⅰ The relative maximum root length of haploid wheat under salt stress was relatively lower TaPHR1-6A-Hap ⅠI Haploid wheat is long.

Images