A system for detecting prostate specific membrane antigen in urine and a method thereof

Abstract

This invention relates to a system and method for detecting prostate-specific membrane antigen (PSA) in urine, belonging to the field of tumor detection and biosensing technology. The system for detecting PSA in urine includes a signal recognition module, a signal amplification module, a signal reporting module, and a signal readout module. The signal recognition module includes a single-stranded DNA activation strand that is partially complementary to the specific aptamer of PSA. The signal amplification module includes a Cas12a-crRNA complex. The signal reporting module includes an HCG-ssDNA-magnetic bead complex. The signal readout module is a lateral flow chromatography test strip coated with anti-HCG antibody. The system and method of this invention are simple, rapid, non-invasive, and low-cost, enabling preliminary screening of prostate cancer risk at home or in primary healthcare institutions. It can also be used as a clinical auxiliary diagnostic tool for monitoring the efficacy of prostate cancer treatment and for early warning of recurrence.

Description

Technical Field

[0001] This invention relates to the field of tumor detection and biosensing technology, and in particular to a system and method for detecting prostate-specific membrane antigens in urine. Background Technology

[0002] Prostate cancer is one of the most common malignant tumors in men. In recent years, the incidence and mortality rates of prostate cancer in my country have shown a significant upward trend, with the incidence rate doubling in the past five years and the mortality rate increasing by 160%. Clinical data shows that 70% of prostate cancer patients in my country are already in the late stage when diagnosed, missing the best opportunity for radical treatment. The lack of accurate and widely available early diagnostic methods is the core reason for this treatment dilemma.

[0003] Currently, the core indicator for early screening and auxiliary diagnosis of prostate cancer in clinical practice is serum prostate-specific antigen (PSA). However, this detection method has significant specificity limitations. Clinical data shows that the overall specificity of early screening methods based on peripheral blood PSA is only 40%; especially when the PSA test value is in the clinical "gray area" of 4-10 ng / mL, its specificity further drops to 25%, with a false diagnosis rate as high as 75%. The excessively high false positive rate directly leads to a large number of subjects undergoing unnecessary prostate biopsies, placing additional physiological and psychological burdens on patients and causing an unreasonable consumption of medical resources.

[0004] Prostate biopsy is currently the gold standard for diagnosing prostate cancer. However, as an invasive procedure, it has inherent and unavoidable drawbacks: on the one hand, the procedure may cause complications such as bleeding and infection, posing clear medical risks; on the other hand, biopsy has significant sampling errors, which may lead to missed diagnoses due to factors such as lesion location and sampling site. Furthermore, it cannot be repeatedly used as a primary screening method for large populations. Based on this clinical situation, there is an urgent need in the industry for a non-invasive, convenient, and more specific auxiliary diagnostic tool for prostate cancer, used for initial screening and risk assessment in the population, thereby reducing unnecessary biopsy procedures from the outset.

[0005] Prostate-specific membrane antigen (PSMA) offers a superior target for prostate cancer diagnosis. PSMA is a type II transmembrane glycoprotein. Studies have shown that PSMA is specifically highly expressed on the surface of prostate cancer cells, particularly in high-grade and metastatic prostate cancer cells, where its expression level is significantly upregulated. In contrast, its expression level is extremely low in benign prostate tissue and other normal tissues. This highly specific expression characteristic makes PSMA a core biomarker for prostate cancer with superior specificity compared to PSA.

[0006] Currently, the PSMA detection technologies used in clinical practice have significant limitations. Existing PSMA detection methods are mainly divided into two categories: one is immunohistochemical detection based on prostate biopsy specimens, which requires invasive procedures to obtain tissue specimens and cannot be used for early screening and continuous dynamic monitoring of the disease; the other is PSMA PET-CT imaging technology based on radionuclide labeling, which suffers from high detection costs, complex procedures, and the risk of radiation exposure, and cannot be applied to large-scale prostate cancer screening.

[0007] Urine samples possess inherent advantages such as being completely non-invasive, repeatable, and having high patient compliance, making them an ideal sample type for large-scale early disease screening. Existing studies have confirmed that prostate-derived exosomes, cellular debris, and other biological components can enter urine, and these components carry PSMA protein, providing a solid theoretical basis for the detection of PSMA in urine. However, currently, there are no mature, commercially available rapid PSMA testing products based on urine samples globally, failing to meet the core clinical needs for non-invasive, highly specific, and widely accessible early screening and auxiliary diagnosis of prostate cancer, thus becoming a pressing technical problem to be solved in this field. Summary of the Invention

[0008] To address the aforementioned technical problems, this invention provides a system and method for detecting prostate-specific membrane antigens (PSA) in urine. Specifically, it comprises a PSA detection system and method that utilizes aptamer signal conversion, CRISPR / Cas12a signal amplification, magnetic bead complex signal reporting, and lateral flow test strip signal output to detect a protein recognition event. The method of this invention is simple, rapid, non-invasive, and low-cost, enabling preliminary screening for prostate cancer risk at home or in primary healthcare institutions. It can serve as a clinical auxiliary diagnostic tool, improving the specificity of prostate cancer diagnosis and complementing PSA testing. It can also be used for efficacy monitoring and recurrence warning after prostate cancer treatment (such as surgery, radiotherapy, and endocrine therapy). The PSA detection method of this invention has advantages such as being non-invasive, highly sensitive, highly specific, and easy to operate.

[0009] This invention is achieved through the following technical solution: The first objective of this invention is to provide a system for detecting prostate-specific membrane antigens in urine, comprising a signal recognition module, a signal amplification module, a signal reporting module, and a signal readout module; The signal recognition module includes a double-stranded capture probe composed of a specific aptamer for prostate-specific membrane antigen and a single-stranded DNA activation strand; the specific aptamer and the single-stranded DNA activation strand have partially complementary sequences; at the same time, the activation strand has the function of activating subsequent Cas12a-crRNA; the double-stranded capture probe can realize the specific recognition of prostate-specific membrane antigen and the function of converting protein signals into nucleic acid signals; The specific aptamer serves as a molecular probe to specifically recognize and bind to PSMA protein in urine samples. The activation strand is complementary to a portion of the aptamer sequence, and the two anneal to form a double-stranded capture probe. When the aptamer binds to PSMA, its double-strand conformation changes, resulting in the release of the activation strand. This free activation strand can then serve as the activation portion of the subsequent CRISPR Cas12a enzyme system.

[0010] The signal amplification module mainly comprises a Cas12a-crRNA complex, which is in an inactive state. The crRNA is designed to recognize and bind to the released activation strand. Once the ternary complex is formed, the Cas12a protein is activated, exhibiting strong trans-cleavage activity, capable of indiscriminately cleaving single-stranded DNA (ssDNA) in the surrounding environment, thus achieving exponential signal amplification.

[0011] The signal reporting module includes an HCG-ssDNA-magnetic bead complex; the HCG-ssDNA-magnetic bead complex includes streptavidin-coated magnetic beads, an ssDNA reporter probe, and the reporter molecule human chorionic gonadotropin (HCG); the three are covalently coupled through a cross-linking agent to form a magnetic bead complex, thereby realizing the HCG signal reporting output; among them, the ssDNA reporter probe (biotin-ssDNA-thiol) is a key linker molecule, whose sequence contains a site that can be non-specifically trans-cleaved after Cas12a activation, with one end modified with a thiol group (-SH) and the other end modified with biotin (-Biotin).

[0012] The connection method is as follows: the thiol end of the ssDNA reporter probe is covalently linked to the amino end of HCG via a cross-linking agent to form a stable HCG-ssDNA conjugate. The biotin end, through the high affinity of biotin-streptavidin, immobilizes the above HCG-ssDNA conjugate on the surface of magnetic beads, thereby constructing an HCG-ssDNA-magnetic bead complex.

[0013] The signal readout module is a lateral flow chromatography test strip coated with anti-HCG antibodies, which can perform qualitative and quantitative detection of HCG. The test strip's detection line (T line) is coated with anti-HCG antibodies to specifically bind to the target analyte in the magnetic separation supernatant; the control line (C line) is coated with anti-immunoglobulin antibodies, preferably anti-mouse IgG antibodies or anti-rabbit IgG antibodies, to capture the labeled antibodies or their complexes contained in the binding pad, thereby forming a control signal to verify the effectiveness of the test strip and the normal progress of the chromatography process.

[0014] Furthermore, the sequence of the specific aptamer for the prostate-specific membrane antigen is shown in SEQ ID NO.4; And / or, the sequence of the single-stranded DNA activation strand is as shown in SEQ ID NO.1.

[0015] Furthermore, the Cas12a-crRNA complex is prepared by the following method: crRNA and Cas12a are mixed and incubated in a reaction buffer to obtain the Cas12a-crRNA complex.

[0016] The concentration ratio of crRNA to Cas12a is 1:1-3:1, preferably 2:1; the incubation temperature is 4℃-42℃, preferably 25℃-42℃; the pH of the reaction is 6.0-8.0, preferably 6.5-7.5; the reaction buffer contains Mg... 2+ Concentration of 5 mmol·L -1 -20 mmol·L -1 Preferably 10 mmol·L -1 .

[0017] Furthermore, the HCG-ssDNA-magnetic bead complex was prepared by the following method: HCG is mixed with a crosslinking agent and reacted to obtain activated HCG; The activated HCG was coupled with the reduced ssDNA reporter probe to obtain the HCG-ssDNA complex. The obtained HCG-ssDNA complex was reacted with streptavidin magnetic beads to obtain the HCG-ssDNA-magnetic bead complex.

[0018] The crosslinking agent is one or more of sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (sulfo-SMCC), succinimidyl 4-[N-maleimidomethyl]cyclohexane-1-carboxylate (SMCC), and sulfosuccinimide sodium salt (sulfo-GMBS).

[0019] Furthermore, the lateral flow chromatography test strip is a pregnancy test strip.

[0020] A second objective of this invention is to provide a standard method for detecting prostate-specific membrane antigens using the aforementioned system, characterized by comprising the following steps: (1) The urine sample was mixed with the double-stranded capture probe and incubated to obtain the incubation product; (2) The incubation product obtained in step (1) is mixed with the Cas12a-crRNA complex and the HCG-ssDNA-magnetic bead complex in a buffer solution and incubated. (3) Perform magnetic separation on the reaction system obtained in step (2) and take the supernatant; (4) Add the supernatant obtained in step (3) to the sample application point of the test strip, and perform qualitative and quantitative analysis of prostate-specific membrane antigen in the urine sample based on the color development result of the test strip.

[0021] Further, in step (2), the concentration ratio of Cas12a to crRNA in the Cas12a-crRNA complex is 1:1 to 3:1.

[0022] Furthermore, in step (2), the incubation temperature is 4℃-42℃; preferably 37℃.

[0023] Further, in step (2), the pH value of the incubation is 6.0-8.0; preferably 7.0.

[0024] Further, in step (2), the incubation time is 25 min-40 min, preferably 30 min.

[0025] Further, in step (2), the buffer solution is a CRISPR / Cas12a NEBuffer buffer; the buffer solution contains Mg2+ The concentration is 5 mmol·L -1 -20 mmol·L -1 The preferred concentration is 10 mmol·L⁻¹. -1 .

[0026] A third objective of this invention is to provide the application of the system or method described above for detecting prostate-specific membrane antigens in urine in the preparation of prostate cancer auxiliary diagnostic products or prostate cancer population screening products.

[0027] The detection mechanism of this invention is as follows: Upon binding to its specific nucleic acid aptamer, PSMA induces a conformational change in the aptamer, thereby disrupting the partially complementary double-stranded structure between the aptamer and the activation strand, releasing a free single-stranded DNA activation strand. This activation strand, serving as the trigger sequence for the CRISPR / Cas12a system, specifically pairs with crRNA to form a Cas12a–crRNA–activation strand ternary complex, activating the trans-cleavage activity of Cas12a.

[0028] Activated Cas12a can non-specifically cleave single-stranded DNA reporter probes in the system, causing HCG originally attached to the magnetic bead surface to be released into the solution supernatant through ssDNA breakage. After removing the magnetic beads by magnetic separation, the supernatant is added to a lateral flow chromatography test strip. The anti-HCG antibody captures the signal and produces a colorimetric reaction, thereby enabling the visual detection of PSMA.

[0029] Compared with the prior art, the above-described technical solution of the present invention has the following advantages: (1) Ultra-high sensitivity: Utilizing the trans-cleavage activity of Cas12a, one activated Cas12a can cleave thousands of reporter probes, achieving exponential signal amplification of low concentration PSMA protein, with sensitivity far exceeding that of traditional immunochromatography.

[0030] (2) High specificity: The front end uses a screened PSMA-specific nucleic acid aptamer for recognition, avoiding possible cross-reaction of antibodies, and has high specificity.

[0031] (3) Convenience and low cost: The back-end signal reading uses mature, inexpensive, instrument-free pregnancy test strips, which greatly reduces the testing cost and operation threshold, making it suitable for point-of-care testing (POCT) and home self-testing.

[0032] (4) Ingenious signal conversion and anti-interference design: The presence of the protein target (PSMA) is converted into a nucleic acid signal (activation chain), then amplified by the CRISPR system, and finally converted into an HCG protein signal. The use of magnetic beads for separation can effectively remove the complex urine matrix background and improve the signal-to-noise ratio.

[0033] (5) Universality: The platform technology is universal. By changing the aptamer, it can be applied to the highly sensitive detection of other non-nucleic acid targets such as proteins, small molecules, and even cells. Attached Figure Description

[0034] To make the content of this invention easier to understand, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings.

[0035] Figure 1 This is a schematic diagram of the experimental principle of the urine PSMA test strip detection based on aptamers, CRISPR / Cas12a and HCG-ssDNA-SA magnetic beads in this invention. Figure 2 These are 3% agarose gel electrophoresis images used in this invention to verify the feasibility of strand substitution; lane M: DM-25bp DNA Marker; lane 1: 1 μmol·L⁻¹ -1 Aptamer ssRNA; Lane 2: 1 μmol·L -1 Activated strand ssDNA; Lane 3: 1 μmol·L -1 Double-stranded trap probe; lane 4: 1 μmol·L -1 Double-stranded capture probe + 1 μmol·L -1 PSMA; Lane 5: 1 μmol·L -1 Double-stranded capture probe + nuclease-free water; lane 6: 1 μmol·L -1 Double-stranded capture probe + 1 μmol·L -1 BSA; Lane 7: 1 μmol·L -1 Aptamer ssRNA + 1 μmol·L -1 PSMA; Figure 3 This invention describes the principle and fluorescence verification of PSMA aptamer-mediated strand substitution and triggering of CRISPR / Cas12a trans-cleavage activity; wherein, A is a schematic diagram of the CRISPR / Cas12a trans-cleavage principle; B is the verification of CRISPR / Cas12a trans-cleavage activity using a fluorescent probe. Figure 4 This invention relates to the effect of the concentration ratio of crRNA to Cas12a on cleavage efficiency (n=3). Figure 5 This invention relates to the effect of temperature on the cleavage efficiency of the CRISPR / Cas12a system (n=3). Figure 6 This invention relates to the effect of buffer pH on the cleavage efficiency of the CRISPR / Cas12a system (n=3). Figure 7The Mg in the CRISPR / Cas12a reaction buffer system of this invention 2+ The effect of concentration on cutting efficiency (n=3); Figure 8 This is the specificity verification of CRISPR / Cas12a in this invention (n=3); Figure 9 This is a characterization of the ssDNA-HCG conjugate in this invention; wherein, A is the UV-Vis absorption spectrum of HCG, ssDNA, and the ssDNA-HCG conjugate; B is the bioactivity evaluation of the ssDNA-HCG conjugate. Figure 10 This invention describes the construction, characterization, and immobilization effect verification of the HCG-ssDNA-magnetic bead complex. A represents the optimization results of the conjugation effect of streptavidin magnetic beads and HCG-ssDNA, as well as the volume of magnetic beads used, based on commercial pregnancy test strips. B shows a comparison of the detection results of samples before and after conjugation of HCG-ssDNA with streptavidin magnetic beads on pregnancy test strips. C presents the infrared spectrum of the ssDNA-magnetic bead and HCG-ssDNA-magnetic bead complex, used to verify the successful conjugation of HCG and its immobilization on the surface of the magnetic beads. Figure 11 Characterization diagrams of the naked magnetic beads and HCG-ssDNA-magnetic bead complexes are shown below. A represents the SEM-EDS surface distribution of nitrogen (N) in the naked magnetic beads; B represents the SEM-EDS surface distribution of oxygen (O) in the naked magnetic beads; C represents the SEM-EDS surface distribution of phosphorus (P) in the naked magnetic beads; D represents the SEM-EDS surface distribution of iron (Fe) in the naked magnetic beads; E represents the superimposed distribution of elements in the naked magnetic beads; and F represents the HCG-ssDNA-magnetic bead complex. SEM-EDS surface distribution map of nitrogen (N) in the HCG-ssDNA-magnetic bead complex; G is the SEM-EDS surface distribution map of oxygen (O) in the HCG-ssDNA-magnetic bead complex; H is the SEM-EDS surface distribution map of phosphorus (P) in the HCG-ssDNA-magnetic bead complex; I is the SEM-EDS surface distribution map of iron (Fe) in the HCG-ssDNA-magnetic bead complex; J is the superimposed distribution map of each element in the HCG-ssDNA-magnetic bead complex. Figure 12 This is the result of evaluating the specificity and anti-interference ability of the detection system in this invention; Figure 13 This invention presents the color development results of pregnancy test strips with different concentrations of PSMA (A) and the relationship between the gray value of the T line and the concentration of PSMA (B) (n=3). Figure 14 This is a stability evaluation of the HCG-ssDNA-magnetic bead complex in this invention (n=3). Figure 15This invention establishes the urine PSMA detection method and evaluates its consistency with ELISA results; where A is the ELISA standard curve for PSMA; B is a comparison of the distribution of urine PSMA concentration detected by the two methods (P < 0.001); C is the correlation analysis between the method of this study and the ELISA detection results; and D is the consistency analysis of the detection results of the two methods (Bland–Altman plot). Detailed Implementation

[0036] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0037] The experimental principle diagram of this invention, based on aptamers, CRISPR / Cas12a, and HCG-ssDNA-SA magnetic beads, for urine PSMA test strip detection is shown below. Figure 1 As shown: ① Signal recognition module: A PSMA-specific nucleic acid aptamer forms a double-stranded capture probe with partially complementary single-stranded DNA (activation strand); when the target PSMA is present, the aptamer specifically binds to PSMA and undergoes a conformational change, triggering a strand displacement reaction and releasing the activation strand; ② Signal amplification module: The released activation strand specifically pairs with crRNA, activating the trans-cleavage activity of Cas12a protein, thereby non-specifically cleaving the single-stranded DNA reporter probe (ssDNA) in the system, achieving signal amplification; ③ Signal reporting module: The ssDNA reporter probe is coupled to human chorionic gonadotropin (HCG) through a cross-linking agent (sulfo-SMCC) and immobilized on the surface of magnetic beads through biotin-streptavidin action; when the ssDNA is cleaved by Cas12a, HCG is released from the surface of the magnetic beads and enters the supernatant after magnetic separation; ④ Signal readout module: Free HCG in the supernatant can be detected by a lateral flow chromatography test strip, generating a visual signal on the detection line (T line), realizing rapid qualitative or semi-quantitative analysis of PSMA.

[0038] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials and reagents used are commercially available.

[0039] The sequences involved in the embodiments of the present invention are shown in Table 1 below: Table 1 Nucleic acid sequences used Note: "FAM" represents 6-carboxyfluorescein, "BHQ1" represents quencher, "SH" represents thiol, "Biotin" represents biotin, crRNA is the RNA sequence, and the remaining oligonucleotides are DNA sequences.

[0040] The reagents involved in the embodiments of this invention are shown in Table 2 below: Table 2 Main Reagents Example 1: Design and Synthesis of Double-Stranded Capture Probes for Prostate-Specific Membrane Antigens (1) Nucleic acid aptamers with high affinity and high specificity for prostate-specific membrane antigen PSMA were selected, and double-stranded capture probes complementary to the CRISPR / Cas12a activation chain were designed. The aptamer sequence (GGGAGGACGAUGCGGAUCAGCCAUGUUUACGUCACUCC, SEQ ID NO.4) was obtained by consulting literature databases, and the activation chain was designed as a DNA sequence partially complementary to the aptamer sequence (GGAGTGTCGTAAACATGGCTGATCCGCATCGTCCTCCC, SEQ ID NO.1); the above sequences were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0041] The synthesized aptamer and activator chains were dissolved separately in nuclease-free ultrapure water to a final concentration of 100 μM. The solutions were thoroughly mixed using a vortex mixer and then allowed to stand at room temperature for 10 min to ensure complete dissolution. The dissolved oligonucleotides were aliquoted (10 μL / tube) and stored at -20°C to avoid repeated freeze-thaw cycles.

[0042] The aptamer and activator strands were diluted to 2.0 μM and mixed at a 1:1 molar ratio. 100 μL of each mixture was transferred to an RNase-free centrifuge tube and gently mixed. The mixture was then heated in a metal bath at 95°C for 5 min, followed by natural cooling to room temperature for 90 min to induce annealing of the aptamer and activator strands, forming a stable double-stranded capture probe structure. The final concentration of the resulting double-stranded capture probe was approximately 1 μM, and it was stored at 4°C for short-term use.

[0043] (2) To verify whether the double-stranded capture probe constructed from the PSMA aptamer strand (ssRNA) and the activation strand (ssDNA) of the CRISPR / Cas12a system can be correctly formed and undergo a specific strand displacement reaction in the presence of the target PSMA, 3% agarose gel electrophoresis was used to analyze different reaction systems. Figure 2As shown, in lane 3, the aptamer and activating strand, after annealing, form a new band with a lower migration rate than the single strand, indicating the successful construction of the double-stranded capture probe. When the target PSMA is added to the system (lane 4), the intensity of the band corresponding to the double-stranded capture probe significantly decreases, while the signal of the activating strand band increases, indicating that PSMA can specifically bind to the aptamer, inducing a conformational change in the double-stranded capture probe and releasing the activating strand, thereby triggering a strand displacement reaction. In contrast, in the absence of the target (lane 5) or with the addition of the non-target protein BSA (lane 6), the band corresponding to the double-stranded capture probe remains stable, and no obvious new band is observed, indicating that the system has good structural stability and target response specificity. In summary, the constructed PSMA aptamer / activating strand double-stranded capture probe not only exists stably but also undergoes an effective strand displacement reaction induced by the target PSMA, releasing the activating strand. This provides a reliable upstream triggering module for the specific activation of the subsequent CRISPR / Cas12a trans-cleavage reaction, ensuring the feasibility of the experiment.

[0044] Example 2: Feasibility Verification and Optimization of CRISPR / Cas12a Signal Amplification System (1) Feasibility verification of activation and trans-cleavage activity of the CRISPR / Cas12a system First, add 10 μL, 1 mmol·L -1 PSMA solution and 10 μL 1 μmol·L -1 The pre-constructed double-stranded capture probes were mixed and incubated at 25°C for 30 min to fully induce the strand displacement reaction and release the activating strand. In the blank control group, 10 μL of nuclease-free ultrapure water was used instead of PSMA, while all other conditions remained the same. After the strand displacement reaction was completed, 10 μL of 1 μmol·L⁻¹ hydrochloric acid was added sequentially to the system. -1 crRNA, 10 μL, 1 μmol·L -1 Cas12a and 20 μL of 10×NEBuffer were gently mixed and incubated at 25°C for 5 min to pre-assemble the Cas12a-crRNA complex. Then, 10 μL of a 1 μM fluorescent reporter probe was added, and the total volume was brought to 200 μL with nuclease-free ultrapure water. After the reaction system was prepared, it was immediately transferred to a fluorescence detector for real-time monitoring, with fluorescence signals read every 1 min for 60 min. The trans-cleavage activity of the CRISPR / Cas12a system for the fluorescent reporter probe was evaluated by recording the fluorescence intensity change curve over time, and the feasibility of Cas12a activation after PSMA trigger strand replacement of the double-stranded capture probe was further verified.

[0045] like Figure 3As shown in Figure A, the fluorescent probe is modified with FAM and BHQ1 groups at both ends, respectively. Due to fluorescence resonance energy transfer (FRET), no fluorescence signal is generated at this time. In the presence of the target PSMA, the activating strand freed from the double-stranded capture probe can bind to the spacer sequence of crRNA, thereby triggering the trans-cleavage activity of Cas12a. It can non-specifically cleave surrounding ssDNA. The breakage of the fluorescent probe disrupts the FRET phenomenon between the fluorescent and quenching groups, thus restoring the fluorescence signal. Real-time fluorescence measurement is performed using an instrument to provide data support for experimental evaluation. Figure 3 As shown in Figure B, in the absence of target PSMA, no fluorescence signal generated by probe breakage can be observed, proving that the Cas12a / crRNA binary complex does not activate the cleavage activity of Cas12a. In this case, the fluorescent probe remains intact, exhibiting FRET (Fluorescent Trans-Extraction). When target PSMA is present, Cas12a / crRNA forms a ternary complex with target PSMA, activating the trans-cleavage activity of Cas12a. The fluorescent probe is cleaved, and the distance between the FAM fluorescent group and the BHQ1 quencher group exceeds the distance required for FRET, causing the FRET to disappear and promoting the recovery of the fluorescence signal. This result demonstrates the feasibility of PSMA-mediated strand substitution reactions effectively triggering CRISPR / Cas12a-mediated cleavage.

[0046] (2) Optimization of key reaction conditions and specificity verification of the CRISPR / Cas12a signal amplification system.

[0047] 1) Optimization of Cas12a / crRNA concentration ratio To further improve the cleavage efficiency of Cas12a, the effect of the concentration ratio of Cas12a to crRNA on the cleavage efficiency was investigated. Using ssDNA fluorescent probes modified with the fluorescent group FAM and the quencher group BHQ1 as substrates, the change in fluorescence intensity over 10 min was used as the indicator (ΔF). Keeping the concentrations of the target PSMA and the fluorescent probe constant, the amount of crRNA was varied by fixing the amount of Cas12a, and experiments were conducted using crRNA / Cas12a concentration ratios of 3:1, 2:1, 1:1, 1:2, and 1:3 to evaluate the cleavage efficiency. Figure 3 As shown, ΔF increased with the ratio of crRNA to Cas12a from 1:3 to 1:1, indicating higher cleavage efficiency. The highest fluorescence intensity change was observed when the ratio was further increased to 2:1. However, when the ratio was further increased to 3:1, ΔF decreased slightly, indicating that the cleavage efficiency was inhibited.

[0048] In this study's detection system, crRNA and Cas12a form a complex to exert their function. Based on experimental results, crRNA and Cas12a typically do not bind completely in a 1:1 ratio to achieve maximum cleavage efficiency. The ratio of crRNA to Cas12a affects the CRISPR / Cas12a-based detection system. Cas12a contains RuvC domain nuclease sites and RNA processing sites; higher concentrations of crRNA may compete with the activation sites on Cas12a and potentially alter its conformation, preventing normal activation and trans-cleavage activity. Results are as follows... Figure 4 As shown, by keeping other conditions constant and varying the ratio of crRNA to Cas12a, the change in fluorescence intensity reached its maximum when the ratio was 2:1. Therefore, in subsequent experiments, 2:1 was chosen as the optimal concentration ratio of crRNA to Cas12a.

[0049] 2) Optimization of reaction temperature for the CRISPR / Cas12a system Systematic optimization of the reaction temperature in the CRISPR / Cas12a system to obtain the optimal operating temperature for Cas12a is crucial for achieving stable, reliable, and sensitive detection performance. With other experimental conditions kept constant, different reaction temperatures (4℃, 25℃, 37℃, and 42℃) were set, and the effect of temperature on the trans-cleavage efficiency of Cas12a was evaluated by comparing the fluorescence signal changes (ΔF) at each temperature. Considering reaction efficiency, system stability, and experimental repeatability, the optimal reaction temperature suitable for subsequent detection experiments was finally determined.

[0050] like Figure 5 As shown, the reaction temperature of the CRISPR / Cas12a system was optimized while keeping the concentrations of PSMA, Cas12a, crRNA, and fluorescent probe constant. The results showed that when the temperature increased from 4℃ to 37℃, the fluorescence intensity change (ΔF) of the system significantly increased, indicating that the trans-cleavage activity of Cas12a increased with increasing temperature. When the temperature was further increased to 42℃, ΔF decreased, suggesting that higher temperatures may lead to reduced stability of the Cas12a / crRNA complex or a conformational state unfavorable to substrate binding and catalysis, thereby inhibiting cleavage efficiency. Considering both reactivity and system stability, this study selected 37℃ as the optimal reaction temperature for subsequent experiments.

[0051] 3) Optimization of the pH of the reaction buffer in the CRISPR / Cas12a system Systematic optimization of the reaction buffer pH for the CRISPR / Cas12a system is essential for obtaining stable, sensitive, and reproducible detection signals. Under fixed concentrations of PSMA, Cas12a, crRNA, and reporter probe, the reaction performance of the CRISPR / Cas12a system under different buffer pH conditions was systematically investigated. By comparing the fluorescence signal change (ΔF) under each pH condition, the optimal buffer pH for Cas12a trans-cleavage activity was selected, providing a stable and reliable reaction environment for subsequent detection experiments.

[0052] like Figure 6 As shown, under fixed concentrations of PSMA, Cas12a, crRNA, and fluorescent probe, the effect of buffer pH on the cleavage performance of the CRISPR / Cas12a system was investigated. The results showed that as the pH increased from 6.0 to 7.0, ΔF gradually increased, reaching its maximum at pH 7.0; however, when the pH continued to increase to 7.5-8.0, ΔF decreased, indicating that a slightly alkaline environment may affect the coordination of the Cas12a catalytic center to metal ions and substrate conformation recognition, thus reducing the trans-cleavage efficiency. Overall, the Cas12a system typically exhibits a better activity window under neutral to weakly alkaline conditions. Based on the experimental results and the general reaction buffer system settings, this study ultimately determined pH 7.0 as the optimal buffer condition for subsequent experiments.

[0053] 4) Mg in the buffer solution 2+ Concentration optimization Mg in buffer solution 2+ The optimal concentration of Mg in the CRISPR / Cas12a reaction buffer system has a decisive impact on the full utilization of Cas12a's trans-cleavage activity and signal amplification, making systematic optimization necessary. Under the premise of keeping other experimental conditions constant, the concentration of Mg in the CRISPR / Cas12a reaction buffer system was optimized. 2+ The system concentration was optimized by setting Mg. 2+ Concentration gradient of 5 mmol·L -1 10 mmol·L -1 15 mmol·L -1 and 20 mmol·L -1 The fluorescence detection reactions were performed under various conditions according to a standardized experimental procedure. Comparison of different Mg... 2+ The fluorescence signal intensity change (ΔF) under different concentration conditions was used to screen for Mg in the CRISPR / Cas12a reaction buffer system suitable for this detection system. 2+ The optimal working concentration.

[0054] like Figure 7 As shown, under constant other conditions, further optimization of Mg 2+The effect of Mg concentration on the scale-up of Cas12a inverse cutting. Results show that as Mg concentration increases... 2+ Concentration from 5 mmol·L -1 Increase to 10 mmol·L -1 ΔF increased significantly, and at 10 mmol·L -1 When Mg reaches its peak; 2+ It continued to rise to 15 to 20 mmol·L -1 ΔF decreased. This phenomenon suggests that Mg 2+ As a key divalent metal ion required for Cas12a catalysis, a moderate increase in Mg can promote the trans-cleavage reaction; however, excessive Mg... 2+ This may alter the conformational kinetics of the enzyme-nucleic acid complex or affect the specific binding process to the substrate, thereby leading to a decrease in reaction efficiency. Based on the above results, this study selected 10 mmol·L⁻¹. -1 Mg 2+ As the optimal Mg in the system 2+ condition.

[0055] (3) To further evaluate the specificity and reliability of the constructed CRISPR / Cas12a system, a variety of proteins were selected for specificity verification experiments. First, standard protein solutions of PSMA, prostate-specific antigen (PSA), Tamm-Horsfall protein (THP), immunoglobulin G (IgG), and bovine serum albumin (BSA) were prepared at the same concentration. Under the condition that the concentrations of Cas12a, crRNA, and reporter probe, as well as the reaction temperature and time, were kept constant, equal volumes of protein solutions were added to the aptamer / activating strand double-stranded capture probe system and incubated at 37°C for 10 min to allow the target protein to fully interact with the aptamer and induce possible strand displacement reactions. Subsequently, the reaction products of each group were added to the pre-assembled Cas12a-crRNA complex reaction system, and an equal amount of fluorescent reporter probe was added. The fluorescence signal changes were monitored in real time using a fluorescence detector, and the fluorescence intensity changes of each group within 10 min were recorded.

[0056] like Figure 8 As shown, a significant enhancement of fluorescence signal was only observed in the presence of the target PSMA; however, the changes in fluorescence signal when PSA, THP, IgG, or BSA were basically consistent with the blank control group, with no obvious signal response. Notably, THP, as the most abundant endogenous protein in urine, did not induce a significant change in fluorescence signal, further indicating that the system has good anti-interference ability in simulated real urine environment.

[0057] Experimental results show that the constructed CRISPR / Cas12a detection system can achieve highly specific recognition and response to PSMA and effectively distinguish common high-abundance proteins in urine, laying a reliable foundation for accurate detection of PSMA in complex biological samples.

[0058] Example 3 Preparation of HCG-ssDNA-magnetic bead complex To ensure the stable and efficient assembly of human chorionic gonadotropin (HCG), reporter probe ssDNA (SH-TTTTAATTTT-Biotin), and streptavidin magnetic beads into a complex, a systematic construction and validation process for the preparation of the HCG-ssDNA-magnetic bead complex was developed based on a covalent coupling reaction mediated by the heterobifunctional cross-linking agent sulfo-SMCC, combined with the biotin-streptavidin specific binding principle. The overall preparation process included HCG activation, ssDNA reduction, HCG-ssDNA covalent coupling, spectroscopic validation of the complex, and its immobilization and functional validation on the magnetic bead surface. The reporter probe used was a dual-terminal modified ssDNA, with a thiol group (-SH) introduced at one end for covalent coupling with HCG, and a biotin (-Biotin) group introduced at the other end for subsequent binding to streptavidin magnetic beads.

[0059] 1) Activation of HCG by sulfo-SMCC Take 100 μL of 0.1 mg / mL HCG (0.1 mmol·L⁻¹). -1 The HCG solution (diluted with PBS) was placed in a 1.5 mL EP centrifuge tube. 4 μL of the freshly prepared crosslinking agent sulfo-SMCC solution (4.8 mg / mL, dissolved in DMSO) was added to the above HCG solution. After mixing, the reaction system was placed on a vertical mixer and reacted at 25°C for 1 h to allow the NHS ester of sulfo-SMCC to covalently couple with the amino groups on the surface of the HCG molecule, thereby introducing maleimide active groups onto the HCG. After the reaction, the reaction system was centrifuged using a 10 kDa ultrafiltration tube to remove unreacted sulfo-SMCC and small molecule impurities, obtaining activated HCG with maleimide active groups.

[0060] 2) Reduction treatment of ssDNA thiol groups To improve the reaction efficiency between the thiol group and the maleimide group of ssDNA, the reporter probe ssDNA was pretreated with a reducing agent. 30 μL of 10 μmol·L⁻¹ was used. -1 Thiol-modified ssDNA, added 5 μL of 10 μmol·L⁻¹ -1The TCEP solution was thoroughly mixed and incubated at 25°C for 1 h to reduce any disulfide bonds that might form at the end of the reporter probe. After incubation, the reaction system was centrifuged using a 10 kDa ultrafiltration tube to remove excess TCEP, and the reduced thiol-containing ssDNA was collected for subsequent coupling reactions.

[0061] 3) Covalent coupling of HCG-ssDNA The reduced thiol-containing ssDNA was mixed with activated HCG, ensuring an appropriate molar excess of ssDNA to promote a complete coupling reaction. After mixing, the mixture was placed in a vertical mixer and reacted overnight at 25°C in the dark, allowing the thiol groups of the ssDNA to covalently bind to the maleimide groups on the HCG. After the reaction was complete, the reaction system was centrifuged using a 10 kDa ultrafiltration tube to remove unreacted impurities, ultimately obtaining an HCG-ssDNA complex with HCG coupled at one end and a biotin group at the other end. This complex was then stored at 4°C for short-term use.

[0062] 4) Feasibility verification of HCG-ssDNA covalent coupling To verify whether HCG and the reporter probe ssDNA successfully formed a covalent coupling, the coupling product was characterized by UV-Vis spectrophotometry. The following samples were prepared: S1: 100 μL HCG (0.1 mg / mL, using 0.1 mmol·L⁻¹) -1 S2: 100 μL ssDNA (3 μM, diluted with PBS). -1 (Diluted with PBS); S3: 100 μL HCG-ssDNA conjugate (approximately 3 μM, using 0.1 mmol·L⁻¹) -1 (Diluted with PBS). Baseline correction was performed after the instrument warmed up for 30 min, using 0.1 mmol·L⁻¹. -1 PBS was used as a blank, and the absorption spectrum was scanned in the wavelength range of 220-400 nm. The success of HCG-ssDNA covalent coupling was verified by analyzing the characteristic absorption peaks of the coupling product. Pregnancy test strips were also used to verify the changes in HCG's biological activity before and after the ssDNA coupling reaction. To verify the coupling between ssDNA and HCG, as follows... Figure 9 As shown in Figure A, the conjugate was characterized by absorption spectroscopy using ultraviolet spectrophotometry. The ssDNA-HCG conjugate exhibited a maximum absorption peak at 268 nm, a redshift of approximately 6 nm compared to the maximum absorption peak of the unconjugated ssDNA (262 nm). This significant change in peak position indicates a stable covalent link between ssDNA and HCG, thus confirming the successful construction of the ssDNA-HCG conjugate. Furthermore, pregnancy test strips were used to further evaluate the bioactivity of HCG conjugated with ssDNA. Figure 9 The results in section B show that the ssDNA-HCG complex can produce the same signal intensity as uncoupled HCG on the T line of the pregnancy test strip, indicating that HCG still has biological activity after being coupled with ssDNA. This allows for subsequent experiments to be conducted to prepare HCG-ssDNA-magnetic beads by immobilization with streptavidin.

[0063] 5) Immobilization of HCG-ssDNA on streptavidin magnetic beads After thoroughly mixing the streptavidin magnetic beads, transfer 100 μL of the 10 mg / mL magnetic bead suspension to a 1.5 mL centrifuge tube. Incubate on a magnetic rack for 2 min, then magnetically separate and discard the supernatant. Add 100 μL of 0.1 mmol / L... -1 Wash three times with PBS to remove preservation solution components. Then, add 100 μL of the above HCG-ssDNA conjugate solution, mix thoroughly, and incubate at 25°C for 30 min using a vertical mixer to allow the biotinylate groups at the ends of the ssDNA to specifically bind to streptavidin on the surface of the magnetic beads. After the reaction, discard the supernatant by magnetic separation and wash three times with PBS to remove non-specifically adsorbed and unbound HCG-ssDNA components. To block unreacted streptavidin sites on the magnetic bead surface, add 200 μL of 10 mM biotin solution to the system and incubate at 25°C for 2 h. After incubation, wash three more times, and finally resuspend the prepared HCG-ssDNA-magnetic bead complex in 100 μL of 0.1 mmol·L⁻¹ PBS. -1 Store in PBS at 4°C protected from light for later use.

[0064] 6) Functional validation of the HCG-ssDNA-magnetic bead complex To verify the assembly feasibility of the prepared HCG-ssDNA-magnetic bead complex and its functional performance in an immunochromatographic system, commercially available pregnancy test strips were used to detect different samples. The following solutions were prepared separately: HCG-ssDNA, reaction supernatant, HCG-ssDNA-magnetic bead resuspension, and washing buffer. These solutions were then tested using the same batch of pregnancy test strips. By comparing the difference in detection signal intensity before and after the coupling reaction, the successful immobilization of HCG-ssDNA on the surface of streptavidin magnetic beads was verified.

[0065] like Figure 10 As shown in Figure A, with the gradual increase in the volume of streptavidin magnetic beads used, the color development of the test line (T line) on the pregnancy test strip gradually weakened, indicating that more HCG-ssDNA was effectively immobilized on the surface of the magnetic beads, thereby reducing the amount of free HCG entering the supernatant. Based on the above results, considering both immobilization efficiency and reagent volume, this study selected 20 μL as the optimal volume for using streptavidin magnetic beads.

[0066] The results were obtained by comparing the reaction supernatant, washing buffer of the final product, and resuspension of the HCG-ssDNA-magnetic bead complex after the coupling reaction of HCG-ssDNA with streptavidin magnetic beads. Figure 10 B in the diagram shows that a significant signal was observed only in the resuspension, while no significant signal was observed in the supernatant and washing solution. This indicates that HCG-ssDNA can specifically bind to streptavidin through biotin modified at the probe end and has been successfully and stably immobilized on the surface of the magnetic beads.

[0067] Simultaneously, ssDNA-magnetic beads and HCG-ssDNA-magnetic beads samples were prepared. Fourier transform infrared spectroscopy was used to verify the changes in chemical bond peaks before and after the reaction, further verifying that HCG was successfully immobilized on the surface of the magnetic beads via ssDNA. Figure 10 As shown in C, comparing the infrared spectra of streptavidin magnetic beads-ssDNA (streptavidin magnetic beads-ssDNA is a direct coupling of streptavidin magnetic beads and biotin-ssDNA-thiol groups, serving as the control group) and streptavidin magnetic beads-ssDNA-HCG before and after HCG coupling, a significant change in their amide-related characteristic absorption range can be observed. In the FTIR spectrum of the HCG-ssDNA-magnetic bead complex, approximately 3352.28 cm⁻¹ -1 and 3294.42 cm -1 The absorption peak at this location shifted and changed in intensity compared to the control sample. This region is typically attributed to N–H stretching vibrations, consistent with the characteristics of protein-related functional groups. Combined with the heterobifunctional crosslinking strategy employed—sulfo-SMCC forming an amide bond through the reaction of N-hydroxysuccinimide (NHS) ester with the amino group in the HCG molecule, and simultaneously forming a stable thioether bond through the reaction of the maleimide group with the terminal thiol group of ssDNA—the above data demonstrate that a new protein-related structural feature was introduced into the system after the coupling reaction. This indirectly proves that HCG has been successfully covalently coupled to ssDNA and stably immobilized on the surface of streptavidin magnetic beads.

[0068] 7) Characterization of the HCG-ssDNA-magnetic bead complex The prepared HCG-ssDNA-magnetic bead complex was collected via magnetic separation and washed three times with ultrapure water to thoroughly remove unbound free molecules and reaction residues. Subsequently, the magnetic beads were resuspended in a 10% formaldehyde solution for fixation. An appropriate amount of sample was then dropped onto a clean silicon wafer surface and allowed to air dry at room temperature. To improve the conductivity and reduce the charging effect, the dried sample was subjected to gold sputtering under vacuum. The surface morphology and dispersion state of the sample were observed using field emission scanning electron microscopy (SEM). During SEM testing, the accelerating voltage was set to 10 kV, the working distance was approximately 8 mm, and the magnification was adjusted according to the specific morphological characteristics of the sample. Based on SEM observations, elemental composition and distribution analysis of the samples were performed using a matching EDS. Energy-dispersive X-ray spectroscopy (EDS) images and surface distribution maps of iron (Fe), oxygen (O), nitrogen (N), and phosphorus (P) were acquired for the samples. SEM morphology images and elemental distribution overlay maps were obtained under the same field of view to characterize the spatial distribution characteristics of each element on the sample surface. Simultaneously, unreacted streptavidin magnetic beads were analyzed under the same conditions using SEM-EDS as a control group to compare the differences in elemental composition between the complex and the bare magnetic beads.

[0069] The results are as follows Figure 11 As shown in the EDS surface distribution results, Fe, O, and a small amount of P element signals were mainly detected on the surface of bare magnetic beads, while N element was not detected. In contrast, P and N element signals were clearly detected in the HCG-ssDNA-magnetic bead complex and were uniformly distributed. Combined with the quantitative analysis results in Table 3, it can be seen that the P element content in the complex increased significantly from 18.57% to 45.70%, while the N element increased from 0 to 4.58%, and the Fe element content decreased from 75.90% to 64.71%. Among them, the P element originates from the phosphate backbone of nucleic acid molecules, and its significant increase indicates that ssDNA was successfully immobilized on the surface of magnetic beads; the N element mainly originates from the amino structure of protein molecules, and its presence directly proves that HCG has been successfully introduced into the system. The decrease in the Fe element content further indicates that the surface of the magnetic beads is covered by an organic molecular layer. It should be noted that the SEM observation was carried out under vacuum and dry conditions. A certain degree of aggregation of magnetic beads may occur during the sample preparation process. This phenomenon is relatively common in magnetic nanomaterials and does not represent their true dispersion state in the solution system.

[0070] In summary, SEM-EDS analysis, from both elemental composition and spatial distribution perspectives, demonstrates that ssDNA and HCG have been successfully loaded onto the surface of magnetic beads, confirming the feasibility of constructing the HCG-ssDNA-magnetic bead complex and laying the foundation for subsequent signal amplification and detection experiments.

[0071] Table 3 Comparison of EDS elemental composition of naked magnetic beads and HCG-ssDNA-magnetic bead complexes Example 4: Feasibility and specificity verification of this PSMA detection system To comprehensively evaluate the feasibility and specificity of the constructed detection system, several representative non-target proteins were selected as potential interfering agents and blank controls for validation experiments. First, standard solutions of PSA, THP, IgG, and BSA were introduced into the double-stranded capture probe system for the first stage of specific capture and strand displacement reaction. Subsequently, the resulting reaction solution was added to the CRISPR / Cas12a reaction system and further combined with the HCG-ssDNA-magnetic bead complex and commercial pregnancy test strips to complete the second stage of specific signal detection.

[0072] 10 µL, 1 μmol·L -1 PSMA standard, 10 µL, 1 μmol·L -1 The double-stranded trapping probes were mixed, vortexed, and incubated at 25°C for 30 min to induce a chain displacement reaction. Then, 20 µL and 1 μmol·L⁻¹ were added sequentially. - 1 crRNA, 10 µL, 1 μmol·L -1 Cas12a, 20 µL, 10×NEBuffer, and 10 µL of pre-prepared HCG-ssDNA-magnetic bead complex were added, and the total volume was brought to 200 µL with nuclease-free ultrapure water. After mixing, the mixture was incubated at 37°C for 5 min to trigger the trans-cleavage effect of CRISPR / Cas12a. A blank control group was prepared with an equal volume of 10 µL of 0.1 mmol·L⁻¹ HCG-ssDNA-magnetic bead complex. -1PBS was used instead of PSMA standard. Immediately after the reaction, the centrifuge tubes were placed on a magnetic rack for magnetic separation, and the supernatant was collected. Before testing, the pregnancy test strips were removed from the packaging and allowed to equilibrate at room temperature for 10 minutes to avoid the influence of temperature and humidity changes on the chromatography process. Three replicates were set up for all experiments. All test strips were from the same brand and batch to reduce errors caused by batch variations. 100 µL of the supernatant was slowly added dropwise to the sample pad area of ​​the pregnancy test strip, allowing the sample to chromatographically move along the strip under capillary action. After reacting for 5 minutes at room temperature, the presence of a colored band on the test line (T line) was visually assessed for qualitative determination. To reduce human error, after testing, the test strips were placed under a uniform background and fixed lighting conditions, and photographed using a smartphone. The same shooting distance, angle, and exposure parameters were maintained during photography.

[0073] like Figure 12 As shown, the T line of the pregnancy test strip showed obvious color development only when the target PSMA was present; when PSA, THP, IgG or BSA were added to the system, the color of the T line of the test strip did not change significantly and was basically consistent with the blank control group, indicating that the detection system can effectively distinguish PSMA from a variety of potential interfering proteins.

[0074] In summary, the constructed lateral flow detection system not only has a highly specific recognition ability for PSMA, but also maintains stable signal output under the coexistence of various prostate-related proteins, high-abundance urinary endogenous proteins, and non-specific proteins, further verifying the reliability and practicality of this detection strategy in the analysis of complex biological samples.

[0075] Example 5 Sensitivity Analysis of This PSMA Detection System 1) To evaluate the detection performance of the lateral flow test strip, under the optimal screening parameters described above, tests were conducted on concentration gradients of 0 and 0.05 pmol·L⁻¹. -1 0.1 pmol·L -1 0.2 pmol·L -1 0.5 pmol·L -1 0.8 pmol·L -1 1 pmol·L -1 2 pmol·L -1 5 pmol·L -1 8 pmol·L -1 10 pmol·L -1 20 pmol·L -1 50 pmol·L -1 100 pmol·L -1and 150 pmol·L -1 The PSMA standard solution was used for testing, and a standard curve was established. Detailed steps are as follows: First, weigh an appropriate amount of PSMA standard and add it to artificial urine. Shake thoroughly to prepare the PSMA standard solutions with the above concentration gradient. Then, add 10 µL of different concentrations of PSMA standard, 10 µL of 1 μmol·L⁻¹, and 10 µL of different concentrations of PSMA standard, respectively. - ¹The double-stranded trapping probes were mixed, vortexed, and incubated at 25°C for 30 min to induce a chain displacement reaction. Then, 20 µL of 1 μmol·L⁻¹ was added sequentially. -1 crRNA, 10 µL 1 μmol·L -1 Cas12a, 20 µL of 10×NEBuffer, and 10 µL of pre-prepared HCG-ssDNA-magnetic bead complex were added, and the total volume was brought to 200 µL with nuclease-free ultrapure water. After mixing, the mixture was incubated at 37°C for 5 min to trigger the trans-cleavage effect of CRISPR / Cas12a. A blank control group was prepared with an equal volume of 10 µL of 0.1 mmol·L⁻¹ HCG-ssDNA-magnetic bead complex. - ¹PBS was used instead of PSMA standard. Immediately after the reaction, the centrifuge tubes were placed on a magnetic rack for magnetic separation, and the supernatant was collected. Before testing, the pregnancy test strips were removed from the packaging and allowed to equilibrate at room temperature for 10 minutes to avoid the influence of temperature and humidity changes on the chromatography process. Three replicates were set up for all experiments. All test strips were from the same brand and batch to reduce errors caused by batch variations. 100 µL of the supernatant was slowly added dropwise to the sample pad area of ​​the pregnancy test strip, allowing the sample to chromatographically move along the strip under capillary action. After reacting for 5 minutes at room temperature, the presence of a colored band on the test line (T line) was visually assessed for qualitative determination. To reduce human error, after testing, the test strips were placed under a uniform background and fixed lighting conditions, and photos were taken using a smartphone. The same shooting distance, angle, and exposure parameters were maintained when taking the photos. After imaging the test strip results, the grayscale value of the detection line (T-line) was measured using ImageJ software. A standard curve was plotted with the grayscale value as the ordinate and the logarithm of the PSMA concentration as the abscissa to analyze the relationship between the detection signal and the PSMA concentration. Based on the standard curve results, the linear response range of the detection system was further determined, and the limit of detection (LOD) was calculated according to the principle of 3 times the standard deviation (3σ) of the blank sample signal, thereby comprehensively evaluating the sensitivity performance of the PSMA detection system constructed in this study.

[0076] like Figure 13As shown in Figure A, the T-line on the test strip gradually darkens with increasing PSMA concentration. The T / C ratio for each sample was calculated using images taken with a smartphone and analyzed with ImageJ. Figure 13 As shown in B, the obtained T / C ratios are correlated with the logarithm of PSMA concentration in the range of 0.05–150 pmol·L⁻¹. -1 The expression exhibits good linearity within the given range (y = 0.2521x + 0.3771, R² = 0.9911). Based on the 3σ principle, the limit of detection (LOD) is calculated to be 0.059 pmol·L⁻¹. -1 Compared with previously reported PSMA detection methods, this lateral flow detection method exhibits a lower detection limit (Table 4), indicating that it has higher sensitivity and accuracy, providing an effective and reliable method for PSMA detection.

[0077] Table 4 Performance comparison of this scheme with previously reported PSMA detection methods References [1] Zhou L, Wang Y, Chen J, Liu H, Li Z, Zhang [2] Liu Y., Zhang N., Pan JB, Song J., Zhao W., Chen HY, et al. Bipolar electrode array for multiplexed detection of prostate cancer biomarkers. Analytical Chemistry, 2022, 94(6): 3005–3012. https: / / doi.org / 10.1021 / acs.analchem.1c05383 [3] Kawakami K, Fujita Y, Kato T, Horie K, Koie T, Umezawa K, et al. Diagnostic potential of serum extracellular vesicles expressing prostate-specific membrane antigen in urologic malignancies. Sci Rep. 2021;11: 1–12.doi:10.1038 / s41598-021-94603-9 [4] Iagaru A., Suarez JF, Behr S., Aggarwal R., Paredes P., BuffiN., et al. Imaging efficacy of [18F]CTT1057 PET for the detection of PSMA-positive tumors using histopathology as standard of truth: results from theGuideView phase 2 / 3 prospective multicenter study. Journal of NuclearMedicine, 2025, 66(8): 1232–1238. https: / / doi.org / 10.2967 / jnumed.124.269007 Example 6: Clinical Sample Validation 1) Validation of PSMA spiked on artificial urine First, PSMA standard solutions of different concentrations were added to the artificial urine samples to achieve a final concentration of 1 pmol·L⁻¹. -1 30 pmol·L -1 and 50 pmol·L -1All spiked samples were tested according to a standardized procedure. Specifically, urine samples were first mixed with the double-stranded capture probe and reacted at room temperature for 30 min. Then, the CRISPR / Cas12a reaction system and HCG-ssDNA-magnetic bead complex were added, and the reaction was continued for another 5 min. Subsequently, the supernatant was added to a pregnancy test strip, allowed to stand for 5 min, and the color development was observed and recorded. The gray value of the test line (T line) was quantitatively analyzed using ImageJ software, and the actual concentration of PSMA was calculated based on a standard curve. Statistical analysis of the experimental results (Table 5) showed that the PSMA spiked recovery rate ranged from 107.3% to 110.8%, the intra-assay coefficient of variation was 8.7% to 11.2%, and the inter-assay coefficient of variation was 10.6% to 13.9%. These results indicate that the detection system has good accuracy and repeatability in a urine matrix. Further analysis of clinical urine samples and ELISA results confirms that the PSMA detection method established in this study is not easily affected by non-specific interference under complex urine matrix conditions, and has good specificity and clinical application potential.

[0078] Table 5. Detection of PSMA spiked in artificial urine 2) Stability verification In practical testing applications, the storage stability of magnetic bead complexes directly affects the reliability and repeatability of test results. To evaluate the stability of the magnetic bead complexes, the prepared complexes were stored at 4°C in the dark. On days 0, 7, 14, 21, and 30 after storage, artificial urine samples spiked with different concentrations of PSMA were tested using a standardized procedure. After testing, pregnancy test strips were photographed under uniform lighting and fixed imaging parameters, and the images were imported into ImageJ software to measure and record the grayscale values ​​of the test line (T line). By comparing the changes in the grayscale values ​​of the T line corresponding to different PSMA concentrations at different storage time points, the stability of the magnetic bead complexes during long-term storage and its impact on the detection signal output were evaluated. Figure 14 As shown, the gray values ​​of the T lines corresponding to each concentration of PSMA increased slightly with prolonged storage time. This may be due to the oxidation of covalent bonds or the degradation of cross-linking agents during storage; however, it did not significantly affect the detection results. This indicates that the magnetic bead complex maintains good consistency in detection response under these storage conditions and has small errors, demonstrating the stability and reliability of the detection method.

[0079] 3) Real sample testing and verification Building upon the artificial spiking experiments, this detection system was further applied to actual urine samples from prostate cancer patients to simulate real-world clinical scenarios. It should be noted that clinical urine samples are complex, containing various proteins, metabolites, and inorganic salts, all of which can interfere with target detection. Therefore, validating the detection system in real urine samples is crucial for assessing its clinical applicability. To further verify the reliability of the results, enzyme-linked immunosorbent assay (ELISA) was used as a control method to measure the expression level of PSMA in urine samples from the same patient, and the results were compared with those obtained using the method established in this study.

[0080] This study strictly adhered to medical research ethics guidelines and was approved by the Ethics Committee of Jiangnan University Medical Center (Approval No.: 2023-Y-168). All participants voluntarily signed written informed consent forms after fully understanding the research objectives, experimental procedures, and potential risks. To protect participant privacy, all samples were immediately coded and anonymized after collection, and no personally identifiable information was involved in the research process.

[0081] To further verify the feasibility of the established detection system in real clinical samples, this study selected clinical urine samples for methodological evaluation. Clinical urine samples were obtained from 30 patients diagnosed with prostate cancer and 30 healthy volunteers at the Affiliated Central Hospital of Jiangnan University. Among them, the prostate cancer patients all had PSA levels in the 4-10 ng / mL "gray zone". This population is of great significance in clinical diagnosis, as traditional PSA testing in this range has low specificity and is easily confused with benign prostatic hyperplasia and prostatitis. Therefore, this population is a key target group for early screening and accurate diagnosis of prostate cancer.

[0082] To minimize the impact of pre-analytical factors on the test results, all subjects underwent urine sample collection according to standardized procedures. Prior to sampling, subjects were instructed to avoid strenuous exercise and procedures that might affect the release of prostatic secretions or changes in urine composition, such as prostate massage, catheterization, and cystoscopy. Recent dietary habits, medication use, and underlying medical conditions were recorded, with particular attention paid to clinical factors that could potentially affect the test results, including prostatitis, benign prostatic hyperplasia, urinary tract infection, and hematuria, to comprehensively assess their potential interference in the results analysis.

[0083] All urine samples were collected in the early morning, using clean-catch midstream urine, and preprocessed within 2 hours of collection. Samples were centrifuged at 3000 g for 10 min at 4°C to remove cell debris and insoluble impurities; the supernatant was then collected for later use. If samples could not be tested immediately, they were aliquoted and stored in a suitable container. Store at 80℃; thaw naturally at room temperature before testing, and centrifuge again to remove precipitate. Considering that repeated freeze-thaw cycles may lead to protein degradation, exosome rupture, and loss of target molecules, thus affecting the accuracy of the test results, the number of freeze-thaw cycles for all clinical samples in this study was strictly controlled, allowing only one freeze-thaw cycle, and the sample tubes were clearly labeled to ensure the reliability and reproducibility of the test results.

[0084] To achieve methodological control, the expression level of PSMA in urine was first determined using a commercial ELISA kit on the same batch of urine samples. Before the ELISA assay, all reagents in the kit were removed from 4°C and equilibrated to room temperature to avoid the influence of temperature differences on the reaction results. The kit was prepared according to the instructions, including blank wells (0 ng / mL). -1 Six concentration gradient standards, including [specific standards not provided], were used to plot a standard curve. 100 μL of standard or urine sample was added sequentially to each pre-coated 96-well ELISA plate, with two parallel wells for each sample. After adding the sample, the plate was sealed and incubated at 37°C for 90 min to ensure sufficient binding between the antigen and the coating antibody. After incubation, the liquid in the wells was discarded, and 300 μL of washing buffer was added to each well. After standing for 30 s, the buffer was discarded and the plate was gently blotted dry. This washing process was repeated three times. Subsequently, biotinylated detection antibody and HRP conjugate were added sequentially, and incubated at 37°C for 60 min and 30 min, respectively, followed by washing according to the manufacturer's instructions. After the reaction was complete, 100 μL of TMB chromogenic substrate was added to each well, and the reaction was incubated at room temperature for 10 min in the dark. Once the color in the wells had developed and reached a suitable intensity, 50 μL of stop solution was added to terminate the reaction. Immediately after termination, the absorbance of each well was read at 450 nm using a microplate reader, and the concentration of PSMA in the urine sample was calculated based on the standard curve. See Figure 15 The A curve in the ELISA standard curve shows good linearity (R²=0.9903) and can be used as a reliable reference method.

[0085] Subsequently, the same batch of urine samples were tested according to the standard procedure established in this study. After the test, the test strips were photographed under uniform lighting conditions and fixed shooting parameters, and the gray values ​​of the test line (T line) were quantitatively analyzed using ImageJ software.

[0086] like Figure 15 As shown in Figure B, the violin plot reveals similar distribution characteristics of urinary PSMA concentrations measured by our method and ELISA. However, paired statistical analysis showed a significant difference between the two methods (P < 0.001), suggesting a certain systematic bias in absolute measurements between our method and ELISA. The overall detection values ​​obtained by our method were slightly higher than those obtained by ELISA, consistent with subsequent Bland–Altman analysis results.

[0087] Based on this, linear regression analysis was further used to evaluate the correlation between the detection results of the two methods. For example... Figure 15 As shown in C, the results of this study were significantly positively correlated with those of ELISA (R²=0.97, P<0.001), with a regression equation of y=0.98x+0.5. The slope and intercept were close to the ideal values, indicating that the two methods have good consistency at the quantitative level and can accurately reflect the changes in PSMA concentration in urine.

[0088] To further evaluate the consistency of the two methods at the quantitative level, a Bland–Altman analysis was used for comparison. Figure 15 (D in the text). The results showed that the average deviation between the two methods was 0.38 ng / mL, and the 95% agreement limit was -0.13 to 0.90 ng / mL. The vast majority of data points fell within the agreement limit, indicating good overall consistency between the two methods. The positive average deviation suggests that the results obtained using our method were slightly better than those obtained using the ELISA method, but the deviation was within an acceptable range.

[0089] The results above indicate that the urine PSMA detection system established in this study can achieve stable detection in clinical samples and shows good consistency with the ELISA method in terms of detection trends and quantitative results.

[0090] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A system for detecting prostate-specific membrane antigens in urine, characterized in that, It includes a signal recognition module, a signal amplification module, a signal reporting module, and a signal readout module; The signal recognition module includes a double-stranded capture probe composed of a specific aptamer for prostate-specific membrane antigen and a single-stranded DNA activation strand; the specific aptamer is partially complementary to the single-stranded DNA activation strand. The signal amplification module includes a Cas12a-crRNA complex; The signal reporting module includes an HCG-ssDNA-magnetic bead complex; the HCG-ssDNA-magnetic bead complex includes streptavidin-coated magnetic beads, an ssDNA reporter probe, and a reporter molecule, human chorionic gonadotropin (HCG). The signal readout module is a lateral flow chromatography test strip coated with anti-HCG antibody.

2. The system according to claim 1, characterized in that, The sequence of the specific aptamer of the prostate-specific membrane antigen is shown in SEQ ID NO.4; The sequence of the single-stranded DNA activation strand is shown in SEQ ID NO.

1.

3. The system according to claim 1, characterized in that, The Cas12a-crRNA complex was prepared by mixing crRNA and Cas12a in a reaction buffer and incubating to obtain the Cas12a-crRNA complex.

4. The system according to claim 1, characterized in that, The HCG-ssDNA-magnetic bead complex was prepared by the following method: HCG is mixed with a crosslinking agent and reacted to obtain activated HCG; The activated HCG was coupled with the reduced ssDNA reporter probe to obtain the HCG-ssDNA complex. The obtained HCG-ssDNA complex was reacted with streptavidin magnetic beads to obtain the HCG-ssDNA-magnetic bead complex.

5. The system according to claim 4, characterized in that, The crosslinking agent is one or more of sulfosuccinimide-4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid ester, succinimide-4-[N-maleimidemethyl]cyclohexane-1-carboxylate, and sodium sulfosuccinimide-4-maleimidebutyrate.

6. A method for detecting prostate-specific membrane antigens using the system described in any one of claims 1-5, characterized in that, Includes the following steps: (1) The urine sample was mixed with the double-stranded capture probe and incubated to obtain the incubation product; (2) The incubation product obtained in step (1) is mixed with the Cas12a-crRNA complex and the HCG-ssDNA-magnetic bead complex in a buffer solution and incubated. (3) Perform magnetic separation on the reaction system obtained in step (2) and take the supernatant; (4) Add the supernatant obtained in step (3) to the sample application point of the test strip, and perform qualitative and quantitative analysis of prostate-specific membrane antigen in the urine sample based on the color development result of the test strip.

7. The method according to claim 6, characterized in that, In step (2), the concentration ratio of Cas12a to crRNA in the Cas12a-crRNA complex is 1:1 to 3:

1.

8. The method according to claim 6, characterized in that, In step (2), the incubation temperature is 4℃-42℃; And / or, the incubation is performed at a pH of 6.0-8.0; And / or, the incubation time is 25 min-40 min.

9. The method according to claim 6, characterized in that, In step (2), the buffer solution is NE Buffer; the buffer solution contains Mg 2+ The concentration is 5 mmol·L -1 -20mmol·L -1 .

10. The system for detecting prostate-specific membrane antigens in urine according to any one of claims 1-5, or the method according to any one of claims 6-9, is used in the preparation of prostate cancer auxiliary diagnostic products or prostate cancer population screening products.

Images