A method and system for designing a site-directed mutation primer of a target protein coding gene

Abstract

This invention discloses a method and system for designing primers for site-directed mutagenesis of a target protein-encoding gene, relating to the field of bioinformatics. The method includes: acquiring the gene sequence and mutation instructions for the target protein; analyzing the mutation type, and when an amino acid mutation is identified, querying a pre-defined codon preference table to select the optimal codon and determine the nucleotide change information; when a saturation mutation is identified, automatically expanding it into multiple amino acid mutations; determining the primer overlap region based on the nucleotide change information, constructing forward and reverse primers using an asymmetric extension strategy, with both extending in different directions along the gene and sharing only the overlap region; performing quality assessment on the primers to obtain a quality score; and iteratively searching to select the optimal primer pair with the goal of minimizing annealing temperature deviation and optimizing the quality score. This invention combines codon optimization, precise control of the overlap region, and multi-dimensional quality assessment, improving the efficiency and accuracy of site-directed mutagenesis primer design.

Description

Technical Field

[0001] This invention relates to the field of bioinformatics technology, and in particular to a method and system for designing primers for site-directed mutation of target protein-encoding genes. Background Technology

[0002] Site-directed mutagenesis is a core technique in protein engineering and molecular biology research, widely used in areas such as enzyme activity modification, substrate-specific regulation, stability enhancement, and functional mechanism research. In site-directed mutagenesis experiments, researchers need to design mutation primers targeting specific locations in the target gene and introduce the desired base changes through PCR amplification.

[0003] Current site-directed mutagenesis primer design employs fully complementary forward and reverse primers or partially overlapping primer strategies, relying primarily on general primer design software such as Primer and Geneious. However, these software programs take nucleotide sequences as input and cannot directly handle amino acid-level mutations. When performing site-directed mutagenesis at the amino acid level, the target amino acid must be converted into its corresponding DNA codon. Since different host organisms have preferences for different synonymous codons, researchers must manually consult codon tables to determine the optimal codon before designing primers, resulting in a fragmented and error-prone process. Furthermore, existing partially overlapping primer design methods often employ symmetrical design strategies, with forward and reverse primers symmetrically distributed around the mutation site. This makes precise control of the overlapping region difficult, often resulting in an overlap much larger than expected, affecting PCR amplification efficiency and primer specificity. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a method and system for designing primers for site-directed mutagenesis of target protein-encoding genes.

[0005] The first aspect of this invention provides a method for designing primers for site-directed mutagenesis of a target protein-coding gene, comprising: Obtain the coding gene sequence of the target protein and at least one mutation instruction; Based on the gene sequence and the mutation instruction, the mutation instruction is parsed to identify the mutation type. When an amino acid mutation is identified, a preset codon preference table is queried to select the optimal codon for the target amino acid and determine the nucleotide change information. When a saturation mutation is identified, it is automatically expanded into multiple amino acid mutations. Based on the nucleotide change information, the primer overlap region is determined. Based on the overlap region, an asymmetric extension strategy is used to construct forward and reverse primers, wherein the forward and reverse primers extend in different directions of the gene and share only the overlap region. A quality assessment was performed on the forward and reverse primers to obtain a quality score. Based on the quality score, with the goal of minimizing the annealing temperature deviation and optimizing the quality score, the optimal primer pair is selected through iterative search and the primer design results are output.

[0006] Furthermore, the parsing of the mutation instruction supports the following formats: The amino acid single-letter format is represented by sequentially connecting the original amino acid single letter, its position, and the target amino acid single letter. The amino acid three-letter format is represented by sequentially connecting the three letters of the original amino acid, the position, and the three letters of the target amino acid. Multi-target format, which separates multiple target amino acids with commas, automatically splits them into multiple independent mutations; The saturation mutation format is represented by connecting amino acids, positions, and saturation markers in sequence, and automatically expands to a mutation of all amino acids at that position except for the wild type.

[0007] Furthermore, determining the primer overlap region specifically involves: calculating the center position of all mutation sites, using this center position as the center of the overlap region, and calculating the start and end points of the overlap region based on a preset overlap length; when a mutation site exceeds the overlap region, automatically shifting the overlap region so that all mutated bases are located within the overlap region.

[0008] Furthermore, the asymmetric extension strategy is specifically as follows: taking the overlapping region as a reference, the forward primer independently searches from the right boundary of the overlapping region towards gene 5' within a preset length range, and the reverse primer independently searches from the left boundary of the overlapping region towards gene 3' within a preset length range. The lengths of the forward primer and the reverse primer are independently determined, and they only share the overlapping region. The size of the overlapping region is equal to the preset overlapping length.

[0009] Furthermore, the quality assessment includes: Hairpin structure detection is used to detect whether a stem-loop self-folding structure exists inside the primer; Self-dimer detection is used to detect self-complementary pairing at the 3' end of primers; Cross-dimer detection is used to detect complementary pairing between the 3' end of the forward primer and the 3' end of the reverse primer; Detection of consecutive identical bases is used to detect the presence of sequence segments with consecutive identical bases. Dinucleotide repeat detection is used to detect the presence of dinucleotide repeat patterns. GC clip detection is used to detect whether the 3' end of a primer contains a G or C base. 3' end stability detection is used to count the number of GC bases in the 3' end region of the primer.

[0010] Furthermore, the iterative search selects the optimal primer pair, and its comprehensive scoring formula is as follows:

[0011] in, and These are the annealing temperatures for the forward and reverse primers, respectively. The target annealing temperature, For annealing temperature deviation penalty weight, and The quality scores for the forward and reverse primers are respectively. This is the compression factor for the quality score. The severity of cross-dimerization, The weight for cross-dimer penalty. Bonus points are awarded for GC content within a preset range. Bonus points are awarded when the overlap length equals the minimum target value.

[0012] A second aspect of the present invention provides a primer design system for site-directed mutagenesis of a target protein-coding gene, comprising: The sequence acquisition module is used to acquire the coding gene sequence of the target protein and at least one mutation instruction; The mutation parsing module is used to parse the mutation instruction based on the gene sequence and the mutation instruction, identify the mutation type, and when it is identified as an amino acid mutation, query a preset codon preference table, select the optimal codon for the target amino acid, and determine the nucleotide change information; when it is identified as a saturation mutation, it automatically expands it into multiple amino acid mutations. The primer design module is used to determine the primer overlap region based on the nucleotide change information, and to construct forward and reverse primers using an asymmetric extension strategy based on the overlap region, wherein the forward and reverse primers extend in different directions of the gene and share only the overlap region. The quality assessment module is used to perform quality assessment on the forward primer and the reverse primer to obtain a quality score; The filtering output module is used to select the optimal primer pair and output the primer design results by iteratively searching based on the quality score, with the goal of minimizing the annealing temperature deviation and optimizing the quality score.

[0013] A third aspect of the present invention provides an electronic device including a memory, a processor, and a program stored in the memory and running on the processor, wherein the processor executes the program to implement the steps in the target protein coding gene site-directed mutagenesis primer design method as described in the first aspect of the present invention.

[0014] A fourth aspect of the present invention provides a computer-readable storage medium having a program stored thereon that, when executed by a processor, implements the steps in the target protein coding gene site-directed mutagenesis primer design method as described in the first aspect of the present invention.

[0015] A fifth aspect of the present invention provides a computer program product comprising software code, wherein the program in the software code performs the steps in the target protein coding gene site-directed mutagenesis primer design method as described in the first aspect of the present invention.

[0016] Compared with existing technologies, the method and system for designing primers for site-directed mutagenesis of target protein-coding genes provided by this invention have the following advantages: (1) Integrated codon preference table. Existing primer design tools do not have codon optimization functions. The conversion of amino acid to nucleotide mutations relies on manual querying, which is fragmented and prone to errors. This invention has a built-in host codon usage frequency table, which can automatically complete the selection of the optimal codon and the comparison of nucleotide changes during the parsing of mutation instructions. It realizes the automated conversion of amino acid mutations to nucleotide changes corresponding to the optimal codon, saves the tedious step of manual querying, and reduces the risk of errors.

[0017] (2) Achieving precise control over the overlapping region. Existing overlapping primer designs employ a symmetrical strategy, determining the primer length first and then passively forming the overlapping region, ultimately resulting in an overlapping region size far exceeding expectations. This invention first pre-defines a fixed-size overlapping region using the mutation center as an anchor point. Then, based on this, the forward primer independently searches for the optimal length from the right boundary of the overlapping region towards the gene 5' direction, and the reverse primer independently searches for the optimal length from the left boundary of the overlapping region towards the gene 3' direction. The forward and reverse primers only share this pre-determined overlapping region size. This scheme ensures precise control over the overlapping region size while supporting independent and flexible adjustments to the forward and reverse primer lengths to optimize annealing temperature and quality score respectively, achieving a balance between precision and flexibility in primer design.

[0018] (3) A quality-driven primer selection mechanism is adopted. Existing tools only provide basic Tm value and GC content calculation functions, and lack a mechanism to feed back the quality assessment results to the primer selection decision process. This invention establishes a multi-dimensional quality assessment system covering seven indicators such as hairpin structure, dimer, and GC clip, and uses quality score and annealing temperature deviation as dual optimization targets for primer selection. This ensures that the finally screened primers meet the experimental requirements in terms of thermodynamic performance and structural stability, effectively reducing the risk of PCR failure. Attached Figure Description

[0019] The accompanying drawings, which form part of this disclosure, are used to provide a further understanding of this disclosure. The illustrative embodiments of this disclosure and their descriptions are used to explain this disclosure and do not constitute an undue limitation of this disclosure.

[0020] Figure 1 This is a flowchart of the primer design method for site-directed mutation of the target protein encoding gene provided in Embodiment 1 of the present invention.

[0021] Figure 2 This is a flowchart of the multi-format parsing of mutation instructions provided in Embodiment 1 of the present invention.

[0022] Figure 3 This is a schematic diagram of the asymmetric partially overlapping primer design strategy provided in Embodiment 1 of the present invention.

[0023] Figure 4 This is a diagram illustrating the primer quality assessment system architecture provided in Embodiment 1 of the present invention.

[0024] Figure 5 The flowchart of the comprehensive scoring and optimal primer selection algorithm provided in Embodiment 1 of the present invention is shown.

[0025] Figure 6 This is a flowchart of the automatic expansion of saturation mutation provided in Embodiment 1 of the present invention.

[0026] Figure 7 This is an architecture diagram of the target protein coding gene site mutation primer design system provided in Embodiment 2 of the present invention. Detailed Implementation

[0027] It should be noted that the following detailed descriptions are exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0028] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments of the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form as well. Furthermore, it should be understood that the terms "comprising," "having," and any variations thereof are intended to cover non-exclusive inclusion, for example, a process, method, system, product, or apparatus that comprises a series of steps or units is not necessarily limited to those steps or units explicitly listed, but may include other steps or units not explicitly listed or inherent to such processes, methods, products, or apparatus.

[0029] Where there is no conflict, the embodiments and features in the embodiments of the present invention can be combined with each other.

[0030] All data acquisition in this embodiment is carried out in accordance with laws and regulations and with user consent, and the data is used legally.

[0031] Example 1 like Figure 1 This embodiment provides a method for designing primers for site-directed mutagenesis of a target protein-coding gene, including: S1. Obtain the coding gene sequence of the target protein and at least one mutation instruction.

[0032] This example uses the coding gene sequence of Escherichia coli FabG enzyme (3-ketoacyl-ACP reductase, EC 1.1.1.100, SDR superfamily member, NCBI accession number M84991.1) as an example. The gene is 735 bp in length and encodes 244 amino acids.

[0033] Input the complete coding DNA sequence of the target protein (5'→3' direction, containing only A, T, C, and G bases), and at least one mutation instruction. In this embodiment, three mutation instructions are input: F77Y (77th position Phe→Tyr), L235P (235th position Leu→Pro), and K127A (127th position Lys→Ala).

[0034] The input gene sequence undergoes preprocessing: non-base characters such as spaces, newlines, and numbers are automatically removed; the sequence is uniformly converted to uppercase; and the sequence is verified to contain only ATCG and be at least 20 bp in length. Additionally, optional upstream and downstream flanking sequences can be accepted: the upstream flanking sequence is the sequence before the gene start codon ATG (e.g., promoter, ribosome binding site), and the downstream flanking sequence is the sequence after the gene stop codon (e.g., terminator). When flanking sequences are provided, the upstream flanking sequence, gene sequence, and downstream flanking sequence are concatenated into a complete template sequence (upstream flanking + gene sequence + downstream flanking). During primer design, the forward primer can extend into the upstream flanking region, and the reverse primer can extend into the downstream flanking region, thus providing primer design capabilities for the first and last amino acids of the gene (positions where primer design is normally impossible due to insufficient primer length). In this example, the mutation site is located in the middle of the gene, and no flanking sequence is needed.

[0035] S2. Based on the gene sequence and the mutation instruction, the mutation instruction is parsed to identify the mutation type. When an amino acid mutation is identified, a preset codon preference table is queried to select the optimal codon for the target amino acid and determine the nucleotide change information. When a saturation mutation is identified, it is automatically expanded into multiple amino acid mutations.

[0036] like Figure 2 It intelligently recognizes mutation instructions and supports four formats: (1) The amino acid single-letter format is represented by connecting the original amino acid single letter, position and target amino acid single letter in sequence, such as F77Y means that the 77th phenylalanine is replaced with tyrosine; (2) The amino acid three-letter format is represented by connecting the three letters of the original amino acid, the position and the three letters of the target amino acid in sequence, such as Phe15Tyr; (3) Multi-target format, with multiple target amino acids separated by commas, such as T56C,G indicates that the threonine at position 56 is mutated to cysteine ​​or glycine, which is automatically split into two independent mutations, T56C and T56G. (4) Saturation mutation format, represented by amino acid, position and saturation marker connected in sequence, wherein the saturation marker is X, , saturated, SAT, BAO, NNK or NNN, automatically expand to the mutation of all amino acids at that position except wild type.

[0037] For amino acid mutations, the built-in E. coli codon frequency table is consulted. This table contains all synonymous codons of the 20 standard amino acids and stop codons, along with their frequencies of use in the host. The optimal codon is marked for each amino acid, and the optimal codon for the target amino acid is selected. The original codon is compared position by position with the optimal codon to determine the specific nucleotide position and target base that needs to be changed.

[0038] Taking K127A as an example, perform the following processing: (a) Calculate the nucleotide start position corresponding to amino acid position 127: ntStart = (127-1)×3 = 378; (b) Extract the original codon: geneSeq[378:381] = “AAA”, translated as Lys; (c) Query the E. coli codon table, the optimal codon for Ala is GCG (frequency 34%). (d) Compare AAA and GCG position by position, A→G at position 1, A→C at position 2, and A→G at position 3, and record the three nucleotide changes {pos:379, from:A, to:G}, {pos:380, from:A, to:C}, and {pos:381, from:A, to:G} (using index position 1). (e) Generate mutation tag: “K127A (AAA→GCG)”.

[0039] For saturation mutations, the wild-type amino acid at that position is automatically read. After excluding the wild-type, the remaining amino acids are expanded into independent amino acid mutation instructions, and primers are designed separately for each instruction.

[0040] S3. Based on the nucleotide change information, determine the primer overlap region. Based on the overlap region, construct forward and reverse primers using an asymmetric extension strategy, wherein the forward and reverse primers extend in different directions of the gene and share only the overlap region.

[0041] The specific method for determining the overlapping region is as follows: Calculate the center position of all mutation sites mutCenter = floor((firstMut + lastMut) / 2), where firstMut and lastMut are the position indices of the first and last mutation sites, respectively; take this center position as the center of the overlapping region, and calculate the starting point oStart = mutCenter - floor((overlap-1) / 2) and the ending point oEnd = oStart + overlap - 1 according to the preset overlap length overlap; when the mutation site exceeds the overlapping region, automatically shift the overlapping region to ensure that all mutated bases are within the overlapping region.

[0042] For the K127A mutation, the mutated nucleotide positions are 379-381 (corresponding to 0 indices 378-380). Assume the overlap length is 15 bp. mutCenter = (378 + 380) / / 2 = 379; oStart = 379 - floor(14 / 2) = 379 - 7 = 372; oEnd = 372 + 15 - 1 = 386; The overlapping region is located at positions 373-387 (index 1) of the gene sequence, and the mutation site is located at positions 379-381 within it. The original sequence of the overlapping region is shown in SEQ ID NO.1, which is ATGATGAAAAAAAGCGT, and the mutated sequence is shown in SEQ ID NO.2, which is ATGATGAGCGAAGCGT.

[0043] like Figure 3 The asymmetric extension strategy is as follows: taking the overlapping region as a reference, the forward primer independently searches from the right boundary of the overlapping region toward gene 5' within a preset length range, and the reverse primer independently searches from the left boundary of the overlapping region toward gene 3' within a preset length range. The lengths of the forward primer and the reverse primer are determined independently, and they only share the overlapping region. The size of the overlapping region is equal to the preset overlapping length.

[0044] Specifically, the sequence interval of the forward primer is [fStart, oEnd], where oEnd is the right boundary of the overlapping region, and fStart searches within the range of [oEnd - maxLen + 1, oEnd - minLen + 1]. The forward primer covers the overlapping region and extends towards the 5' direction of the gene. The sequence interval of the positive strand of the reverse primer is [oStart, rEnd], where oStart is the left boundary of the overlapping region, and rEnd searches within the range of [oStart + minLen - 1, oStart + maxLen - 1]. The reverse primer covers the overlapping region and extends towards the 3' direction of the gene. The final reverse primer sequence is the reverse complementary strand of the positive strand.

[0045] The forward and reverse primers share only the overlapping region, the size of which is exactly equal to the preset overlap length. Outside the overlapping region, the forward primer extends to the left and the reverse primer extends to the right, forming an asymmetric partially complementary structure.

[0046] Table 1 shows the effect of overlapping region control on traditional symmetrical design and the asymmetric extension strategy of this invention, centered on the mutation site: Table 1 Comparison between traditional symmetrical design and asymmetrical extension strategies

[0047] The asymmetric extension strategy of this invention limits the forward primer to extend in the 5' direction and the reverse primer to extend in the 3' direction, so that the two primers only share a preset size overlap region, fundamentally solving the problem of the difficulty in accurately controlling the overlap region in traditional designs.

[0048] For the K127A mutation, the primer length is set to 30-35 bp, and the target Tm is 64℃. Forward primer search: fStart traverses the range [oEnd-35+1, oEnd-30+1] = [352, 357]. For each fStart, a primer sequence geneSeq[fStart:oEnd+1] is constructed and the mutated base is introduced. Tm and quality score are calculated. Six candidate primers (30-35 bp) are evaluated one by one. The 34 bp primer has a quality score reduced to 84 due to the presence of four consecutive adenines (A×4) at the 5' end. The 33 bp primer, with a Tm of 64.1℃ and a quality score of 88, is the optimal primer and is selected. Reverse primer search: rEnd is traversed within the range [oStart+30-1, oStart+35-1]=[401, 406] to construct the positive strand geneSeq[oStart:rEnd+1] and introduce mutated bases. The reverse complementary strand is then selected, and Tm and quality score are calculated. When rEnd=403, the primer length is 32bp, Tm=60.4℃, and the quality score is 84. This primer is selected.

[0049] S4. Perform quality assessment on the forward primer and the reverse primer to obtain a quality score.

[0050] like Figure 4 Seven quality checks were performed on each candidate primer sequence: (1) Hairpin structure detection: detect whether there is a stem-loop self-folding structure inside the primer. The presence of the hairpin structure is determined to be ≥4bp in length and ≥3bp in length, and the presence of the hairpin structure is determined to be ≥6bp in length. (2) Self-dimer detection: the 3' ends of the detection primers are self-complementary and paired. A match of ≥4bp is considered to be present, and ≥6bp is considered to be severe. (3) Cross-dimer detection: The complementary pairing of the 3' end of the forward primer and the 3' end of the reverse primer is detected. A match of ≥4bp is considered to be present. (4) Detection of consecutive identical bases: Detection of sequence segments with 4 or more consecutive identical bases; 5 or more consecutive identical bases are considered serious. (5) Dinucleotide repeat detection, detecting dinucleotide repeat patterns 4 or more times; (6) GC clip detection to detect whether the 3' end of the primer contains a G or C base; (7) 3' end stability test: count the number of GC bases in the last 5 bases of the 3' end of the primer. 1-3 bases are acceptable.

[0051] The quality scoring uses a penalty accumulation mechanism: serious problems incur a penalty of 25 points, warning-level problems incur a penalty of 12 points, and minor problems incur a penalty of 4 points. The quality score = 100 - total penalty points. The quality rating is divided into four levels: A (no problems), B (minor problems only), C (warnings only), and D (serious problems).

[0052] For the selected forward and reverse primer pairs for the K127A mutation, a seven-dimensional quality assessment was performed: the forward primer, as shown in SEQ ID NO.3, is AAAGCGGTAATGCGCGCTATGATGGCGAAGCGT (33bp), with a 4bp hairpin structure (4bp stem length, 8bp loop length), a quality score of 88, grade C; the reverse primer, as shown in SEQ ID NO.4, is GTGATAATACGACCATGACGCTTCGCCATCAT (32bp), with a 4bp hairpin structure (4bp stem length, 22bp loop length) and no GC clip at the 3' end, a quality score of 84, grade C; the cross-dimer is 0bp. The hairpin structure stem length is only 4bp (lower limit of detection threshold), having limited impact on PCR amplification; therefore, this primer pair is accepted.

[0053] S5. Based on the quality score, with the goal of minimizing the annealing temperature deviation and optimizing the quality score, the optimal primer pair is selected through iterative search and the primer design results are output.

[0054] like Figure 5 With the dual objectives of minimizing the target annealing temperature deviation and optimizing the quality score, within a preset overlap length range (traversing from largest to smallest), candidate forward and reverse primers are traversed within the primer length range for each overlap length, and the optimal primer pair is selected through comprehensive scoring.

[0055] Specifically, the parameters are first initialized, then the overlap lengths (from overlapMax to overlapMin) are traversed, and the overlap regions (oStart, oEnd) are calculated. For each overlap length, the positions of the forward primer fStart are traversed, and the Tm value and quality score are calculated. Simultaneously, the Tm value and quality score are calculated by traversing each position of the reverse primer rEnd. The calculation results from both sides are combined into the comprehensive scoring module, and the score is calculated using the comprehensive scoring formula. It is then checked whether the score is greater than the current best score (Score>best?). If so, the bestScore is updated; otherwise, the current best score is retained. The process continues to check if the iteration is complete. If not, the iteration continues; if so, the optimal primer pair is output.

[0056] The comprehensive scoring formula is:

[0057] in, and These are the annealing temperatures for the forward and reverse primers, respectively. The target annealing temperature, For annealing temperature deviation penalty weight, and The quality scores for the forward and reverse primers are respectively. The compression factor for the quality score. The severity of cross-dimerization is indicated by a value ranging from 0 to 3. The weight for cross-dimer penalty. 3 points are added for each GC content in the range of 40%-60%. Add 2 points if the overlap length equals the minimum target value.

[0058] In a preferred embodiment, The value is 2. The value is 0.05. The value is set to 15. The values ​​of each weight parameter are based on the following: A score of 2 means that 2 points will be deducted for every 1°C deviation of the primer annealing temperature from the target, ensuring that the selected primer pair has thermodynamic properties close to the target annealing temperature; By setting the value to 0.05, the quality score range of 0-100 points is compressed into a contribution range of 0-5 points, so as to prevent the quality score item from numerically overshadowing the annealing temperature deviation item, and to make the quality score play an auxiliary and regulatory role rather than a dominant role in the overall score. A score of 15 indicates that 15 points are deducted for each level increase in the severity of cross-dimerism, in order to exclude candidate primer pairs containing cross-dimerism from the preferred selection range.

[0059] This comprehensive scoring formula balances Tm bias, quality score, cross-dimer risk, and GC content and overlap length bonuses to ensure that the final selected primer pairs meet experimental requirements in terms of thermodynamic performance and structural stability.

[0060] Annealing temperature is calculated using the salt correction formula: Tm = 81.5 + 16.6 × log10[Na + + 0.41 × (%GC) - 600 / N Among them [Na] + ] represents the sodium ion concentration (default 50mM), %GC represents the percentage of G and C bases in the primer sequence, and N represents the primer length.

[0061] During the iterative search process, if the Tm deviation of a candidate primer is ≤1.0℃ and the quality severity is ≤1, the search in the current direction is terminated in advance to improve efficiency.

[0062] Outputs primer design results for each mutant, including: mutation tag, nucleotide change details, forward primer sequence and Tm / GC / length / position / quality rating, reverse primer sequence and parameters, overlap region size, and primer alignment view. Supports batch copying of all primers, copying summary tables, and CSV export. In CSV export, mutated bases are labeled with lowercase letters, and non-mutated bases are labeled with uppercase letters for easy differentiation.

[0063] The design results of the three mutations in this embodiment are summarized in Table 2: Table 2 Summary of the design results of the three mutant primers K127A, F77Y, and L235P

[0064] Taking the design of forward primers for the K127A mutation as an example, there are two forward primers with similar Tm values ​​in the candidate primer pool, as shown in Table 3: Table 3 Comparison of quality assessment between primer A and primer B

[0065] Primer A, shown in SEQ ID NO. 9, has a smaller Tm bias (0.0℃ vs 0.1℃), but primer B, shown in SEQ ID NO. 3, has a higher quality score (88 vs 84). Primer A has an additional deduction because it contains four consecutive adenines (A×4) at the 5' end of its sequence, triggering the detection of consecutive identical bases. In the individual scoring, primer A's self-score = 0.0×2 + 84×0.1 = 8.4, while primer B's self-score = 0.1×2 + 88×0.1 = 8.6. The quality score advantage (0.4 points) outweighs the Tm bias disadvantage (0.2 points), so primer B is ultimately selected.

[0066] like Figure 6 Taking the mutation instruction "M1X" (Met at position 1 → all 19 non-wild-type amino acids) as an example, the saturation mutation expansion is performed as follows: (1) Parse the instruction format and identify the saturation marker "X"; (2) Read the first codon ATG and translate it into Met; (3) After excluding wild-type Met, the remaining 19 amino acids (A, R, N, D, C, Q, E, G, H, I, L, K, F, P, S, T, W, Y, V) were analyzed one by one; (4) For each amino acid mutation, look up the optimal codon (e.g., Ala→GCG, Arg→CGT, etc.) to determine the nucleotide change; (5) Primer design procedures were performed for each of the 19 groups of mutations; (6) Output the design results of 19 sets of primers, and label them as saturation mutations.

[0067] This function compresses the workload of manually writing 19 sets of mutation instructions and designing primers one by one into a single line of instructions that can be completed automatically.

[0068] Example 2 like Figure 7 This embodiment provides a target protein-coding gene site-directed mutagenesis primer design system, including: The sequence acquisition module is used to acquire the coding gene sequence of the target protein and at least one mutation command. This module provides an input interface for the gene sequence, upstream flanking sequences, downstream flanking sequences, and mutation commands, and supports automatic cleaning and format verification. When flanking sequences are provided, they are automatically assembled into a complete template sequence.

[0069] The mutation parsing module is used to parse the mutation instruction based on the gene sequence and the mutation instruction, identify the mutation type, and when an amino acid mutation is identified, query a preset codon preference table to select the optimal codon for the target amino acid and determine the nucleotide change information; when a saturation mutation is identified, it is automatically expanded into multiple amino acid mutations. This module performs the identification and parsing of multi-format mutation instructions, integrates the E. coli codon preference table, realizes automatic conversion from amino acids to optimal codons, and supports automatic expansion and multi-target splitting of saturation mutations.

[0070] The primer design module is used to determine the primer overlap region based on the nucleotide change information. Based on the overlap region, an asymmetric extension strategy is used to construct forward and reverse primers, wherein the forward and reverse primers extend in different directions along the gene and share only the overlap region. This module uses the mutation center as an anchor point to determine the overlap region; the forward primer extends in the 5' direction, and the reverse primer extends in the 3' direction, ensuring precise control over the size of the overlap region.

[0071] The quality assessment module is used to perform quality assessment on the forward and reverse primers to obtain a quality score. This module performs seven-dimensional quality checks, including hairpin structure, self-dimerization, cross-dimerization, continuous bases, dinucleotide repeats, GC clips, and 3' end stability detection, and calculates the quality score and rating.

[0072] The output filtering module is used to select the optimal primer pair and output the primer design results through iterative search based on the quality score, with the goals of minimizing annealing temperature deviation and optimizing the quality score. This module aims for dual optimization of annealing temperature deviation and quality score, selecting the optimal primer pair through iterative search and comprehensive scoring. It supports early termination of optimization, outputs primer sequences and various parameters, and supports batch processing, CSV export, and lowercase annotation of mutation sites.

[0073] The system described in this embodiment can be deployed in several forms: a web application, deployed on a cloud server as a single-page HTML application, accessible to users via a browser without the need to install local software; a desktop application, packaged as a local installer for Windows / macOS / Linux platforms using the Electron framework, supporting offline use; and a command-line tool, integrated into the bioinformatics analysis workflow as a script.

[0074] Example 3 Embodiment 3 of the present invention provides an electronic device.

[0075] An electronic device includes a memory, a processor, and a program stored in the memory and running on the processor. The processor includes, but is not limited to, at least one of a central processing unit (CPU), a graphics processing unit (GPU), a neural network processor (NPU), a tensor processor (TPU), or an artificial intelligence acceleration chip. When executing the program, the program implements the steps in the target protein encoding gene site-directed mutation primer design method as described in Embodiment 1 of the present invention.

[0076] The detailed steps are the same as the target protein encoding gene site mutation primer design method provided in Example 1, and will not be repeated here.

[0077] Example 4 Embodiment 4 of the present invention provides a computer-readable storage medium.

[0078] A computer-readable storage medium having a program stored thereon, which, when executed by a processor, implements the steps in the target protein coding gene site-directed mutagenesis primer design method as described in Embodiment 1 of the present invention.

[0079] The detailed steps are the same as the target protein encoding gene site mutation primer design method provided in Example 1, and will not be repeated here.

[0080] Example 5 Embodiment 5 of the present invention provides a computer program product.

[0081] A computer program product includes software code, wherein the program in the software code performs the steps in the target protein encoding gene site-directed mutagenesis primer design method as described in Embodiment 1 of the present invention.

[0082] The detailed steps are the same as the target protein encoding gene site mutation primer design method provided in Example 1, and will not be repeated here.

[0083] Those skilled in the art will understand that embodiments of the present invention can be provided as methods, systems, or computer program products. Therefore, the present invention can take the form of a completely hardware embodiment, a completely software embodiment, or an embodiment combining software and hardware aspects. Furthermore, the present invention can take the form of a computer program product implemented on one or more computer-usable storage media (including but not limited to disk storage, CD-ROM, optical storage, etc.) containing computer-usable program code. The solutions in the embodiments of the present invention can be implemented using various computer languages. For example, in one implementation, the methods and systems can be developed based on deep learning frameworks (such as TensorFlow, PyTorch, etc.) and using the Python language. Those skilled in the art will understand that other suitable programming languages ​​or tools can also be used for implementation without departing from the core ideas of the present invention.

[0084] The above description is merely a preferred embodiment of this practice and is not intended to limit the scope of this practice. Various modifications and variations can be made to this practice by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of this practice should be included within the protection scope of this practice.

Claims

1. A method for designing primers for site-directed mutagenesis of a target protein-coding gene, characterized in that, include: Obtain the coding gene sequence of the target protein and at least one mutation instruction; Based on the gene sequence and the mutation instruction, the mutation instruction is parsed to identify the mutation type. When an amino acid mutation is identified, a preset codon preference table is queried to select the optimal codon for the target amino acid and determine the nucleotide change information. When a saturation mutation is identified, it is automatically expanded into multiple amino acid mutations. Based on the nucleotide change information, the primer overlap region is determined. Based on the overlap region, an asymmetric extension strategy is used to construct forward and reverse primers, wherein the forward and reverse primers extend in different directions of the gene and share only the overlap region. A quality assessment was performed on the forward and reverse primers to obtain a quality score. Based on the quality score, with the goal of minimizing the annealing temperature deviation and optimizing the quality score, the optimal primer pair is selected through iterative search and the primer design results are output.

2. The method according to claim 1, characterized in that, The parsing of the mutation instructions supports the following formats: The amino acid single-letter format is represented by sequentially connecting the original amino acid single letter, its position, and the target amino acid single letter. The amino acid three-letter format is represented by sequentially connecting the three letters of the original amino acid, the position, and the three letters of the target amino acid. Multi-target format, with multiple target amino acids separated by commas, automatically splits into multiple independent mutations; The saturation mutation format is represented by connecting amino acids, positions, and saturation markers in sequence, and automatically expands to a mutation of all amino acids at that position except for the wild type.

3. The method according to claim 1, characterized in that, The determination of the primer overlap region specifically involves: calculating the center position of all mutation sites, using this center position as the center of the overlap region, and calculating the start and end points of the overlap region according to the preset overlap length; when a mutation site exceeds the overlap region, automatically shifting the overlap region so that all mutated bases are located within the overlap region.

4. The method according to claim 1, characterized in that, The asymmetric extension strategy is as follows: taking the overlapping region as a reference, the forward primer independently searches from the right boundary of the overlapping region toward gene 5' within a preset length range, and the reverse primer independently searches from the left boundary of the overlapping region toward gene 3' within a preset length range. The lengths of the forward primer and the reverse primer are determined independently, and they only share the overlapping region. The size of the overlapping region is equal to the preset overlapping length.

5. The method according to claim 1, characterized in that, The quality assessment includes: Hairpin structure detection is used to detect whether a stem-loop self-folding structure exists inside the primer; Self-dimer detection is used to detect self-complementary pairing at the 3' end of primers; Cross-dimer detection is used to detect complementary pairing between the 3' end of the forward primer and the 3' end of the reverse primer; Detection of consecutive identical bases is used to detect the presence of sequence segments with consecutive identical bases. Dinucleotide repeat detection is used to detect the presence of dinucleotide repeat patterns. GC clip detection is used to detect whether the 3' end of a primer contains a G or C base. 3' end stability detection is used to count the number of GC bases in the 3' end region of the primer.

6. The method according to claim 1, characterized in that, The iterative search selects the optimal primer pair, and its comprehensive scoring formula is as follows: in, and These are the annealing temperatures for the forward and reverse primers, respectively. The target annealing temperature, For annealing temperature deviation penalty weight, and The quality scores for the forward and reverse primers are respectively. The compression factor for the quality score. The severity of cross-dimerization, The weight for cross-dimer penalty. Bonus points are awarded for GC content within a preset range. Bonus points are awarded when the overlap length equals the minimum target value.

7. A primer design system for site-directed mutagenesis of a target protein-coding gene, characterized in that, include: The sequence acquisition module is used to acquire the coding gene sequence of the target protein and at least one mutation instruction; The mutation parsing module is used to parse the mutation instruction based on the gene sequence and the mutation instruction, identify the mutation type, and when it is identified as an amino acid mutation, query a preset codon preference table, select the optimal codon for the target amino acid, and determine the nucleotide change information; when it is identified as a saturation mutation, it automatically expands it into multiple amino acid mutations. The primer design module is used to determine the primer overlap region based on the nucleotide change information, and to construct forward and reverse primers using an asymmetric extension strategy based on the overlap region, wherein the forward and reverse primers extend in different directions of the gene and share only the overlap region. The quality assessment module is used to perform quality assessment on the forward primer and the reverse primer to obtain a quality score; The filtering output module is used to select the optimal primer pair and output the primer design results by iteratively searching based on the quality score, with the goal of minimizing the annealing temperature deviation and optimizing the quality score.

8. An electronic device comprising a memory, a processor, and a computer program stored in the memory and running on the processor, characterized in that, When the processor executes the program, it implements the steps of the target protein encoding gene site-directed mutagenesis primer design method according to any one of claims 1 to 6.

9. A computer-readable storage medium having a computer program stored thereon, characterized in that, When executed by the processor, the program implements the steps of the method for designing primers for site-directed mutations of the target protein encoding gene according to any one of claims 1 to 6.

10. A computer program product, comprising software code, characterized in that, The program in the software code executes the steps of the target protein encoding gene site-directed mutagenesis primer design method according to any one of claims 1 to 6.

Images