Delivery of collagen type iv alpha chain using split-intein dual aav vectors

Abstract

This document discloses a splitting intronipeptide system comprising a first nucleic acid molecule encoding a fusion protein comprising an N-external peptide of an external peptide pair and an N-internal peptide of an intronipeptide pair, wherein the N-external peptide comprises a first signal sequence located at the N-terminus of the N-terminal portion of the type IV collagen α chain. A second nucleic acid molecule is also disclosed, encoding a fusion protein comprising a second signal sequence, a C-internal peptide of the intronipeptide pair, and a C-external peptide of the external peptide pair, wherein the C-external peptide comprises the C-terminal portion of the type IV collagen α chain. Furthermore, an AAV vector comprising these nucleic acid molecules is disclosed, as well as methods for treating subjects with Alport syndrome using these AAV vectors or nucleic acid molecules.

Description

Cross-references to related applications

[0001] This application claims priority to U.S. Provisional Application No. 63 / 564,923, filed March 13, 2024, which is incorporated herein by reference in its entirety.

[0002] Incorporation of electronic sequence lists The sequence list was submitted as an XML file named "899-111312-02_Sequence" (~621127 bytes), created on February 19, 2025, and is incorporated into this paper by reference. Technical Field

[0003] This disclosure relates to gene therapy methods (including a splitting intron system), compositions, and systems for treating Alport syndrome, including the use of an AAV vector encoding a splitting intron system. Background Technology

[0004] Alport syndrome, also known as hereditary nephritis, is a genetic disorder caused by mutations in the type IV collagen alpha chain gene. These mutations impair the normal production and / or assembly of the type IV collagen network, which forms parts of the kidneys, eyes, and inner ear. These mutations are associated with thinning, thickening, splitting, and stratification of the type IV collagen membrane. While there is currently no cure for Alport syndrome, treatment can slow the progression of the kidney disease. However, in practice, most patients progress to a stage requiring dialysis or kidney transplantation. In the United States, Alport syndrome accounts for approximately 2.2% of children with end-stage renal disease and 0.2% of adults with end-stage renal disease. There is a need for alternative therapies to treat Alport syndrome. Summary of the Invention

[0005] This paper discloses a splitting intron system comprising a first nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, an N-external peptide of an external peptide pair and an N-internal peptide of an intronal peptide pair, wherein the N-external peptide comprises a first signal sequence located at the N-terminus of the N-terminal portion of a type IV collagen α chain. The splitting intron system comprises a second nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, a second signal sequence, a C-internal peptide of the intronal peptide pair, and a C-external peptide of the external peptide pair, wherein the C-external peptide comprises the C-terminal portion of the type IV collagen α chain. In some examples, the type IV collagen α chain is COL4A5. The N-terminal and C-terminal portions of the type IV collagen α chain together define the sequence of the type IV collagen α chain separated at the cleavage point. The N-external and C-external peptides in this splitting intron system are spliced ​​together during expression in mammalian cells to form a mature type IV collagen α chain. In some respects, the system comprises a first adeno-associated virus (AAV) vector containing a first nucleic acid molecule and / or a second AAV vector containing a second nucleic acid molecule.

[0006] The method of treating Alport syndrome is also disclosed, including administering a therapeutically effective amount of the split intipeptide system or a pharmaceutical composition containing the split intipeptide system to a subject.

[0007] The above and other features and advantages of the present invention will become more apparent from the following detailed description of several examples with reference to the accompanying drawings. Attached Figure Description

[0008] Figure 1A-1C A table of exemplary intron insertion sites and their characteristics in .COL4A5. In the column labeled "Structure": SS, signal sequence; CD, collagen domain; Int, non-collagen interruption region; NC1, non-collagen C-terminal domain. In the column labeled "Load into AAV?", "Yes" indicates that the construct can be loaded into an AAV when using a CAG promoter-driven expression cassette; "Maybe" indicates that the construct can be loaded into an AAV when using a combination of a shorter enhancer-promoter and a shorter polyadenylation signal (the combined size of which is about 0.2 kb or less).

[0009] Figure 2 Receiver operating characteristic (ROC) curve analysis was performed based on the similarity predictions of a support vector machine (SVM) model to natural exon peptide splicing sites. SVM scores for a total of 752 labeled data points were determined using leave-one-out cross-validation and used to plot ROC curves to evaluate the model. The 45-degree dashed line represents random guessing.

[0010] Figure 3 A table of confusion matrices for predicting exon peptide splicing sites using an SVM model is provided.

[0011] Figures 4A-4D A table of exemplary intron insertion sites and their characteristics in .COL4A3. In the column labeled "Structure": SS, signal sequence; CD, collagen domain; Int, non-collagen break region; NC1, non-collagen C-terminal domain. In the column labeled "Load into AAV?", "Yes" indicates that the construct can be loaded into an AAV when using a CAG promoter-driven expression cassette; "May" indicates that the construct can be loaded into an AAV when using a combination of a shorter enhancer-promoter and a shorter polyadenylation signal (the combined size of which is about 0.2 kb or less).

[0012] Figures 5A-5D A table of exemplary intron insertion sites and their characteristics in .COL4A4. In the column labeled "Structure": SS, signal sequence; CD, collagen domain; Int, non-collagen break region; NC1, non-collagen C-terminal domain. In the column labeled "Load into AAV?", "Yes" indicates that the construct can be loaded into an AAV when using a CAG promoter-driven expression cassette; "May" indicates that the construct can be loaded into an AAV when using a combination of a shorter enhancer-promoter and a shorter polyadenylation signal (the combined size of which is about 0.2 kb or less).

[0013] Figures 6A-6E . Figure 6A : A map of the splitting intron COL4A5 construct. Twelve splitting sites are indicated out of 27. Amino acid positions show the C-half + 1 amino acid residue in the splitting intron Col4A5 construct. H53 indicates the epitope position of the rat monoclonal anti-COL4A5 antibody (H53 clone) used in this study. The general structures of the full-length COL4A5 construct (No. 1), the splitting intron COL4A5 N-half construct (No. 2), and the splitting intron C-half constructs (Nos. 2-6) are shown. (Astro) () indicates the insertion position of WPRE or WPRE3 for constructs carrying either the post-transcriptional regulatory element (WPRE) or the post-transcriptional regulatory element 3 (WPRE3) of marmot hepatitis virus. Figure 6B The role of the signal sequence in the efficient expression of the C half of the cleavage inteptide COL4A5. Using expression of nativeSS-Cint-Col4A5-FLAG ( Figure 6A (Middle No. 3, Split Point 1), chymoSS-Cint-Col4A5-FLAG ( Figure 6A (Middle No. 4, Split Point 1) or noSS-Cint-Col4A5-FLAG ( Figure 6AHEK293 cells were transfected with plasmid DNA from cell line 5 (mitochondrial site 1), and the expression level of the COL4A5 C hemisphere protein in the cells was assessed by Western blotting using an anti-FLAG antibody. GAPDH was used as a loading control. Figure 6C Trans-splicing efficiency of constructs containing the C half of the splitting intipeptide with different signal sequences was assessed. HEK293 cells were transfected with plasmid DNA expressing the constructs shown above each lane. 1. Full-length COL4A5-FLAG ( Figure 6A 1, Split point 1); 2, Col4A5-Nint-FLAG ( Figure 6A No. 2, Split Point 1); 3, nativeSS-Cint-Col4A5-FLAG ( Figure 6A 3rd in the middle, split point 1); 4, chymoSS-Cint-Col4A5-FLAG ( Figure 6A The fourth one in the middle, split point 1); and 5, noSS-Cint-Col4A5-FLAG ( Figure 6A Cell lysate number 5 (mitochondrial point 1). Western blot analysis of crude cell lysates was performed using anti-FLAG antibody. GAPDH was used as a loading control. Figure 6D Trans-splicing of the cleavage intipeptide COL4A5 protein in HEK293 cells. HEK293 cells were transfected with plasmid DNA expressing the constructs shown above each lane. 1. Full-length Col4A5-FLAG ( Figure 6A 1. Split point 2); 2. nativeSS-Cint-Col4A5-FLAG ( Figure 6A 3, split point 2); and 3, Col4A5-Nint-FLAG ( Figure 6A Cell lysate number 2 (mitochondrial point 2). Western blot analysis was performed on the crude cell lysates using anti-FLAG antibody. The pAAV-CAG-FLAG-Empty plasmid was used as a negative control (Neg). Figure 6E Human podocytes transduced with the peptide-containing dual AAV-Col4A5 vector secrete trans-spliced ​​full-length COL4A5 protein. The AAV-KP1 vector shown in the panel was generated, purified, and titrated at 1 × 10⁻⁶. 5 The multiple of infection (MOI) was determined by infecting terminally differentiated human podocytes with each AAV-KP1 vector. Western blot analysis was performed to detect AAV-vector-derived COL4A5 protein produced in AAV-vector-transduced podocytes and secreted into the culture medium within 48 hours. An anti-HA antibody was used to distinguish between endogenous COL4A5 protein and AAV-vector-derived HA-tagged COL4A5 protein.

[0014] Figure 7A table showing the COL4A5 split point and the genome lengths of the N and C halves of the splitting peptide-containing vector, bis-AAV-CAG-Col4A5.

[0015] Figures 8A-8D Table of constructs for the splitting peptide-containing dual AAV-CAG-Col4A5 vector plasmid. na indicates not applicable.

[0016] Figures 9A-9F Functional validation of trans-splicing site candidates in COL4A5. Using plasmid DNA or combinations of plasmid DNA expressing COL4A5 (e.g., ...). Figure 9E-9F HEK293 cells were transfected with the plasmid (listed in the diagram). Forty-eight hours post-transfection, cells were harvested and trans-splicing of proteins was assessed by Western blot analysis using anti-FLAG and anti-human COL4A5 antibodies. Each inset represents an independent experiment, and all experiments included the SP2 construct, a full-length control (ctrl), and an empty plasmid negative control. Samples indicated by N+C received plasmid constructs containing the cleaved intipeptide COL4A5 N and C halves. Samples in lanes 4 and 10 received N and C halves, but the C half construct did not contain the signal sequence. Sample in lane 23 received the expected trans-splicing N and C halves; however, the full-length COL4A5 construct did not contain the FLAG tag and therefore could not be detected using the anti-FLAG antibody. The location of the full-length COL4A5 is indicated in each inset.

[0017] Figure 9G .pass Figures 9A-9F The method used in this study determined the protein trans-splicing (PTS) efficiency at 11 feasible cleavage sites.

[0018] Figure 9H .pass Figures 9A-9F The COL4A5 amino acid motif at the protein trans-splicing (PTS) site was determined using the method used in this study.

[0019] Figure 10 The effect of the ratio of the N- and C-half constructs of the cleavage inteptide COL4A5 on protein transsplicing. HEK293 cells were transfected with plasmid constructs containing the N- and C-half constructs of the cleavage inteptide COL4A5 at different ratios. Forty-eight hours after transfection, cells were harvested and transsplicing was assessed by Western blot analysis using anti-FLAG and anti-human COL4A5 antibodies. The pAAV-CAG-Col4A5-FLAG-WPRE and pAAV-CAG-GFP plasmids were used as the full-length control (ctrl) and negative control (ctrl), respectively. The location of the full-length COL4A5 is shown.

[0020] Figure 11A-11BEffects of the splitting point (SP) on the N and C halves of the splitting intipeptide COL4A5 construct in HEK293 cells. The expression of the N halves of the splitting intipeptide COL4A5 was used... Figure 11A ) or C-segment construct ( Figure 11B HEK293 cells were transfected with plasmid DNA. The construct expressed in each sample is indicated above the inset. Forty-eight hours after transfection, cells were harvested and the steady-state level of each construct was assessed by Western blot analysis using anti-FLAG antibody. The band near the bottom of inset B is a nonspecific band.

[0021] Figures 12A-12E . Figure 12A Genomic map of the LSL-Col4a5 knock-in allele. Figure 12A A 1.1-kb LSL box carrying three copies of the SV40 polyadenylation signal and flanked by two loxP sequences was inserted into mouse X chromosome loci between 141,510,668 and 141,510,669 (mm10). Figure 12B-12E : LSL-Col4a5 mouse phenotype. Body weight was monitored in hemizygous male mice (i.e., KO) and wild-type male mice. Figure 12B Proteinuria Figure 12C ), survival rate ( Figure 12D ) and blood biomarkers ( Figure 12E The study showed progressive weight loss and chronic kidney disease, eventually leading to end-stage renal disease. All affected animals reached death or the study endpoint at 34 weeks of age. A two-way ANOVA with repeated measures was used. Figure 12B-12C ) and log-rank test ( Figure 12D ). p < 0.0001. Error bars represent SEM. Blood urea nitrogen (BUN). Hematocrit (hct). Hematocrit (PCV). Hemoglobin (Hb).

[0022] Figures 13A-13B .CKD 1 AAV9 IV injection, rather than AAV-KP1 IV injection, enhances podocyte transduction. Figure 13A Representative glomeruli from mouse kidneys injected with each AAV vector expressing tdTomato (tdT). Podocyte transduction was assessed using staining with anti-WT1 antibody. Scale bar, 100 μm. Figure 13B : Quantitative assessment of podocyte transduction efficiency by manually counting WT1-labeled tdT+ and tdT- podocytes. p < 0.0001; p < 0.05; ns, not significant. Error bars represent SEM. Two-way ANOVA was used, followed by a Tukey post-hoc test. P-values ​​are corrected p-values.

[0023] Figures 14A-14H In the LSL Col4a5 XLAS mouse model, AAV9 IV gene therapy transduced podocytes and restored type IV collagen expression in the glomeruli. Three 17-week-old LSL Col4a5 hemizygous (He) male mice received 6.8 × 10⁸ AAV9 IV gene therapy. 11 AAV9-CAG-Cre treatment for vg. Figure 14A Ten weeks post-injection, the expression of Col4a4 and Col4a5 proteins in the kidneys of an AAV vector-treated mouse (He+AAV) was evaluated using anti-COL4A4 (clone b42) and anti-COL4A5 (clone H53) antibodies. He and wild-type (WT) mice were used as negative and positive controls, respectively. and Indicates continuous sections. Glomerular instances visible in both sections are indicated by arrows. Scale bar, 100 μm. Compared to the He control, treated mice showed significantly higher expression of COL4A4 and COL4A5, particularly in the glomeruli. Figure 14B The same glomerulus in He mice treated with AAV vector was stained with the antibody shown. COL4A4 and COL4A5 showed a clear overlapping staining pattern. Scale bar, 50 μm. Figure 14C In the LSLCol4a5 XLAS mouse model, AAV9 IV gene therapy mediated the therapeutic effect. Three male LSLCol4a5 hemizygous (He) mice at 17 weeks of age were subjected to a 6.8 × 10⁻⁶ gene therapy. 11 Mice were treated with the AAV9-CAG-Cre vector via intravenous injection at doses of vg, and their body weight was monitored until 19 weeks (36 weeks of age) post-injection. Ten weeks post-injection, one mouse was euthanized for histological evaluation. Body weight was normalized to its weight at injection time (i.e., 17 weeks of age). Figure 14D LSL-Col4a5 hemizygous (He) male mice (n=11) were injected with 3.0 × 10⁻⁶ molluscs solution via retroorbital injection at 4 weeks of age. 11 vg was treated with AAV9-CAG-Cre vector and its weight was monitored until 56 weeks of age. Figure 14E : Monitored albuminuria in mice treated with the AAV vector shown in inset D until 17 weeks of age. The data did not clearly indicate that AAV vector treatment effectively prevented albumin leakage into the urine. Figure 14F : Measurement of AAV vector-treated mice at 31 weeks of age (shown in Figure 14D Blood biomarkers in ). Figure 14GSurvival analysis of LSL-Col4a5 XLAS mice treated with or without AAV9 IV gene therapy at 4 weeks of age. Data showed that the therapy extended median survival from 31.5 weeks to 50.0 weeks. Figure 14H H&E-stained kidneys collected from mice at 31 to 32 weeks of age. This indicates that AAV9 IV gene therapy mediates therapeutic effects in XLAS mice, leading to improvements in biomarkers and survival when injected at an earlier age. p < 0.0001. Two-way ANOVA with repeated measures was used. Error bars represent SEM.

[0024] Figures 15A-15C Representative images of glomeruli in Col4a5 G5X XLAS mice intravenously injected with a splitting intron peptide dual AAV9 vector expressing COL4A5. Two 26-week-old Col4a5 G5X XLAS hemicolon male mice were intravenously injected with a 1:1 mixture of the splitting intron peptide dual AAV-CAG-Col4a5 N- and C-half vectors. Three weeks post-injection, kidney tissue was stained with the antibodies shown in each inset. HA, anti-HA antibody; LAMB2, anti-laminus β2 / γ1 antibody (glomerular basement membrane (GBM) marker); WT1, anti-WT1 antibody (podocyte marker); and H53, anti-COL4A5 antibody. Anti-COL4A5 H53 antibody detected the COL4A5 N-half, while anti-HA antibody detected the C-half. Figure 15A No obvious HA staining was observed in untreated mice. Figure 15B-15C : Mice treated with the cleavage of the inteptide-dual AAV9 vector. Arrows indicate COL4A5-positive podocytes. Scale bar, 50 μm. Figure 15B The HA staining pattern overlaps with the LAMB2 staining pattern. Figure 15C The HA staining pattern overlaps with the H53 staining pattern.

[0025] Figures 16A-16D Assessment of the percentage (deposition%) of Col4a5 deposition in GBM in LSL-Col4a5 XLAS mice treated with IV AAV9-CAG-Cre. From 3 × 10⁻⁶ IV injections at 4 weeks of age... 11 Kidneys were harvested from two 31-week-old LSL-Col4a5 hemizygous male mice (#1 and #2) treated with vg AAV9-CAG-Cre. Both mice showed therapeutic efficacy. Figure 16AKidney sections were stained with anti-rat COL4A5 antibody (H53) and anti-rabbit agrin antibody and examined by confocal microscopy. Approximately 10 Col4a5-positive glomeruli were randomly selected, and the lengths of agrin and Col4a5-positive membrane structures within Bowman's capsule were analyzed, representing the total length of GBM and Col4a5-deposited GBM, respectively. Using ImageJ software, GBM was traced with thin lines in each small plot, and the total length of the lines in each small plot was determined. Scale bar, 20 μm. Figure 16B The percentage of Col4a5 deposition in GBM within each glomerulus was calculated using the formula (Col4a5 length) / (aggregate length) × 100. A similar length-based method has previously been used to quantify the degree of the foot process effacement observed in podocyte dysplasia (Derewicz). et al. Archives of the Balkan Medical Union 54:532-539, 2019. Error bars indicate SD. Figure 16C Total deposition was determined based on the mean deposition percentage in each Col4a5-positive glomerulus and the percentage of Col4a5-positive glomeruli in the total number of glomeruli assessed. Figure 16D : Received a total of 4×10 IV injections 13 In Col4a5 G5X XLAS mice treated with a 1:1 mixture of AAV9-CAG-COL4A5-Nint-F(SP2) and AAV9-CAG-COL4A5-Cint-H(SP2), GBM was positive for both AAV-derived COL4A5 and endogenous Col4a4 (indicated by arrows). Mice were treated at 18 weeks of age and euthanized at 32 weeks of age. COL4A5 reconstituted by PTS and endogenous Col4a4 were evaluated using anti-HA and anti-COL4A4 (B42) antibodies. Significant overlap between Col4a4 and HA (COL4A5) staining patterns was observed in the merged view.

[0026] sequence The nucleic acid and amino acid sequences listed in the attached sequence listing are represented using standard letter abbreviations for nucleotide bases and single-letter codes for amino acids, as defined in 37 CFR 1.822. Only one strand of each nucleic acid sequence is shown, but any reference to the strand shown is to include its complementary strand.

[0027] In the attached sequence list: SEQ ID NO: 1 is an exemplary CAG-WPRE-SV40pA expression cassette.

[0028] SEQ ID NO: 2 is an exemplary CAG-WPRE3-SV40pA expression cassette.

[0029] SEQ ID NO: 3 is an exemplary CAG-SV40pA expression cassette.

[0030] SEQ ID NO: 4 is an exemplary collagen signal sequence.

[0031] SEQ ID NO: 5 is an exemplary chymotrypsin signal sequence.

[0032] SEQ ID NO: 6 is an exemplary FLAG tag of 22 amino acids.

[0033] SEQ ID NO: 7 is an exemplary human influenza virus hemagglutinin label.

[0034] SEQ ID NO: 8 is an exemplary sgRNA, Col4a5_crRNA1.

[0035] SEQ ID NO: 9 is an exemplary sgRNA, Col4a5_crRNA2.

[0036] SEQ ID NO: 10 is an exemplary sgRNA, Col4a5_crRNA3.

[0037] SEQ ID NO: 11 is an exemplary forward primer derived from LHA.

[0038] SEQ ID NO: 12 is an exemplary reverse primer derived from the KI region.

[0039] SEQ ID NO: 13 is an exemplary COL4A3 amino acid sequence.

[0040] SEQ ID NO: 14 is an exemplary COL4A4 amino acid sequence.

[0041] SEQ ID NO: 15 is an exemplary COL4A5 amino acid sequence.

[0042] SEQ ID NO: 16 is an exemplary COL4A5 amino acid sequence, NP_203699.1.

[0043] SEQ ID NO: 17 is an exemplary COL4A5 amino acid sequence, AAI51847.1.

[0044] SEQ ID NO: 18 is an exemplary COL4A5 amino acid sequence, AIW39922.1.

[0045] SEQ ID NO: 19 is an exemplary COL4A5 amino acid sequence, XP_016884749.1.

[0046] SEQ ID NO: 20 is an exemplary COL4A5 amino acid sequence, XP_016884748.1.

[0047] SEQ ID NO: 21 is an exemplary COL4A5 amino acid sequence, XP_011529151.2.

[0048] SEQ ID NO: 22 is an exemplary COL4A5 amino acid sequence, XP_047297766.1.

[0049] SEQ ID NO: 23 is an exemplary COL4A5 amino acid sequence, XP_016884750.1.

[0050] SEQ ID NO: 24 is an exemplary COL4A5 amino acid sequence, XP_047297767.1.

[0051] SEQ ID NO: 25 is an exemplary COL4A5 amino acid sequence, XP_016884751.1.

[0052] SEQ ID NO: 26 is Npu An example N-intein of DnaE intein.

[0053] SEQ ID NO: 27 is Npu An example of a C-inpeptide of DnaE inteptides.

[0054] SEQ ID NO: 28 is an exemplary nucleotide sequence encoding the open reading frame (ORF) of pAAV-CAG-Col4A5-FLAG-WPRE.

[0055] SEQ ID NO: 29 is an exemplary amino acid sequence of the ORF of pAAV-CAG-Col4A5-FLAG-WPRE.

[0056] SEQ ID NO: 30 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP1-Col4A5-Nint-FLAG-WPRE.

[0057] SEQ ID NO: 31 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP1-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 32 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP2-Col4A5-Nint-FLAG-noWPRE. SEQ ID NO: 33 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP2-Col4A5-Nint-FLAG-noWPRE. SEQ ID NO: 34 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE3. SEQ ID NO: 35 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE3. SEQ ID NO: 36 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 37 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 38 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP3-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 39 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP3-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 40 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP3-Col4A5-Nint-FLAG-WPRE3. SEQ ID NO: 41 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP3-Col4A5-Nint-FLAG-WPRE3. SEQ ID NO: 42 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP4-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 43 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP4-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 44 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP4-Col4A5-Nint-FLAG-WPRE3. SEQ ID NO: 45 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP4-Col4A5-Nint-FLAG-WPRE3. SEQ ID NO: 46 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP5-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 47 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP5-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 48 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP5-Col4A5-Nint-FLAG-WPRE3. SEQ ID NO: 49 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP5-Col4A5-Nint-FLAG-WPRE3. SEQ ID NO: 50 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP7-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 51 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP7-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 52 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP7-Col4A5-Nint-FLAG-noWPRE. SEQ ID NO: 53 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP7-Col4A5-Nint-FLAG-noWPRE. SEQ ID NO: 54 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP9-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 55 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP9-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 56 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP9-Col4A5-Nint-FLAG-noWPRE. SEQ ID NO: 57 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP9-Col4A5-Nint-FLAG-noWPRE. SEQ ID NO: 58 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP11-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 59 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP11-Col4A5-Nint-FLAG-WPRE. SEQ ID NO: 60 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-SP12-Col4A5-Nint-FLAG-noWPRE. SEQ ID NO: 61 is an exemplary amino acid sequence of the ORF of pAAV-CAG-SP12-Col4A5-Nint-FLAG-noWPRE. SEQ ID NO: 62 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-noSS-Cint-SP1-Col4A5-FLAG-WPRE. SEQ ID NO: 63 is an exemplary amino acid sequence of the ORF of pAAV-CAG-noSS-Cint-SP1-Col4A5-FLAG-WPRE. SEQ ID NO: 64 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP1-Col4A5-FLAG-WPRE. SEQ ID NO: 65 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP1-Col4A5-FLAG-WPRE. SEQ ID NO: 66 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-chymoSS-Cint-SP1-Col4A5-FLAG-WPRE. SEQ ID NO: 67 is an exemplary amino acid sequence of the ORF of pAAV-CAG-chymoSS-Cint-SP1-Col4A5-FLAG-WPRE. SEQ ID NO: 68 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-nativeSS-Cint-SP2-Col4A5-HA-noWPRE. SEQ ID NO: 69 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP2-Col4A5-HA-noWPRE. SEQ ID NO: 70 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-WPRE3. SEQ ID NO: 71 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-WPRE3. SEQ ID NO: 72 is an exemplary nucleotide sequence of the ORF encoding pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-noWPRE. SEQ ID NO: 73 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-noWPRE. SEQ ID NO: 74 is an exemplary nucleotide sequence of the ORF encoding pAAV-CAG-chymoSS-Cint-SP2-Col4A5-FLAG-WPRE3. SEQ ID NO: 75 is an exemplary amino acid sequence of the ORF of pAAV-CAG-chymoSS-Cint-SP2-Col4A5-FLAG-WPRE3. SEQ ID NO: 76 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-WPRE. SEQ ID NO: 77 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-WPRE. SEQ ID NO: 78 is an exemplary nucleotide sequence of the ORF encoding pAAV-CAG-chymoSS-Cint-SP2-Col4A5-FLAG-noWPRE. SEQ ID NO: 79 is an exemplary amino acid sequence of the ORF of pAAV-CAG-chymoSS-Cint-SP2-Col4A5-FLAG-noWPRE. SEQ ID NO: 80 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-noSS-Cint-SP2-Col4A5-FLAG-WPRE. SEQ ID NO: 81 is an exemplary amino acid sequence of the ORF of pAAV-CAG-noSS-Cint-SP2-Col4A5-FLAG-WPRE. SEQ ID NO: 82 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-chymoSS-Cint-SP2-Col4A5-FLAG-WPRE. SEQ ID NO: 83 is an exemplary amino acid sequence of the ORF of pAAV-CAG-chymoSS-Cint-SP2-Col4A5-FLAG-WPRE. SEQ ID NO: 84 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP3-Col4A5-FLAG-WPRE. SEQ ID NO: 85 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP3-Col4A5-FLAG-WPRE. SEQ ID NO: 86 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP3-Col4A5-FLAG-WPRE3. SEQ ID NO: 87 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP3-Col4A5-FLAG-WPRE3. SEQ ID NO: 88 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-chymoSS-Cint-SP3-Col4A5-FLAG-WPRE3. SEQ ID NO: 89 is an exemplary amino acid sequence of the ORF of pAAV-CAG-chymoSS-Cint-SP3-Col4A5-FLAG-WPRE3. SEQ ID NO: 90 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP4-Col4A5-FLAG-WPRE. SEQ ID NO: 91 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP4-Col4A5-FLAG-WPRE. SEQ ID NO: 92 is an exemplary nucleotide sequence of the ORF encoding pAAV-CAG-nativeSS-Cint-SP4-Col4A5-FLAG-WPRE3. SEQ ID NO: 93 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP4-Col4A5-FLAG-WPRE3. SEQ ID NO: 94 is an exemplary nucleotide sequence of the ORF encoding pAAV-CAG-chymoSS-Cint-SP4-Col4A5-FLAG-WPRE3. SEQ ID NO: 95 is an exemplary amino acid sequence of the ORF of pAAV-CAG-chymoSS-Cint-SP4-Col4A5-FLAG-WPRE3. SEQ ID NO: 96 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP5-Col4A5-FLAG-WPRE. SEQ ID NO: 97 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP5-Col4A5-FLAG-WPRE. SEQ ID NO: 98 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP5-Col4A5-FLAG-WPRE3. SEQ ID NO: 99 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP5-Col4A5-FLAG-WPRE3. SEQ ID NO: 100 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-chymoSS-Cint-SP5-Col4A5-FLAG-WPRE3. SEQ ID NO: 101 is an exemplary amino acid sequence of the ORF of pAAV-CAG-chymoSS-Cint-SP5-Col4A5-FLAG-WPRE3. SEQ ID NO: 102 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-nativeSS-Cint-SP7-Col4A5-FLAG-noWPRE. SEQ ID NO: 103 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP7-Col4A5-FLAG-noWPRE. SEQ ID NO: 104 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP9-Col4A5-FLAG-noWPRE. SEQ ID NO: 105 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP9-Col4A5-FLAG-noWPRE. SEQ ID NO: 106 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-noSS-Cint-SP11-Col4A5-FLAG-WPRE. SEQ ID NO: 107 is an exemplary amino acid sequence of the ORF of pAAV-CAG-noSS-Cint-SP11-Col4A5-FLAG-WPRE. SEQ ID NO: 108 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-nativeSS-Cint-SP11-Col4A5-FLAG-WPRE. SEQ ID NO: 109 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP11-Col4A5-FLAG-WPRE. SEQ ID NO: 110 is an exemplary nucleotide sequence of an ORF encoding pAAV-CAG-chymoSS-Cint-SP11-Col4A5-FLAG-WPRE. SEQ ID NO: 111 is an exemplary amino acid sequence of the ORF of pAAV-CAG-chymoSS-Cint-SP11-Col4A5-FLAG-WPRE. SEQ ID NO: 112 is an exemplary nucleotide sequence encoding the ORF of pAAV-CAG-nativeSS-Cint-SP12-Col4A5-FLAG-noWPRE. SEQ ID NO: 113 is an exemplary amino acid sequence of the ORF of pAAV-CAG-nativeSS-Cint-SP12-Col4A5-FLAG-noWPRE. SEQ ID NO: 114 is an exemplary 5' portion of SEQ ID NO: 1. It may be an example of the region located on the 5' side of the ORF in SEQ ID NO: 1.

[0058] SEQ ID NO: 115 is an exemplary 3' portion of SEQ ID NO: 1. It may be an example of the region located on the 3' side of the ORF in SEQ ID NO: 1.

[0059] SEQ ID NO: 116 is an exemplary 5' portion of SEQ ID NO: 2. It may be an example of the region located on the 5' side of the ORF in SEQ ID NO: 2.

[0060] SEQ ID NO: 117 is an exemplary 3' portion of SEQ ID NO: 2. It may be an example of the region located on the 3' side of the ORF in SEQ ID NO: 2.

[0061] SEQ ID NO: 118 is an exemplary 5' portion of SEQ ID NO: 3. It may be an example of the region located on the 5' side of the ORF in SEQ ID NO: 3.

[0062] SEQ ID NO: 119 is an exemplary 3' portion of SEQ ID NO: 3. It may be an example of the region located on the 3' side of the ORF in SEQ ID NO: 3.

[0063] SEQ ID NO: 120 is an exemplary nucleotide sequence encoding WPRE.

[0064] SEQ ID NO: 121 is an exemplary nucleotide sequence encoding WPRE3.

[0065] SEQ ID NO: 122 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint14-3xFLAG-WPRE.

[0066] SEQ ID NO: 123 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint14-3xFLAG-WPRE.

[0067] SEQ ID NO: 124 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint15-3xFLAG-WPRE.

[0068] SEQ ID NO: 125 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint15-3xFLAG-WPRE.

[0069] SEQ ID NO: 126 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint16-3xFLAG-WPRE.

[0070] SEQ ID NO: 127 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint16-3xFLAG-WPRE.

[0071] SEQ ID NO: 128 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint17-3xFLAG-WPRE.

[0072] SEQ ID NO: 129 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint17-3xFLAG-WPRE.

[0073] SEQ ID NO: 130 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint18-3xFLAG-WPRE.

[0074] SEQ ID NO: 131 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint18-3xFLAG-WPRE.

[0075] SEQ ID NO: 132 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint19-3xFLAG-WPRE.

[0076] SEQ ID NO: 133 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint19-3xFLAG-WPRE. SEQ ID NO: 134 is an exemplary nucleotide sequence encoding the ORF of pAAV-tCAG-COL4A5-Nint20-3xFLAG-WPRE. SEQ ID NO: 135 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint20-3xFLAG-WPRE.

[0077] SEQ ID NO: 136 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint21-3xFLAG-WPRE.

[0078] SEQ ID NO: 137 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint21-3xFLAG-WPRE.

[0079] SEQ ID NO: 138 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint22-3xFLAG-WPRE.

[0080] SEQ ID NO: 139 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint22-3xFLAG-WPRE.

[0081] SEQ ID NO: 140 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint23-3xFLAG-WPRE.

[0082] SEQ ID NO: 141 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint23-3xFLAG-WPRE.

[0083] SEQ ID NO: 142 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint24-3xFLAG-WPRE.

[0084] SEQ ID NO: 143 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint24-3xFLAG-WPRE.

[0085] SEQ ID NO: 144 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint25-3xFLAG-WPRE.

[0086] SEQ ID NO: 145 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint25-3xFLAG-WPRE.

[0087] SEQ ID NO: 146 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint26-3xFLAG-WPRE.

[0088] SEQ ID NO: 147 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint26-3xFLAG-WPRE.

[0089] SEQ ID NO: 148 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint27-3xFLAG-WPRE.

[0090] SEQ ID NO: 149 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint27-3xFLAG-WPRE.

[0091] SEQ ID NO: 150 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint28-3xFLAG-WPRE.

[0092] SEQ ID NO: 151 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint28-3xFLAG-WPRE.

[0093] SEQ ID NO: 152 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint6-3xFLAG-WPRE.

[0094] SEQ ID NO: 153 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint6-3xFLAG-WPRE.

[0095] SEQ ID NO: 154 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint8-3xFLAG-WPRE.

[0096] SEQ ID NO: 155 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint8-3xFLAG-WPRE.

[0097] SEQ ID NO: 156 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-COL4A5-Nint10-3xFLAG-WPRE.

[0098] SEQ ID NO: 157 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-COL4A5-Nint10-3xFLAG-WPRE.

[0099] SEQ ID NO: 158 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint14-COL4A5-HA-WPRE.

[0100] SEQ ID NO: 159 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint14-COL4A5-HA-WPRE.

[0101] SEQ ID NO: 160 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint15-COL4A5-HA-WPRE.

[0102] SEQ ID NO: 161 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint15-COL4A5-HA-WPRE.

[0103] SEQ ID NO: 162 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint16-COL4A5-HA-WPRE.

[0104] SEQ ID NO: 163 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint16-COL4A5-HA-WPRE.

[0105] SEQ ID NO: 164 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint17-COL4A5-HA-WPRE.

[0106] SEQ ID NO: 165 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint17-COL4A5-HA-WPRE.

[0107] SEQ ID NO: 166 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint18-COL4A5-HA-WPRE.

[0108] SEQ ID NO: 167 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint18-COL4A5-HA-WPRE.

[0109] SEQ ID NO: 168 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint19-COL4A5-HA-WPRE.

[0110] SEQ ID NO: 169 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint19-COL4A5-HA-WPRE.

[0111] SEQ ID NO: 170 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint20-COL4A5-HA-WPRE.

[0112] SEQ ID NO: 171 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint20-COL4A5-HA-WPRE.

[0113] SEQ ID NO: 172 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint21-COL4A5-HA-WPRE.

[0114] SEQ ID NO: 173 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint21-COL4A5-HA-WPRE.

[0115] SEQ ID NO: 174 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint22-COL4A5-HA-WPRE.

[0116] SEQ ID NO: 175 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint22-COL4A5-HA-WPRE.

[0117] SEQ ID NO: 176 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint23-COL4A5-HA-WPRE.

[0118] SEQ ID NO: 177 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint23-COL4A5-HA-WPRE.

[0119] SEQ ID NO: 178 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint24-COL4A5-HA-WPRE.

[0120] SEQ ID NO: 179 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint24-COL4A5-HA-WPRE.

[0121] SEQ ID NO: 180 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint25-COL4A5-HA-WPRE.

[0122] SEQ ID NO: 181 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint25-COL4A5-HA-WPRE.

[0123] SEQ ID NO: 182 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint26-COL4A5-HA-WPRE.

[0124] SEQ ID NO: 183 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint26-COL4A5-HA-WPRE.

[0125] SEQ ID NO: 184 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint27-COL4A5-HA-WPRE.

[0126] SEQ ID NO: 185 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint27-COL4A5-HA-WPRE.

[0127] SEQ ID NO: 186 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint28-COL4A5-HA-WPRE.

[0128] SEQ ID NO: 187 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint28-COL4A5-HA-WPRE.

[0129] SEQ ID NO: 188 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint6-COL4A5-HA-WPRE.

[0130] SEQ ID NO: 189 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint6-COL4A5-HA-WPRE.

[0131] SEQ ID NO: 190 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint8-COL4A5-HA-WPRE.

[0132] SEQ ID NO: 191 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint8-COL4A5-HA-WPRE.

[0133] SEQ ID NO: 192 is an exemplary nucleotide sequence of an ORF encoding pAAV-tCAG-nativeSP-Cint10-COL4A5-HA-WPRE.

[0134] SEQ ID NO: 193 is an exemplary amino acid sequence of the ORF of pAAV-tCAG-nativeSP-Cint10-COL4A5-HA-WPRE.

[0135] SEQ ID NO: 194 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP1.

[0136] SEQ ID NO: 195 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP14.

[0137] SEQ ID NO: 196 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP24.

[0138] SEQ ID NO: 197 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP25.

[0139] SEQ ID NO: 198 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP26.

[0140] SEQ ID NO: 199 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP4.

[0141] SEQ ID NO: 200 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP15.

[0142] SEQ ID NO: 201 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP16.

[0143] SEQ ID NO: 202 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP17.

[0144] SEQ ID NO: 203 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP18.

[0145] SEQ ID NO: 204 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP19.

[0146] SEQ ID NO: 205 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP21.

[0147] SEQ ID NO: 206 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP22.

[0148] SEQ ID NO: 207 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP23.

[0149] SEQ ID NO: 208 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP28.

[0150] SEQ ID NO: 209 is an exemplary amino acid sequence used as negative training data for SVM, corresponding to SP3.

[0151] SEQ ID NO: 210 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP10.

[0152] SEQ ID NO: 211 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP11.

[0153] SEQ ID NO: 212 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP12.

[0154] SEQ ID NO: 213 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP2.

[0155] SEQ ID NO: 214 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP20.

[0156] SEQ ID NO: 215 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP27.

[0157] SEQ ID NO: 216 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP5.

[0158] SEQ ID NO: 217 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP6.

[0159] SEQ ID NO: 218 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP7.

[0160] SEQ ID NO: 219 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP8.

[0161] SEQ ID NO: 220 is an exemplary amino acid sequence used as positive training data for SVM, corresponding to SP9.

[0162] SEQ ID NO: 221 is an exemplary C-terminal amino acid sequence.

[0163] SEQ ID NO: 222 is an exemplary C-terminal amino acid sequence.

[0164] SEQ ID NO: 223 is an exemplary C-terminal amino acid sequence.

[0165] SEQ ID NO: 224 is an exemplary C-terminal amino acid sequence.

[0166] SEQ ID NO: 225 is an exemplary C-terminal amino acid sequence.

[0167] SEQ ID NO: 226 is an exemplary C-terminal amino acid sequence.

[0168] SEQ ID NO: 227 is an exemplary C-terminal amino acid sequence.

[0169] SEQ ID NO: 228 is an exemplary C-terminal amino acid sequence.

[0170] SEQ ID NO: 229 is an exemplary C-terminal amino acid sequence.

[0171] SEQ ID NO: 230 is an exemplary C-terminal amino acid sequence.

[0172] SEQ ID NO: 231 is an exemplary C-terminal amino acid sequence.

[0173] Some of the amino acid sequences disclosed herein contain an N-terminal methionine. In some instances, this methionine is optional. Therefore, sequences lacking an N-terminal methionine and sequences containing an N-terminal methionine are envisioned as exemplary sequences. Detailed Implementation

[0174] I. Introduction Alport syndrome can be caused by a genetic defect in the type IV collagen α chain (e.g. COL4A3 , COL4A4 and / or COL4A5 Alport syndrome is caused by mutations in the gene. This article discloses the use of complementation of defective gene products to treat Alport syndrome.

[0175] AAV vectors can be used to incorporate complementary genes into subjects; however, the effective payload of AAV vectors is limited to about 5.0 kb, while the open reading frame of type IV collagen α chain is about 5.0-5.1 kb, making it infeasible to incorporate nucleic acid molecules encoding the full-length type IV collagen α chain ORF along with expression control sequences (including cis-regulatory elements and polyadenylation signals) into a single AAV vector.

[0176] Splitting intron systems can be used to express split gene products using trans-splicing; however, trans-splicing proteins using non-natural exopeptides remains challenging. This process involves cleaving a single protein into two distinct polypeptide sequences. This can lead to protein folding and stability issues. Furthermore, neighboring sequences to cleavage sites that meet amino acid sequence criteria may not be tolerant of intron insertion. Additionally, using splitting intron systems for secretory proteins can be challenging because both the N- and C-hemispheric proteins must be independently transported to the secretory pathway while undergoing successful trans-splicing.

[0177] These issues are particularly relevant to COL4A3, COL4A4, and COL4A5. This paper discloses candidate cleavage sites located within the collagen domain of the type IV collagen α chain. This domain contains an evolutionarily conserved GXY motif, forming a structurally conserved triple helix. Most pathogenic missense mutations (accounting for approximately 40% of COL4A5 mutations leading to XLAS) (Gubler) et al. (Nat ClinPract Nephrol 4, 24-37 (2008)) involves glycine residues of the GXY motif in the collagen domain. Heterotrimination occurs in the early stages of type IV collagen heterotrimerization in the presecretory endoplasmic reticulum (ER). Therefore, the splitting of the collagen domain may adversely affect protein stability, folding, heterotrimerization, and secretion.

[0178] However, a splitting intipeptide system has been developed, comprising a first nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, an N-external peptide of an external peptide pair and an N-internal peptide of an intipeptide pair, wherein the N-external peptide comprises a first signal sequence located at the N-terminus of the N-terminal portion of the type IV collagen α chain. The splitting intipeptide system further comprises a second nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, a second signal sequence, a C-internal peptide of the intipeptide pair, and a C-external peptide of the external peptide pair, wherein the C-external peptide comprises the C-terminal portion of the type IV collagen α chain. In some instances, the N-terminal portion does not contain a collagen signal sequence. This document discloses the order of the elements in the splitting intipeptide system, and optionally the use of certain splitting points, such that when the splitting intipeptide system is introduced into mammalian cells, full-length COL4A3, COL4A4, and COL4A5 can be generated.

[0179] II. Terminology Summary Unless otherwise stated, technical terms are used in their usual sense. Definitions of many commonly used terms in molecular biology can be found in Krebs et al. (eds.), Lewin's genes XII, published by Jones & Bartlett Learning, 2017. As used herein, the singular forms “a,” “an,” and “the” refer to both the singular and plural forms unless the context clearly indicates otherwise. For example, the term “a vector” includes both singular and plural vectors and can be considered equivalent to the phrase “at least one vector.” As used herein, the term “comprising” means “including.” The term “about” means within five percent. It should also be understood that any and all base sizes or amino acid sizes of nucleic acids or polypeptides given, as well as all molecular weight or molecular mass values, are approximate and given for descriptive purposes unless otherwise stated. Although many methods and materials similar to or equivalent to those described herein may be used, specific suitable methods and materials are described herein. In case of conflict, this specification (including the explanations of terms) shall prevail. Furthermore, materials, methods, and examples are illustrative only and not intended to be limiting.

[0180] AAV vector: Any vector containing or derived from AAV and suitable for infecting mammalian cells (including human cells) of any of a variety of tissue types (e.g., brain, heart, lung, skeletal muscle, liver, kidney, spleen, or pancreas), whether in vitro or in vivo. The term "AAV vector" may be used to refer to AAV-type viral particles (or viral particles) containing at least one nucleic acid molecule encoding a protein of interest or a nucleic acid molecule of interest.

[0181] Administration: The reagent shall be provided or administered to the subject by any effective route. Exemplary routes of administration include, but are not limited to, oral, injection (e.g., subcutaneous, intramuscular, intradermal, intraperitoneal, intravenous, intrathecal, and intratumoral), sublingual, rectal, percutaneous, intranasal, intratubal, vaginal, and inhalation routes. In some respects, administration may be to the subject's kidneys.

[0182] Reagent: Any carrier, peptide, compound, small molecule, organic compound, salt, polynucleotide, or other molecule of interest. Reagents may include therapeutic agents, diagnostic agents, or pharmaceutical reagents. A "therapeutic agent" is a substance that exhibits some therapeutic effect by restoring or maintaining health (e.g., by alleviating symptoms associated with a disease or physiological condition, or by delaying (including preventing) the progression or onset of a disease (e.g., kidney disease, such as Alport syndrome). Reagents may be AAV carriers.

[0183] Alport syndrome: can be caused by a genetic defect in type IV collagen (e.g. COL4A3 , COL4A4 and / or COL4A5 Hereditary diseases caused by mutations in genes. These mutations hinder the normal production and / or assembly of the type IV collagen network (particularly the collagen 4α345 network). This network is part of the tissues of organs including the kidneys, eyes, and cochlea (inner ear).

[0184] Symptoms of Alport syndrome may include gross hematuria, microscopic hematuria, proteinuria, edema, nephrotic syndrome, chronic anemia, osteodystrophy, sensorineural hearing loss, anterior lenticonus, punctate and macular retinopathy, temporal macular thinning, tracheobronchial tree leiomyomatosis, and esophageal leiomyomatosis. Alport syndrome can be diagnosed by clinicians, for example, by examining symptoms or through genetic testing. Alport syndrome can be treated with ACE inhibitors, ARBs, and diuretics. However, many people with Alport syndrome will progress to dialysis or kidney transplantation.

[0185] Alport syndromes include X-linked Alport syndromes (XLAS), which can be caused by... COL4A5 Caused by gene mutation. Alport syndrome also includes autosomal recessive Alport syndrome (ARAS) or autosomal dominant Alport syndrome (ADAS), which can be caused by... COL4A3 and / or COL4A4 Caused by gene mutation.

[0186] Angiotensin-converting enzyme inhibitors (ACE inhibitors): Agents that inhibit the activity of angiotensin-converting enzyme. Angiotensin-converting enzyme converts angiotensin I to angiotensin II and hydrolyzes bradykinin. Exemplary ACE inhibitors include: benazepril, captopril, cilazapril, enalapril, fosinopril, lisinopril, moexipril, perindopril, ramipril, quinapril, and trandolapril.

[0187] Angiotensin II receptor blockers (ARBs): Agents that bind to and inhibit angiotensin II type 1 receptors. Exemplary ARBs include candesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, and valsartan.

[0188] Conservative substitutions: For example, conservative substitutions in peptides involve replacing one or more amino acids with amino acids that have similar biochemical properties. This does not lead to an alteration or loss of the peptide's biological or biochemical function and is called a "conservative" substitution. These conservative substitutions may have minimal impact on the activity of the resulting protein. Table A shows amino acids that can be substituted in proteins and are considered conservative substitutions.

[0189] Table A

[0190] One or more conserved alterations, or up to ten conserved alterations (e.g., two, three, four, or five amino acid substitutions), can be made in a polypeptide without altering the protein itself (e.g., collagen or...). Npu The biochemical functions of DnaE C-inteptide protein, for example Npu Trans-splicing of peptide pairs within DnaE.

[0191] Control: A reference standard. In some respects, a control is a negative control sample obtained from a healthy patient. In other respects, a control is a positive control, such as a sample obtained from a patient diagnosed with Alport syndrome or nephropathy. In still other respects, a control is a historical control or a standard reference value or range of values ​​(e.g., a control sample previously tested, such as a group of Alport syndrome patients with a known prognosis or outcome, or a set of samples representing baseline or normal values).

[0192] The “difference” between the test sample and the control can be an increase or conversely a decrease. This difference can be qualitative or quantitative, such as a statistically significant difference. In some instances, the difference is an increase or decrease of at least about 5% relative to the control, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 68%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, at least about 300%, at least about 350%, at least about 400%, at least about 500%, or greater than 500%.

[0193] Effective amount: Specifies the amount of a pharmaceutical reagent or therapeutic agent (e.g., recombinant AAV, a first nucleic acid molecule, a second nucleic acid molecule, or a splitting intronide system) sufficient to achieve the desired effect, such as improved renal function or other desired effects, in a subject or cells being treated with the reagent. The effective amount of the reagent will depend on several factors, including but not limited to the subject or cells being treated and the manner of administration of the therapeutic composition.

[0194] An effective amount of a splitting intron peptide system is an amount sufficient to achieve the desired effect (e.g., improved renal function or other desired effects) in a subject or cell being treated with the reagent. An effective amount of a first nucleic acid molecule encoding an N-exopeptide of an exopeptide pair and an N-intron peptide of an intron peptide pair is such that, when administered together with an effective amount of a second nucleic acid molecule encoding the C-intron peptide of the intron peptide pair and the C-exopeptide of the exopeptide pair, the N-exopeptide and C-exopeptide are spliced ​​together to form a mature protein (e.g., COL4A3, COL4A4, or COL4A5) when the first and second nucleic acid molecules are expressed in mammalian cells, and this amount is sufficient to achieve the desired effect, such as improved renal function or other desired effects, in a subject or cell being treated with the reagent.

[0195] Expression control sequence: A nucleic acid sequence that regulates the expression of a heterologous nucleic acid sequence to which it is operably linked. An expression control sequence is operably linked to a nucleic acid sequence when it controls and regulates transcription and, where appropriate, translation of the nucleic acid sequence. Therefore, an expression control sequence may include a suitable promoter, enhancer, transcription terminator, start codon (i.e., ATG) preceding a protein-coding gene, splicing signals for introns, maintaining the correct reading frame of the gene to allow correct translation of the mRNA, and a stop codon. The term "control sequence" is intended to include at least the components whose presence can affect expression, and may also include additional components whose presence is advantageous, such as leader sequences and fusion coupler sequences. Expression control sequences may include promoters, such as CAG. Expression control sequences may include posttranscriptional regulatory elements of marmot hepatitis virus.

[0196] Heterogeneous: Heterogeneous proteins or peptides refer to proteins or peptides derived from different sources or species. Heterogeneous nucleic acid molecules refer to nucleic acid molecules derived from different sources or species. Therefore, heterogeneous proteins, peptides, or nucleic acid molecules in cells refer to proteins, peptides, or nucleic acid molecules that are not naturally present in cells (e.g., foreign proteins, peptides, or nucleic acid molecules). In some instances, cells expressing heterogeneous proteins, peptides, or nucleic acid molecules are transgenic.

[0197] Inteins and Exopeptides: Inteins are polypeptides capable of catalytically cleaving themselves from N-exopeptides and C-exopeptides (“exopeptides”) adjacent to their N-terminal and C-terminal sequences, respectively. Inteins have been identified in organisms across all phylogenetic kingdoms, and for these naturally occurring inteins, self-cleavage typically results in the N-exopeptide linking to the C-exopeptide via a peptide bond. Self-cleavage of inteins can be caused by interactions between intein sequences within the same polypeptide or by interactions between trans-acting inteins (see Splitting Inteins below).

[0198] "Cleavage intein" is an intein polypeptide in which the N-terminal and C-terminal portions of the intein are expressed as separate polypeptides that can undergo trans-action to complete the cleavage response.

[0199] N-exopeptides and C-exopeptides can be linked together at a “split point.” The split point is the location in the mature polypeptide sequence where the N-exopeptide and C-exopeptide are linked by a peptide bond. In this disclosure, the split point can be defined as the first amino acid residue of the C-exopeptide. For example, in an exemplary sequence, the C-terminus of the N-exopeptide contains the residue DEI, and the N-terminus of the C-exopeptide contains the residue CEPG (SEQ ID NO: 230). Together, they can be represented as the sequence DEI|[C]EPG. In this example, the split point is the residue in parentheses “[C]”. The “split” between the N-exopeptide and the C-exopeptide occurs at the vertical bar character (“|”).

[0200] Isolated: An "isolated" biological component (e.g., nucleic acid, peptide, or protein) has been substantially separated, separately produced, or purified away from other biological components naturally present in the somatic cells of an organism (i.e., other chromosomes and extrachromosomal DNA and RNA, as well as proteins). Therefore, "isolated" nucleic acids, peptides, and proteins include nucleic acids and proteins purified using standard purification methods. The term also includes nucleic acids, peptides, and proteins prepared through recombinant expression in host cells, as well as chemically synthesized nucleic acids. The isolated cell type has been substantially separated from other cell types (e.g., different cell types present in organs). The purified cells or components may be at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% pure.

[0201] Kidneys: Organs found in vertebrates that participate in the control of the volume of various body fluids, osmotic pressure, acid-base balance, concentration of various electrolytes, and clearance of toxins. The kidneys receive blood from paired renal arteries; blood flows out into paired renal veins. Each kidney connects to a ureter, which is the conduit that carries excreted urine to the bladder. Filtration occurs in the glomeruli. One-fifth of the volume of blood entering the kidneys is filtered. Examples of substances reabsorbed are water, sodium, bicarbonate, glucose, and amino acids. Examples of substances secreted are hydrogen, ammonium, potassium, and uric acid. The nephron is the structural and functional unit of the kidney. Each adult kidney contains approximately one million nephrons, while a mouse kidney contains only about 12,500 nephrons. Kidneys also perform functions independent of nephrons. For example, they convert precursors of vitamin D into its active form, calcitriol; and synthesize the hormones erythropoietin and renin. The kidneys consist of (1) nephrons, (2) the interstitium, and (3) the vascular system. The (1) nephron comprises glomerular endothelial cells, mesangial cells, podocytes, and renal tubules (proximal tubules, loop of Henle cells, distal tubules, collecting duct cells, and parietal epithelial cells). The (2) interstitium comprises fibroblasts, myofibroblasts, and pericytes. The (3) vascular system comprises vascular endothelial cells and vascular smooth muscle cells. The kidney also contains blood cells or cells derived from the bone marrow, including lymphocytes, monocytes, neutrophils, dendritic cells, mast cells, and resident macrophages. The kidney also contains blood cells, including lymphocytes, monocytes, neutrophils, and resident macrophages. The kidney also contains specialized endocrine cells that produce erythropoietin, renin, and calcitriol. "Podocytes" are cells in Bowman's capsule in the kidney that surround the capillaries of the glomerulus. Podocytes form the epithelial lining of Bowman's capsule in the kidney, through which blood is filtered. Although various viscera possess an epithelial layer, the term "visceral epithelial cell" typically refers specifically to podocytes, specialized epithelial cells located in the visceral layer of the capsule. Podocytes have long footprocesses called pedicels. These footprocesses enclose capillaries and leave slits between them. Blood is filtered through these slits, each slit being called a filtration slit, slit septum, or slit pore. "Epithelial cells" form the lining of the urethra. "Renal tubular epithelial cells" line the collecting ducts of the kidney, as well as the distal and proximal tubules. In the kidney, the "proximal tubule" is the segment of the nephron extending from the renal pole of Bowman's capsule to the beginning of the loop of Henle. It can be further classified into proximal convoluted tubules and proximal straight tubules. "Proximal tubular cells" are cells derived from the proximal tubules. The lumen surface of the epithelial cells in this segment of the nephron is covered with dense microvilli, forming an edge that increases the surface area of ​​the cell lumen. These cells are also densely populated with mitochondria.The cuboidal epithelial cells lining the proximal tubules exhibit extensive lateral fingering between adjacent cells, appearing without distinct cell borders when observed under a light microscope. A "nephron" is the microscopic structural and functional unit of the kidney, composed of the renal corpuscle and renal tubule. The renal corpuscle consists of a cluster of capillaries called the glomerulus and a goblet-shaped structure called Bowman's capsule. The renal tubule extends from the capsule. The capsule and tubule connect and are composed of lumened epithelial cells. Each kidney in a healthy adult contains 1 to 1.5 million nephrons.

[0202] Nucleic acid molecules: polymers composed of nucleotide units (ribonucleotides, deoxyribonucleotides, related naturally occurring structural variants and their synthetic non-natural analogs) linked by phosphodiester bonds, related naturally occurring structural variants and their synthetic non-natural analogs. Therefore, the term includes nucleotide polymers in which the nucleotides and the bonds between them include synthetic non-natural analogs, such as, but not limited to, phosphate thioesters, phosphoramide esters, methylphosphonates, chiral methylphosphonates, 2-O-methylribonucleotides, peptide nucleic acids (PNAs), etc. Such polynucleotides can be synthesized, for example, using an automated DNA synthesizer. The term "oligonucleotide" generally refers to short polynucleotides, typically not exceeding about 50 nucleotides. It should be understood that when the nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes RNA sequences in which "U" replaces "T" (i.e., A, U, G, C).

[0203] This article uses conventional notation to describe nucleotide sequences: the left end of a single-stranded nucleotide sequence is called the 5' end; the left direction of a double-stranded nucleotide sequence is called the 5' direction. The direction in which nucleotides are added to the 5' to 3' end of a newly formed RNA transcript is called the transcription direction. A DNA strand with the same sequence as the mRNA is called the "coding strand"; a sequence on the DNA strand with the same sequence as the mRNA transcribed from that DNA and located 5' to the 5' end of the RNA transcript is called the "upstream sequence"; a sequence on the DNA strand with the same sequence as the RNA and located 3' to the 3' end of the coding RNA transcript is called the "downstream sequence". Regarding nucleotide molecules, the term "coding" refers to the inherent property of a specific nucleotide sequence in a polynucleotide (e.g., gene, cDNA, or mRNA) as a template for the synthesis of other polymers and macromolecules with a defined nucleotide sequence (i.e., rRNA, tRNA, and mRNA) or a defined amino acid sequence and the resulting biological properties during biological processes. Therefore, if the transcription and translation of mRNA produced by a gene produces a protein in a cell or other biological system, then that gene encodes that protein. Both the coding strand of a gene or cDNA (whose nucleotide sequence is identical to that of the mRNA and is typically provided in the sequence listing) and the non-coding strand (used as a transcription template) can be referred to as encoding a protein or other product of that gene or cDNA. Unless otherwise stated, "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. Nucleotide sequences encoding proteins and RNA may include introns.

[0204] Furthermore, "recombinant nucleic acid" refers to a nucleic acid molecule having a sequence that is not naturally occurring or has a sequence generated by artificially combining two otherwise separated sequence segments. This artificial combination is typically accomplished through chemical synthesis or, more commonly, by artificially manipulating the separated segments of the nucleic acid (e.g., through genetic engineering techniques). Similarly, recombinant proteins are proteins encoded by recombinant nucleic acid molecules. Additionally, recombinant viruses are viruses that contain sequences (e.g., genomic sequences) that are not naturally occurring or generated by artificially combining sequences from at least two different sources. The term "recombinant" also includes nucleic acids, proteins, and viruses that are altered solely by the addition, substitution, or deletion of a portion of a natural nucleic acid molecule, protein, or virus. As used herein, "recombinant AAV" refers to AAV particles in which a recombinant nucleic acid molecule (e.g., a recombinant nucleic acid molecule encoding a therapeutic protein) is already packaged.

[0205] The nucleic acid sequences disclosed herein can be defined by their specific identity and / or similarity to certain nucleic acid sequences described herein. Sequence identity can be greater than 60%, greater than 75%, greater than 80%, greater than 90%, and can be greater than 95%. Sequence identity and / or similarity can be 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% compared to the sequences disclosed herein. Sequence identity can be approximately 95%, 96%, 97%, 98, or 99%.

[0206] Operable ligation: When a first nucleic acid sequence and a second nucleic acid sequence are functionally related, the first nucleic acid sequence is "operably ligated" to the second nucleic acid sequence. For example, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably ligated to that coding sequence. Typically, operably ligated DNA sequences are contiguous and located within the same reading frame when two protein-coding regions need to be ligated.

[0207] Pharmaceutically acceptable carriers: The term "pharmaceutically acceptable carriers" includes conventional excipients. Remington's Pharmaceutical Sciences, 23rd Edition, Academic Press, Elsevier, (2020) describes compositions and formulations suitable for drug delivery of the fusion proteins disclosed herein. Typically, the nature of the carrier will depend on the specific route of administration employed. For example, parenteral formulations often contain injectable liquids, including pharmaceutically and physiologically acceptable liquids such as water, physiological saline, balanced salt solutions, hydrated glucose, glycerol, etc., as solvents. In addition to biologically neutral carriers, the drug composition to be administered may contain small amounts of non-toxic excipients such as wetting agents or emulsifiers, preservatives, and pH buffers, such as sodium acetate or sorbitan monolaurate.

[0208] Polypeptide or protein: A polymer in which monomers are linked together by an amide bond of amino acid residues. When the amino acid is an α-amino acid, an L-optical isomer or a D-optical isomer may be used, preferably an L-isomer. As used herein, the terms “polypeptide” or “protein” are intended to cover any amino acid sequence and include modified sequences such as glycoproteins. The term “polypeptide” is particularly intended to cover naturally occurring proteins as well as recombinant or synthetically produced proteins. Polypeptides are described herein using conventional notation: the left end of the polypeptide sequence is the N-terminus, and the polypeptide extends from the N-terminus to the C-terminus. Typically, the N-terminus includes a free amino group, and typically the C-terminus includes a free carboxyl group. A “therapeutic protein” is a protein that, when expressed in a subject, leads to improvement in the signs or symptoms of a specific condition in that subject (e.g., kidney disease). In some respects, administration of a “therapeutic protein” leads to improvement in the signs or symptoms of a subject’s kidney disease. Administration of a therapeutic protein can lead to improvement in a subject’s disease (e.g., Alport syndrome). A “fusion protein” is made from two heterologous proteins from different sources.

[0209] The polypeptide sequences disclosed herein can be defined by a specific identity and / or similarity with certain polypeptides described herein. Sequence identity may be greater than 60%, greater than 75%, greater than 80%, greater than 90%, and may be greater than 95%. Sequence identity and / or similarity may be 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% compared to the sequences disclosed herein. Sequence identity may be approximately 95%, 96%, 97%, 98, or 99%.

[0210] Prevention, treatment, and improvement: "Prevention" of disease (e.g., kidney disease) refers to inhibiting the complete progression of the disease. "Treatment" refers to therapeutic interventions that improve the signs or symptoms of a disease or pathological condition after it has begun to develop. "Improvement" refers to a reduction in the number or severity of the signs or symptoms of a disease.

[0211] Promoters: An array of nucleic acid control sequences that direct nucleic acid transcription. Promoters include essential nucleic acid sequences near the transcription start site, such as the TATA element in the case of RNA polymerase II promoters. Promoters may also optionally include distal enhancers or repressor elements, which can be located up to thousands of base pairs from the transcription start site. They also include promoter elements sufficient to control promoter-dependent gene expression (for cell type specificity, tissue specificity, or induction by external signals or reagents); such elements may be located in the 5' or 3' region of the gene. Both constitutive and inducible promoters are included. Promoters can direct expression in kidney cells.

[0212] Signal sequences are short amino acid sequences (e.g., approximately 18-30 amino acids in length) that guide newly synthesized secretory or membrane proteins to reach and cross membranes (e.g., the endoplasmic reticulum membrane). Signal sequences are typically located at the N-terminus of a polypeptide and are cleaved by a signal peptidase after the polypeptide has crossed the membrane. Signal sequences generally contain three common structural features: an N-terminal polar basic region (n-region), a hydrophobic core, and a hydrophilic c-region. Exemplary signal sequences are shown in SEQ ID NO: 4 and 5. Signal sequences are also known as signal peptides.

[0213] Subjects: Any mammal, such as a human, non-human primate, pig, sheep, cattle, rodent, etc., will be the recipient of the specific treatment. In two non-limiting instances, the subject is either a human subject or a non-human primate subject. Subjects may have kidney disease, such as Alport syndrome.

[0214] Transduction: When a virus or vector transfers nucleic acid into a cell and produces functional consequences, the virus or vector "transduces" the cell. Cells are "transfected" or "transfected" by nucleic acids transduced into them when DNA is stably maintained by the cell through incorporation of nucleic acids into the cell's genome or through episomal persistence.

[0215] Transfection methods include: chemical methods (e.g., calcium phosphate transfection), physical methods (e.g., electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), receptor-mediated endocytosis (e.g., DNA-protein complexes, viral envelope / capsid-DNA complexes), and biological infection via viruses (e.g., recombinant viruses) (Wolff, JA, ed., GeneTherapeutics, Birkhauser, Boston, USA (1994)). In the case of viral infection, infectious viral particles are absorbed by target cells, resulting in the integration of the viral genome into the cellular DNA or the persistence of viral genetic components as episomes.

[0216] Genetic modification of target cells is a hallmark of successful transfection. "Genetically modified cells" refer to cells whose genotype has been altered by the uptake of exogenous nucleotide sequences through transfection. References to transfected or genetically modified cells include specific cells in which the vector or polynucleotide was introduced and their progeny.

[0217] Genetically modified organisms (GMOs): foreign genes provided by vectors or viruses (such as AAVs).

[0218] Type IV collagen: A type of collagen that is a structural component of the basement membrane and is primarily found in the basal lamina. In vivo, type IV collagen contributes to cell adhesion, migration, survival, proliferation, and differentiation.

[0219] In the synthesis of type IV collagen, a trimer first forms between the three type IV collagen α chains to form a protomer. Two protomers dimerize to form a hexamer, and these hexamers associate to form a protein network. Six human genes are associated with type IV collagen: COL4A1 , COL4A2 , COL4A3 , COL4A4 , COL4A5 and COL4A6 Genes. The structure of protein networks is influenced by the constituent subunits that form the network; for example, the type IV collagen α345 network includes... COL4A3 , COL4A4 and COL4A5 The product of genes.

[0220] Type IV collagen may include a 7S domain, a collagen domain, and a non-collagenous C-terminal domain. The 7S domain promotes the formation of heterotrimers and subsequent network structures along with the NC1 domain described below, and includes amino acid residues 27-41 relative to SEQ ID NO: 15. The collagen domain (CD) forms a triple helix with the CDs of the other two α chains, contains regions that interact with other extracellular matrix components, and plays a role in maintaining the structural integrity of the collagen network. The CD includes amino acid residues 42-1456 relative to SEQ ID NO: 15. The non-collagenous C-terminal domain 1 (NC1) acts as a promoter for heterotrimerization and determines the combination of the three α chains in the heterotrimer. In addition to its role in maintaining the molecular structure of the basement membrane, NC1 can be cleaved by proteolysis and participates as a soluble factor in various biological processes, including morphogenesis, angiogenesis, and tumorigenesis. The NC1 domain includes amino acid residues 1457-1685 relative to SEQ ID NO: 15.

[0221] “COL4A3” is... COL4A3The gene encodes a protein that encodes a possible subunit of type IV collagen. An exemplary COL4A3 amino acid sequence includes SEQ ID NO: 13. NCBI Gene ID: 1285 (human); 12828 (mice). Mus musculus (), will be available on January 17, 2024. An exemplary mRNA encoding COL4A3 includes NCBI RefSeq NM_000091.5 (human), which will be available on March 11, 2024.

[0222] “COL4A4” is... COL4A4 The gene encodes a protein that encodes a possible subunit of type IV collagen. An exemplary COL4A4 amino acid sequence includes SEQ ID NO: 14. NCBI Gene ID: 1286 (human); 12829 (mice), available January 17, 2024. An exemplary mRNA encoding COL4A4 includes NCBI RefSeq NM_000092.5 (human), available March 11, 2024.

[0223] “COL4A5” is... COL4A5 This gene encodes a protein that encodes one of the subunits of type IV collagen. An exemplary COL4A5 amino acid sequence includes SEQ ID NO: 15-25. NCBI Gene ID: 1287 (human); 12830 (mice), available January 17, 2024. Exemplary mRNAs encoding COL4A5 include NCBI RefSeqs NM_000495.5 (human, transcript variant 1) and NM_033380.3 (human, transcript variant 2).

[0224] III. Overview This document discloses a splitting intron system comprising a first nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, an N-external peptide of an external peptide pair and an N-intron of an intron peptide pair, wherein the N-external peptide comprises a first signal sequence located at the N-terminus of the N-terminal portion of a type IV collagen α chain. The splitting intron system comprises a second nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, a second signal sequence, a C-intron of the intron peptide pair, and a C-external peptide of the external peptide pair, wherein the C-external peptide comprises the C-terminal portion of the type IV collagen α chain. In some instances, the type IV collagen α chain is COL4A5. In some instances, the N-terminal portion does not contain a collagen signal sequence. In some instances, the N-terminal and C-terminal portions of the type IV collagen α chain together define the separated type IV collagen α chain sequence at the splitting point. In some instances, when the first and second nucleic acid molecules are expressed in mammalian cells, the N-exopeptide and C-exopeptide are spliced ​​together to form a mature type IV collagen α chain.

[0225] In some instances, the system comprises a first adeno-associated virus (AAV) vector (containing the first nucleic acid molecule) and / or a second AAV vector (containing the second nucleic acid molecule). In some instances, the first AAV vector and / or the second AAV vector is AAV9. In some instances, the first AAV vector and / or the second AAV vector is AAV-KP1. In some instances, the first AAV vector and / or the second AAV vector are AAV1, AAV1_9mt100, AAV1_9mt30, AAV1_9mt76, AAV2, AAV2G9, AAV2i8, AAV2retro, AAV2R585E, AAV2R585E9_2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9AA272, AAV9AA22, AAV9W22A, AAV10, AAV11, AAV2.7m8, AAVAnc80, AAVbb.2, AAV-DJ, AAVHN1, AAVHN2, AAVHN3, AAVhu.11, AAVhu.13, AAVhu.37, AAV-KP1, AAV-KP2, AAV-KP3, AAVL K03, AAVNP40, AAVNP59, AAVPHP.B, AAVPHP.eB, AAVPHP.S, AAVpo1, AAVrh.8, AAVrh.10, AAVrh.20, AAVrh.43 and / or AAVShH10.

[0226] In some instances, the system comprises a first-dependent parvovirus genus viral vector (containing the first nucleic acid molecule) and / or a second-dependent parvovirus genus viral vector (containing the second nucleic acid molecule). In some instances, the system comprises a first-dependent parvovirus subfamily viral vector (containing the first nucleic acid molecule) and / or a second-dependent parvovirus subfamily viral vector (containing the second nucleic acid molecule). In some instances, the system comprises a first-dependent parvovirus family viral vector (containing the first nucleic acid molecule) and / or a second-dependent parvovirus family viral vector (containing the second nucleic acid molecule).

[0227] In some instances, the inpeptide pair is Npu DnaE intekin pairs. In some instances, the N-intekin comprises the amino acid sequence of SEQ ID NO: 26 or an amino acid sequence having at least 95% identity with it. In some instances, the C-intekin comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence having at least 95% identity with it.

[0228] In some instances, the first signal sequence, the N-terminal portion of the type IV collagen α chain, and the N-intein are directly fused. In some instances, the second signal sequence, the C-intein, and the C-terminal portion of the type IV collagen α chain are directly fused.

[0229] In some instances, the splitting inteptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 1:1 to about 0.010:1. In some instances, the splitting inteptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 0.017:1 to about 0.010:1.

[0230] In some instances, the split point is located within the collagen domain of the type IV collagen α chain.

[0231] In some instances, the first signal sequence and / or the second signal sequence is a collagen signal sequence or a chymotrypsin signal sequence. In some instances, the first signal sequence and the second signal sequence are different. In some instances, the collagen signal sequence comprises the amino acid sequence of SEQ ID NO: 4. In some instances, the chymotrypsin signal sequence comprises the amino acid sequence of SEQ ID NO: 5.

[0232] In some instances, the type IV collagen α chain comprises an amino acid sequence of any one of SEQ ID NO: 15-25 or an amino acid sequence having at least 95% identity with it. In some instances, the type IV collagen α chain comprises an amino acid sequence of SEQ ID NO: 15 or an amino acid sequence having at least 95% identity with it.

[0233] In some instances, the split point is located at positions 729 to 1488 relative to SEQ ID NO: 15.

[0234] In some examples, the N-terminal portion contains amino acids 1-450 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 451-1685 of the type IV collagen α chain (SP1). In some examples, the N-terminal portion contains amino acids 1-696 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 697-1685 of the type IV collagen α chain (SP2). In some examples, the N-terminal portion contains amino acids 1-863 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 864-1685 of the type IV collagen α chain (SP4). In some examples, the N-terminal portion contains amino acids 1-878 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 879-1685 of the type IV collagen α chain (SP5). In some examples, the N-terminal portion contains amino acids 1-941 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 942-1685 of the type IV collagen α chain (SP7). In some examples, the N-terminal portion contains amino acids 1-977 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 978-1685 of the type IV collagen α chain (SP9). In some examples, the N-terminal portion contains amino acids 1-1070 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 1071-1685 of the type IV collagen α chain (SP11). In some examples, the N-terminal portion contains amino acids 1-1135 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 1136-1685 of the type IV collagen α chain (SP12).

[0235] In some examples, the N-terminal portion contains amino acids 1-696 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 697-1685 of the type IV collagen α chain (SP2). In some examples, the N-terminal portion contains amino acids 1-878 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 879-1685 of the type IV collagen α chain (SP5). In some examples, the N-terminal portion contains amino acids 1-888 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 889-1685 of the type IV collagen α chain (SP20). In some examples, the N-terminal portion contains amino acids 1-915 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 916-1685 of the type IV collagen α chain (SP6). In some examples, the N-terminal portion contains amino acids 1-941 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 942-1685 of the type IV collagen α chain (SP7). In some examples, the N-terminal portion contains amino acids 1-961 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 962-1685 of the type IV collagen α chain (SP8). In some examples, the N-terminal portion contains amino acids 1-977 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 978-1685 of the type IV collagen α chain (SP9). In some examples, the N-terminal portion contains amino acids 1-995 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 996-1685 of the type IV collagen α chain (SP10). In some instances, the N-terminal portion contains amino acids 1-1070 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 1071-1685 of the type IV collagen α chain (SP11). In some instances, the N-terminal portion contains amino acids 1-1098 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 1099-1685 of the type IV collagen α chain (SP27). In some instances, the N-terminal portion contains amino acids 1-1135 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 1136-1685 of the type IV collagen α chain (SP12).

[0236] In some examples, the N-terminal portion contains amino acids 27-696 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 697-1685 of the type IV collagen α chain (SP2). In some examples, the N-terminal portion contains amino acids 27-878 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 879-1685 of the type IV collagen α chain (SP5). In some examples, the N-terminal portion contains amino acids 27-888 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 889-1685 of the type IV collagen α chain (SP20). In some examples, the N-terminal portion contains amino acids 27-915 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 916-1685 of the type IV collagen α chain (SP6). In some examples, the N-terminal portion contains amino acids 27-941 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 942-1685 of the type IV collagen α chain (SP7). In some examples, the N-terminal portion contains amino acids 27-961 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 962-1685 of the type IV collagen α chain (SP8). In some examples, the N-terminal portion contains amino acids 27-977 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 978-1685 of the type IV collagen α chain (SP9). In some examples, the N-terminal portion contains amino acids 27-995 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 996-1685 of the type IV collagen α chain (SP10). In some examples, the N-terminal portion contains amino acids 27-1070 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 1071-1685 of the type IV collagen α chain (SP11). In some examples, the N-terminal portion contains amino acids 27-1098 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 1099-1685 of the type IV collagen α chain (SP27). In some examples, the N-terminal portion contains amino acids 27-1135 of the type IV collagen α chain, and / or the C-terminal portion contains amino acids 1136-1685 of the type IV collagen α chain (SP12).

[0237] In some instances, the N-terminal portion contains DEI at its C-terminus, and / or the C-terminal portion contains CEPG at its N-terminus (SEQ ID NO: 230) (SP1). In some instances, the N-terminal portion contains IPG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP2). In some instances, the N-terminal portion contains ERG at its C-terminus, and / or the C-terminal portion contains SPGI at its N-terminus (SEQ ID NO: 231) (SP4). In some instances, the N-terminal portion contains PPG at its C-terminus, and / or the C-terminal portion contains SPGL at its N-terminus (SEQ ID NO: 222) (SP5). In some instances, the N-terminal portion contains EKG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP7). In some instances, the N-terminal portion contains PGV at its C-terminus, and / or the C-terminal portion contains SGPK at its N-terminus (SEQ ID NO: 225) (SP9). In some instances, the N-terminal portion contains PGI at its C-terminus, and / or the C-terminal portion contains SSIG at its N-terminus (SEQ ID NO: 227) (SP11). In some instances, the N-terminal portion contains KGI at its C-terminus, and / or the C-terminal portion contains SGPP at its N-terminus (SEQ ID NO: 229) (SP12).

[0238] In some instances, the N-terminal portion contains IPG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP2). In some instances, the N-terminal portion contains PPG at its C-terminus, and / or the C-terminal portion contains SPGL at its N-terminus (SEQ ID NO: 222) (SP5). In some instances, the N-terminal portion contains AGA at its C-terminus, and / or the C-terminal portion contains SGFP at its N-terminus (SEQ ID NO: 223) (SP20). In some instances, the N-terminal portion contains PGR at its C-terminus, and / or the C-terminal portion contains SGVP at its N-terminus (SEQ ID NO: 224) (SP6). In some instances, the N-terminal portion contains EKG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP7). In some instances, the N-terminal portion contains LLG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP8). In some instances, the N-terminal portion contains PGV at its C-terminus, and / or the C-terminal portion contains SGPK at its N-terminus (SEQ ID NO: 225) (SP9). In some instances, the N-terminal portion contains PGL at its C-terminus, and / or the C-terminal portion contains SGQP at its N-terminus (SEQ ID NO: 226) (SP10). In some instances, the N-terminal portion contains PGI at its C-terminus, and / or the C-terminal portion contains SSIG at its N-terminus (SEQ ID NO: 227) (SP11). In some instances, the N-terminal portion contains IKG at its C-terminus, and / or the C-terminal portion contains SVGD at its N-terminus (SEQ ID NO: 228) (SP27). In some instances, the N-terminal portion contains KGI at its C-terminus, and / or the C-terminal portion contains SGPP (SEQ ID NO: 229) (SP12) at its N-terminus.

[0239] In some instances, the sites comprising the C-terminus and N-terminus of the N-extensive peptide have at least 14%, at least 28%, at least 42%, at least 57%, at least 71%, at least 85%, or at least 100% identity with at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 of the sites in SEQ ID NO: 210-220. In some instances, the sites comprising the C-terminus and N-terminus of the N-extensive peptide share at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, or at least 11 of the sites in SEQ ID NO: 210-220. In some instances, the sites comprising the C-terminus and the N-terminus of the N-exotropic peptide have at most 86%, at most 72%, at most 58%, at most 43%, at most 29%, or at most 15% identity with at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16 of those in SEQ ID NO: 194-209. In some instances, the C-terminus of the N-extensive peptide and the N-terminus of the N-extensive peptide share at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 consecutive residues in SEQ ID NO: 194-209. In some instances, the C-terminal portion of the cleaved inteptide system contains amino acid S at its N-terminus.

[0240] In other instances, the first nucleic acid molecule and / or the second nucleic acid molecule are operatively linked to a CAG promoter. In some instances, the first nucleic acid molecule and / or the second nucleic acid molecule further comprises a marmot hepatitis virus post-transcriptional regulatory element. In specific instances, the first nucleic acid molecule and / or the second nucleic acid molecule are operatively linked to the marmot hepatitis virus post-transcriptional regulatory element. In some instances, the first nucleic acid molecule and / or the second nucleic acid molecule further encodes an SV40 polyadenylation signal.

[0241] This article further discloses a pharmaceutical composition comprising an effective amount of the split intipeptide system and a pharmaceutically acceptable carrier, wherein the split intipeptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 1:1 to about 0.010:1.

[0242] This paper also discloses a splitting intron system comprising a first adeno-associated virus (AAV) vector containing a first nucleic acid molecule operatively linked to a CAG promoter, wherein the first nucleic acid molecule encodes an N-external peptide and an N-external peptide pair sequentially comprising external peptide pairs from N-terminus to C-terminus. Npu A fusion protein of the N-inpeptide of the DnaE intein pair, wherein the N-external peptide comprises an N-terminal collagen signal sequence located at the N-terminus of the type IV collagen α5 (COL4A5) chain, wherein the collagen signal sequence, the N-terminal portion of the COL4A5 chain, and the N-intein are directly fused. The split intein system may further comprise a second AAV vector comprising a second nucleic acid molecule operatively linked to a CAG promoter, wherein the second nucleic acid molecule encodes a signal sequence sequentially from the N-terminus to the C-terminus. Npu A fusion protein of the C-inpeptide of the DnaE intron pair and the C-external peptide of the extron pair, wherein the C-external peptide comprises the C-terminal portion of the COL4A5 chain, wherein the signal sequence, the C-inpeptide, and the C-terminal portion of the COL4A5 chain are directly fused. In some instances, the N-terminal and C-terminal portions of the COL4A5 chain are together contained within a separate COL4A5 chain sequence at the cleavage point. In other instances, when the first and second nucleic acid molecules are expressed in mammalian cells, the N-external peptide and the C-external peptide are spliced ​​together to form a mature COL4A5 chain.

[0243] In some instances, the N-terminal portion contains amino acids 1-450 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 451-1685 of the COL4A5 chain (SP1). In some instances, the N-terminal portion contains amino acids 1-696 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 697-1685 of the COL4A5 chain (SP2). In some instances, the N-terminal portion contains amino acids 1-863 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 864-1685 of the COL4A5 chain (SP4). In some instances, the N-terminal portion contains amino acids 1-878 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 879-1685 of the COL4A5 chain (SP5). In some instances, the N-terminal portion contains amino acids 1-941 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 942-1685 of the COL4A5 chain (SP7). In some instances, the N-terminal portion contains amino acids 1-977 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 978-1685 of the COL4A5 chain (SP9). In some instances, the N-terminal portion contains amino acids 1-1070 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1071-1685 of the COL4A5 chain (SP11). In some instances, the N-terminal portion contains amino acids 1-1135 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1136-1685 of the COL4A5 chain (SP12).

[0244] In some instances, the N-terminal portion contains amino acids 1-696 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 697-1685 of the COL4A5 chain (SP2). In some instances, the N-terminal portion contains amino acids 1-878 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 879-1685 of the COL4A5 chain (SP5). In some instances, the N-terminal portion contains amino acids 1-888 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 889-1685 of the COL4A5 chain (SP20). In some instances, the N-terminal portion contains amino acids 1-915 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 916-1685 of the COL4A5 chain (SP6). In some instances, the N-terminal portion contains amino acids 1-941 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 942-1685 of the COL4A5 chain (SP7). In some instances, the N-terminal portion contains amino acids 1-961 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 962-1685 of the COL4A5 chain (SP8). In some instances, the N-terminal portion contains amino acids 1-977 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 978-1685 of the COL4A5 chain (SP9). In some instances, the N-terminal portion contains amino acids 1-995 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 996-1685 of the COL4A5 chain (SP10). In some instances, the N-terminal portion contains amino acids 1-1070 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1071-1685 of the COL4A5 chain (SP11). In some instances, the N-terminal portion contains amino acids 1-1098 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1099-1685 of the COL4A5 chain (SP27). In some instances, the N-terminal portion contains amino acids 1-1135 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1136-1685 of the COL4A5 chain (SP12).

[0245] In some instances, the N-terminal portion does not contain an N-terminal methionine at the first amino acid position. In some instances, the N-terminal portion contains amino acids 2-450 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 451-1685 of the COL4A5 chain (SP1). In some instances, the N-terminal portion contains amino acids 2-696 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 697-1685 of the COL4A5 chain (SP2). In some instances, the N-terminal portion contains amino acids 2-863 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 864-1685 of the COL4A5 chain (SP4). In some instances, the N-terminal portion contains amino acids 2-878 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 879-1685 of the COL4A5 chain (SP5). In some instances, the N-terminal portion contains amino acids 2-941 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 942-1685 of the COL4A5 chain (SP7). In some instances, the N-terminal portion contains amino acids 2-977 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 978-1685 of the COL4A5 chain (SP9). In some instances, the N-terminal portion contains amino acids 2-1070 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1071-1685 of the COL4A5 chain (SP11). In some instances, the N-terminal portion contains amino acids 2-1135 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1136-1685 of the COL4A5 chain (SP12).

[0246] In some instances, the N-terminal portion does not contain an N-terminal methionine at the first amino acid position. In some instances, the N-terminal portion contains amino acids 2-696 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 697-1685 of the COL4A5 chain (SP2). In some instances, the N-terminal portion contains amino acids 2-878 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 879-1685 of the COL4A5 chain (SP5). In some instances, the N-terminal portion contains amino acids 2-888 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 889-1685 of the COL4A5 chain (SP20). In some instances, the N-terminal portion contains amino acids 2-915 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 916-1685 of the COL4A5 chain (SP6). In some instances, the N-terminal portion contains amino acids 2-941 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 942-1685 of the COL4A5 chain (SP7). In some instances, the N-terminal portion contains amino acids 2-961 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 962-1685 of the COL4A5 chain (SP8). In some instances, the N-terminal portion contains amino acids 2-977 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 978-1685 of the COL4A5 chain (SP9). In some instances, the N-terminal portion contains amino acids 2-995 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 996-1685 of the COL4A5 chain (SP10). In some instances, the N-terminal portion contains amino acids 2-1070 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1071-1685 of the COL4A5 chain (SP11). In some instances, the N-terminal portion contains amino acids 2-1098 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1099-1685 of the COL4A5 chain (SP27). In some instances, the N-terminal portion contains amino acids 2-1135 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1136-1685 of the COL4A5 chain (SP12).

[0247] In some instances, the N-terminal portion does not contain a collagen signal sequence, such as SEQ ID NO: 4. In some instances, the N-terminal portion contains amino acids 27-450 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 451-1685 of the COL4A5 chain (SP1). In some instances, the N-terminal portion contains amino acids 27-696 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 697-1685 of the COL4A5 chain (SP2). In some instances, the N-terminal portion contains amino acids 27-863 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 864-1685 of the COL4A5 chain (SP4). In some instances, the N-terminal portion contains amino acids 27-878 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 879-1685 of the COL4A5 chain (SP5). In some instances, the N-terminal portion contains amino acids 27-941 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 942-1685 of the COL4A5 chain (SP7). In some instances, the N-terminal portion contains amino acids 27-977 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 978-1685 of the COL4A5 chain (SP9). In some instances, the N-terminal portion contains amino acids 27-1070 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1071-1685 of the COL4A5 chain (SP11). In some instances, the N-terminal portion contains amino acids 27-1135 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1136-1685 of the COL4A5 chain (SP12).

[0248] In other instances, the N-terminal portion does not contain a collagen signal sequence, such as SEQ ID NO: 4. In some instances, the N-terminal portion contains amino acids 27-696 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 697-1685 of the COL4A5 chain (SP2). In some instances, the N-terminal portion contains amino acids 27-878 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 879-1685 of the COL4A5 chain (SP5). In some instances, the N-terminal portion contains amino acids 27-888 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 889-1685 of the COL4A5 chain (SP20). In some instances, the N-terminal portion contains amino acids 27-915 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 916-1685 of the COL4A5 chain (SP6). In some instances, the N-terminal portion contains amino acids 27-941 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 942-1685 of the COL4A5 chain (SP7). In some instances, the N-terminal portion contains amino acids 27-961 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 962-1685 of the COL4A5 chain (SP8). In some instances, the N-terminal portion contains amino acids 27-977 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 978-1685 of the COL4A5 chain (SP9). In some instances, the N-terminal portion contains amino acids 27-995 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 996-1685 of the COL4A5 chain (SP10). In some instances, the N-terminal portion contains amino acids 27-1070 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1071-1685 of the COL4A5 chain (SP11). In some instances, the N-terminal portion contains amino acids 27-1098 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1099-1685 of the COL4A5 chain (SP27). In some instances, the N-terminal portion contains amino acids 27-1135 of the COL4A5 chain, and / or the C-terminal portion contains amino acids 1136-1685 of the COL4A5 chain (SP12).

[0249] In some instances, the N-terminal portion contains DEI at its C-terminus, and / or the C-terminal portion contains CEPG at its N-terminus (SEQ ID NO: 230) (SP1). In some instances, the N-terminal portion contains IPG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP2). In some instances, the N-terminal portion contains ERG at its C-terminus, and / or the C-terminal portion contains SPGI at its N-terminus (SEQ ID NO: 231) (SP4). In some instances, the N-terminal portion contains PPG at its C-terminus, and / or the C-terminal portion contains SPGL at its N-terminus (SEQ ID NO: 222) (SP5). In some instances, the N-terminal portion contains EKG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP7). In some instances, the N-terminal portion contains PGV at its C-terminus, and / or the C-terminal portion contains SGPK at its N-terminus (SEQ ID NO: 225) (SP9). In some instances, the N-terminal portion contains PGI at its C-terminus, and / or the C-terminal portion contains SSIG at its N-terminus (SEQ ID NO: 227) (SP11). In some instances, the N-terminal portion contains KGI at its C-terminus, and / or the C-terminal portion contains SGPP at its N-terminus (SEQ ID NO: 229) (SP12).

[0250] In some instances, the N-terminal portion contains IPG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP2). In some instances, the N-terminal portion contains PPG at its C-terminus, and / or the C-terminal portion contains SPGL at its N-terminus (SEQ ID NO: 222) (SP5). In some instances, the N-terminal portion contains AGA at its C-terminus, and / or the C-terminal portion contains SGFP at its N-terminus (SEQ ID NO: 223) (SP20). In some instances, the N-terminal portion contains PGR at its C-terminus, and / or the C-terminal portion contains SGVP at its N-terminus (SEQ ID NO: 224) (SP6). In some instances, the N-terminal portion contains EKG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP7). In some instances, the N-terminal portion contains LLG at its C-terminus, and / or the C-terminal portion contains SKGE at its N-terminus (SEQ ID NO: 221) (SP8). In some instances, the N-terminal portion contains PGV at its C-terminus, and / or the C-terminal portion contains SGPK at its N-terminus (SEQ ID NO: 225) (SP9). In some instances, the N-terminal portion contains PGL at its C-terminus, and / or the C-terminal portion contains SGQP at its N-terminus (SEQ ID NO: 226) (SP10). In some instances, the N-terminal portion contains PGI at its C-terminus, and / or the C-terminal portion contains SSIG at its N-terminus (SEQ ID NO: 227) (SP11). In some instances, the N-terminal portion contains IKG at its C-terminus, and / or the C-terminal portion contains SVGD at its N-terminus (SEQ ID NO: 228) (SP27). In some instances, the N-terminal portion contains KGI at its C-terminus, and / or the C-terminal portion contains SGPP (SEQ ID NO: 229) (SP12) at its N-terminus.

[0251] Pharmaceutical compositions comprising an effective amount of the aforementioned splitting intipeptide system and a pharmaceutically acceptable carrier are also disclosed.

[0252] A method for treating Alport syndrome in a subject is further disclosed, comprising administering to the subject a therapeutically effective amount of the disclosed splitting intipeptide system or the disclosed pharmaceutical composition to treat the subject's Alport syndrome. In some instances, the method comprises delivering the splitting intipeptide system to the subject's kidney. In some instances, the method comprises systemic administration, such as systemic injection or systemic infusion. In some instances, the method comprises locally delivering the splitting intipeptide system to the subject's kidney. In some instances, local delivery comprises direct parenchymal injection, renal vein injection, and / or renal artery injection. In some instances, local delivery comprises direct pyelonephrosis injection or retrograde transureteropyrosis injection. In some instances, the splitting intipeptide system transduces at least one of mesangial cells, glomerular endothelial cells, parietal epithelial cells, podocytes, proximal tubule cells, loop of Henle cells, distal tubule cells, collecting duct cells, fibroblasts, pericytes, or vascular smooth muscle cells.

[0253] In some instances, this method improves renal function in subjects, delays the onset of end-stage renal disease, postpones the time to dialysis, postpones the time to kidney transplantation, and / or improves life expectancy. In some instances, the Alport syndrome is X-linked Alport syndrome. In some instances, the method further includes administering an effective amount of angiotensin II receptor blocker (ARB) and / or angiotensin-converting enzyme inhibitor. In some instances, the method further includes administering one or more of candesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, valsartan, benazepril, captopril, cilazapril, enalapril, fosinopril, lisinopril, moxipril, perindopril, ramipril, quinapril, and / or randolapril. In some instances, the ARB includes one or more of candesartan, captopril, eprosartan, irbesartan, losartan, moxipril, olmesartan, telmisartan, and / or valsartan. In some instances, the angiotensin-converting enzyme inhibitor includes one or more of benazepril, cilazapril, enalapril, fosinopril, lisinopril, perindopril, ramipril, quinapril, and / or randopril.

[0254] IV. Splitting Inteptides and Systems Inteins can contain naturally occurring or artificial polypeptide sequences capable of catalyzing a protein splicing reaction that cleaves the intein sequence from a precursor protein and links flanking sequences (N-exopeptides and C-exopeptides) with peptide bonds. Some inteins contain homing endonuclease domains. Exemplary inteins can be found at inbase.ligsciss.com / iwai / . In subsets of inteins, the N-terminal and C-terminal amino acid sequences are not directly linked by peptide bonds, but rather exist as separate fragments that can be non-covalently reassociated or reconstituted into an intein functional for trans-splicing. This is called a split intein. For example, in cyanobacteria, DnaE (the catalytic subunit α of DNA polymerase III) consists of two separate genes. dnaE-n and dnaE-c Encoding. By dnaE-n The gene-encoded intepid is an example N-intepid, and is composed of... dnaE-c Genetically encoded inteins are exemplified by C-inteins.

[0255] In specific examples, intein mutants are used, where the catalytic and second-shell accelerator residues of the intein are maintained, and only non-catalytic residues or residues outside the second shell are mutated. The second-shell accelerator residues are residues adjacent to the active site of the intein and play a role in regulating the splicing activity of the intein. The catalytic and accelerator residues of DnaE family inteins are described in Stevens' work. et al. J. Am. Chem. Soc. (2016) 138:2162-65. Catalytic residues of other inteptide families (including DnaE, ​​GyrA, GyrB, DnaB, TerL, gp41, IMPDH) are described in Shah & Muir, Chem. Sci (2014) 5:446-61. Methods for identifying second-shell accelerating residues are described in Stevens. et al. , J. Am. Chem. Soc. (2016) 138:2162-65. Non-limiting examples of integrin pairs that may be used according to this disclosure include: Cfa DnaE integrin, Gp41-1 integrin, Ssp GyrB integrin, Ssp DnaX integrin, Ter DnaE3 integrin, Ter ThyX integrin, Rma DnaB integrin, and Cne Prp8 integrin (e.g., as described in U.S. Patent No. 8,394,604).

[0256] In some instances, the inteptide contains NpuIn some instances, the N-inpeptide comprises the amino acid sequence of SEQ ID NO: 26 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identity with it. In some instances, the C-inpeptide comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identity with it.

[0257] This document discloses a fusion protein comprising an N-external peptide of an external peptide pair and an N-inpeptide of an internal peptide pair. The construct may have an N-external peptide-N-internal peptide (in N-terminal to C-terminal sequence) structure. This document also discloses a fusion protein comprising a C-internal peptide of the internal peptide pair and a C-external peptide of the external peptide pair. The construct may have a C-internal peptide-C-external peptide (in N-terminal to C-terminal sequence) structure. In some instances, portions of the first and / or second fusion protein (e.g., the N-external peptide and N-internal peptide) are directly linked by peptide bonds. This can be described as direct fusion. In some instances, portions of the first and / or second fusion protein are linked by a linker sequence.

[0258] The nature of the linker will depend on the nature of the part to be joined. In a specific example, the linker is a peptide. In a specific example, the linker is a peptide with a length of 1, 2, 3, 4, 5, 10, 20, 50, 100 or more amino acid residues (e.g., 1 to 3 amino acid residues). In some examples, the linker is a flexible GS linker with glycine and serine residue stretches. In one example, the N-terminus of the linker is attached to the C-terminus of the first part to be joined, and the C-terminus of the linker is attached to the N-terminus of the second part to be joined via a peptide bond.

[0259] The protein to be reconstructed can be encoded by both an N-exponential peptide and a C-exponential peptide. For example, the protein to be reconstructed can be a type IV collagenase alpha chain, such as COL4A3, COL4A4, or COL4A5. In a specific instance, the protein to be reconstructed includes COL4A5.

[0260] It may also contain a signal sequence. In some aspects, the first fusion protein sequentially comprises, from N-terminus to C-terminus, a signal sequence, an N-terminal portion of the type IV collagenase α chain, and an N-intein. In other aspects, the second fusion protein sequentially comprises, from N-terminus to C-terminus, a second signal sequence, a C-intein, and a C-terminal portion of the type IV collagenase α chain. In some aspects, a linker exists between the first signal sequence and the N-terminal portion of the type IV collagen α chain and / or between the N-terminal portion of the type IV collagen α chain and the N-intein. In other aspects, a linker exists between the second signal sequence and the C-intein and / or between the C-intein and the C-terminal portion of the type IV collagen α chain. In some instances, the linker is a flexible GS linker with glycine and serine residue extensions.

[0261] This document discloses N-external peptides and C-external peptides that, when expressed in mammalian cells as a first and second nucleic acid molecule, can be spliced ​​together to form a mature type IV collagen α chain. In some instances, the type IV collagen α chain comprises an amino acid sequence of any one of SEQ ID NO: 15-25 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identity with it. In a specific instance, the type IV collagen α chain comprises an amino acid sequence of SEQ ID NO: 15 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identity with it. In some instances, the type IV collagen α chain comprises the amino acid sequence of SEQ ID NO: 13 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identity with it. In some instances, the type IV collagen α chain comprises the amino acid sequence of SEQ ID NO: 14 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identity with it.

[0262] In some instances, the N-terminal and C-terminal portions of the type IV collagen α chain together define a sequence of type IV collagen α chains separated at a split point. In some instances, the split point may be located within a collagen domain of the type IV collagen α chain. In some instances, the split point is located within a non-collagenous break region of the collagen domain. In some instances, the split point is located within a non-collagenous C-terminal domain. In some instances, the split point is located at positions 729 to 1488 relative to SEQ ID NO: 15. In some instances, the split point is located at positions 697 to 1488 relative to SEQ ID NO: 15. In some instances, the split point is located at positions 697 to 1136 relative to SEQ ID NO: 15. In some instances, the split point is located at positions 879 to 996 relative to SEQ ID NO: 15. In some instances, the split point is located at positions 942 to 996 relative to SEQ ID NO: 15. In some instances, the split point is located at positions 565 to 1111 relative to SEQ ID NO: 15. In some instances, the split point is located at positions 188 to 1488 relative to SEQ ID NO: 15. In some instances, the split point is located at positions 573 to 1108 relative to SEQ ID NO: 13. In some instances, the split point is located at positions 235 to 1499 relative to SEQ ID NO: 13. In some instances, the split point is located at positions 585 to 1116 relative to SEQ ID NO: 14. In some instances, the split point is located at positions 200 to 1492 relative to SEQ ID NO: 14.

[0263] In some instances, the construct, N-inpeptide, C-inpeptide, N-expeptide, or C-expeptide contains an epitope tag, such as a FLAG tag (e.g., SEQ ID NO: 6). In alternative instances, the construct, N-inpeptide, C-inpeptide, N-expeptide, or C-expeptide does not contain an epitope tag, such as a FLAG tag (e.g., SEQ ID NO: 6). In some instances, the construct, N-inpeptide, C-inpeptide, N-expeptide, or C-expeptide does not contain a 3xFLAG tag. In some instances, the construct, N-inpeptide, C-inpeptide, N-expeptide, or C-expeptide does not contain an HA tag. In some instances, the first fusion protein and / or the second fusion protein contains an epitope tag, such as a FLAG tag. In some instances, the first fusion protein and / or the second fusion protein contains a 3xFLAG tag. In some instances, the first fusion protein and / or the second fusion protein contains an HA tag. In alternative examples, the first and / or second fusion protein does not contain a FLAG tag. In some examples, the first and / or second fusion protein does not contain a 3xFLAG tag. In some examples, the first and / or second fusion protein does not contain an HA tag. In some examples, the FLAG tag is located at the C-terminus of the N-inte. In some examples, the 3xFLAG tag is located at the C-terminus of the N-inte. In some examples, the HA tag is located at the C-terminus of the N-inte. In some examples, the FLAG tag is located at the C-terminus of the C-exopeptide. In some examples, the 3xFLAG tag is located at the C-terminus of the C-exopeptide. In some examples, the HA tag is located at the C-terminus of the C-exopeptide.

[0264] In some instances, the first nucleic acid molecule encodes a first signal sequence. In some instances, the N-exopeptide comprises an N-terminal first signal sequence located at the N-terminus of the N-terminal portion of the type IV collagen α chain. In other instances, the N-exopeptide comprises a C-terminal first signal sequence located at the C-terminus of the N-terminal portion of the type IV collagen α chain. In some instances, the first signal sequence is located within the N-terminal portion of the type IV collagen α chain. In some instances, the first nucleic acid molecule encodes a fusion protein comprising, from N-terminus to C-terminus, the first signal sequence, the N-exopeptide of the exopeptide pair, and the N-integrant of the inteptide pair. In some instances, the first nucleic acid molecule encodes a fusion protein comprising, from N-terminus to C-terminus, the N-exopeptide of the exopeptide pair, the first signal sequence, and the N-integrant of the inteptide pair. In some instances, the first nucleic acid molecule encodes a fusion protein comprising, from N-terminus to C-terminus, the N-exopeptide of the exopeptide pair, the N-integrant of the inteptide pair, and the first signal sequence.

[0265] In some instances, the second nucleic acid protein encodes a second signal sequence. In some instances, the C-inpeptide contains the second signal sequence at its N-terminal portion. In some instances, the C-inpeptide contains the second signal sequence at its C-terminal portion. In some instances, the second signal sequence is located within the C-inpeptide. In some instances, the C-exopeptide contains the second signal sequence at its N-terminal portion. In some instances, the C-exopeptide contains the second signal sequence at its C-terminal portion. In some instances, the second signal sequence is located within the C-exopeptide. In some instances, the second nucleic acid protein encodes a fusion protein comprising, from N-terminus to C-terminus, the C-inpeptide of the inpeptide pair and the C-exopeptide of the exopeptide pair. In some instances, the second nucleic acid protein encodes a fusion protein comprising, from N-terminus to C-terminus, the C-inpeptide of the inpeptide pair, the second signal sequence, and the C-exopeptide of the exopeptide pair. In some instances, the second nucleic acid protein encodes a fusion protein comprising, from N-terminus to C-terminus, the C-inpeptide of the inteptide pair, the C-external peptide of the external peptide pair, and a second signal sequence.

[0266] In some instances, the first signal sequence and / or the second signal sequence is a collagen signal sequence or a chymotrypsin signal sequence. In some instances, the first signal sequence and the second signal sequence are different. In some instances, the first signal sequence and the second signal sequence are the same. In some instances, the collagen signal sequence comprises the amino acid sequence of SEQ ID NO: 4 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identity with it. In some instances, the collagen signal sequence is a natural COL4A5 signal sequence. In some instances, the collagen signal sequence is a natural COL4A4 signal sequence. In some instances, the collagen signal sequence is a natural COL4A3 signal sequence. In some instances, the chymotrypsin signal sequence comprises the amino acid sequence of SEQ ID NO: 5 or an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% identity with it.

[0267] Including WPRE elements as 3'UTRs in transgenes can enhance transgene expression in gene delivery vectors. While the mechanisms of WPRE-mediated gene expression enhancement are not fully understood, they include increased mRNA stability and nuclear export, leading to elevated homeostatic mRNA levels, reduced readthrough transcription thus improving transcription termination, and enhanced mRNA translation into protein products. WPRE3, a truncated version of the conventional 0.6-kb WPRE, has been developed to maximize the packaging capacity of AAVs to accommodate transgene expression units while utilizing the transgene expression enhancement effects of WPREs (Choi). et al. Mol Brain (2014) 7:17). WPRE3 is 0.35 kb shorter than WPRE and contains only the smallest γ and α elements of the three regulatory elements (α, β, and γ) present in WPRE. Despite this truncation, WPRE3 retains an enhancement effect comparable to WPRE.

[0268] In some instances, the first nucleic acid molecule contains WPRE and / or WPRE3. In some instances, WPRE and / or WPRE3 are located on the 3' side of the nucleotide sequence encoding the fusion protein (containing an N-external peptide of an external peptide pair and an N-intron peptide of an intron peptide pair). In some instances, WPRE and / or WPRE3 are located on the 5' side of the nucleotide sequence encoding the fusion protein (containing an N-external peptide of an external peptide pair and an N-intron peptide of an intron peptide pair). In some instances, the second nucleic acid molecule contains WPRE and / or WPRE3. In some instances, WPRE and / or WPRE3 are located on the 3' side of the nucleotide sequence encoding the fusion protein (containing a C-intron peptide of an intron peptide pair and a C-external peptide of an external peptide pair). In some instances, WPRE and / or WPRE3 are located on the 5' side of the nucleotide sequence encoding the fusion protein (containing a C-intron peptide of an intron peptide pair and a C-external peptide of an external peptide pair).

[0269] In some instances, WPRE comprises the nucleotide sequence of SEQ ID NO: 120, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.9% identity with it. In some instances, WPRE3 comprises the nucleotide sequence of SEQ ID NO: 121, or a sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.9% identity with it.

[0270] In some instances, the first fusion protein is encoded by a first nucleic acid molecule. In some instances, the second fusion protein is encoded by a second nucleic acid molecule. This document further discloses a first AAV vector containing the first nucleic acid molecule. This document also discloses a second AAV vector containing the second nucleic acid molecule. Administration of one or both nucleic acid molecules, and / or administration of one or both AAV vectors, can result in the reconstruction of the protein to be reconstructed. The purpose of reconstructing these proteins may be to treat diseases associated with mutations in the genes they encode by providing the correct version of these genes, such as treating Alport syndrome by providing the correct version of COL4A5.

[0271] In some instances, the splitting intipeptide system comprises a first nucleic acid molecule encoding the first fusion protein and a second nucleic acid molecule encoding the second fusion protein.

[0272] This paper discloses a split intron system comprising a first nucleic acid molecule encoding a fusion protein containing an N-external peptide of an external peptide pair and an N-intron peptide of an intron peptide pair. The split intron system also comprises a second nucleic acid molecule encoding a fusion protein containing a C-intron peptide of the intron peptide pair and a C-external peptide of the external peptide pair. This paper discloses that incorporating a signal sequence into either the first or second nucleic acid molecule can affect the localization of their respective fusion proteins.

[0273] In some instances, the first fusion protein is encoded by a first nucleic acid molecule. In some instances, the first nucleic acid molecule encodes a fusion protein comprising a first signal sequence. In some instances, the N-exopeptide comprises a first signal sequence located at the N-terminus of the N-terminal portion of the type IV collagen α chain. In other instances, the N-exopeptide comprises a first signal sequence located at the C-terminus of the N-terminal portion of the type IV collagen α chain. In some instances, the first signal sequence is located within the N-terminal portion of the type IV collagen α chain. In some instances, the first fusion protein comprises, from N-terminus to C-terminus, the first signal sequence, the N-exopeptide of the exopeptide pair, and the N-inpeptide of the inteptide pair. In some instances, the first fusion protein comprises, from N-terminus to C-terminus, the N-exopeptide of the exopeptide pair, the first signal sequence, and the N-inpeptide of the inteptide pair. In some instances, the first fusion protein comprises, from N-terminus to C-terminus, the N-exopeptide of the exopeptide pair, the N-inpeptide of the inteptide pair, and a first signal sequence.

[0274] In some instances, the second fusion protein is encoded by a second nucleic acid molecule. In some instances, the second nucleic acid molecule encodes a fusion protein containing a second signal sequence. In some instances, the C-inpeptide contains a second signal sequence at its N-terminal portion. In some instances, the C-inpeptide contains a second signal sequence at its C-terminal portion. In some instances, the second signal sequence is located within the C-inpeptide. In some instances, the C-exopeptide contains a second signal sequence at its N-terminal portion. In some instances, the C-exopeptide contains a second signal sequence at its C-terminal portion. In some instances, the second signal sequence is located within the C-exopeptide. In some instances, the second fusion protein sequentially comprises, from N-terminus to C-terminus, the second signal sequence, and the C-exopeptide of the exopeptide pair. In some instances, the second fusion protein sequentially comprises, from N-terminus to C-terminus, the second signal sequence, and the C-exopeptide of the exopeptide pair. In some instances, the second fusion protein sequentially comprises, from N-terminus to C-terminus, the C-inteptide of the inteptide pair, the C-external peptide of the external peptide pair, and a second signal sequence.

[0275] V. Recombinant adeno-associated virus vector AAV vectors can transduce kidney cells, such as podocytes, mesangial cells, renal tubular epithelial cells, collecting duct cells, interstitial cells, and vascular cells. However, AAV vectors have size limitations, making it impossible to deliver full-length type IV collagen in a single AAV vector. This paper discloses engineered specific AAV vectors that deliver a splitting intipeptide system, such that when the AAV vector is introduced into mammalian cells, full-length collagen is produced. These AAV vectors can be used to deliver the disclosed splitting intipeptide system and can be used to treat Alport syndrome in subjects. In some aspects, the splitting intipeptide system comprises (i) a first adeno-associated virus (AAV) vector containing the first nucleic acid molecule; and (ii) a second AAV vector containing the second nucleic acid molecule. The first AAV vector and the second AAV vector may be of the same serotype. The first AAV vector and the second AAV vector may be of different serotypes.

[0276] The AAV used in the methods disclosed herein can be derived from multiple serotypes, including combinations of capsid serotypes and viral genome serotypes (e.g., "pseudotyped" AAV) or from multiple genomes (e.g., single-stranded or self-complementary).

[0277] AAV belongs to the family Parvoviridae and the genus Dependovirus. AAV is a small, non-enveloped virus that packages a linear, single-stranded DNA genome. The sense and antisense strands of the AAV DNA are packaged into the AAV capsid at the same frequency. In some aspects, the AAV DNA contains a first nucleic acid encoding a fusion protein comprising an N-exopeptide of an exopeptide pair and an N-inpeptide of an inteptide pair. In some aspects, the AAV DNA contains a second nucleic acid encoding a fusion protein comprising a C-inpeptide of the inteptide pair and a C-exopeptide of the exopeptide pair. In some aspects, when the first and second nucleic acid molecules are expressed in mammalian cells, for example after a first AAV particle containing the first nucleic acid and a second AAV particle containing the second nucleic acid come into contact with the mammalian cell, the N-exopeptide and C-exopeptide are spliced ​​together to form a mature type IV collagen α chain.

[0278] The AAV genome is characterized by two inverted terminal repeats (ITRs) flanking two open reading frames (ORFs). For example, in the AAV2 genome, the first 125 nucleotides of the ITR are palindromes, folding themselves to maximize base pairing and form a T-shaped hairpin structure. The remaining 20 bases of the ITR, called the D sequence, remain unpaired. The ITR is a cis-acting sequence, important for AAV DNA replication; it acts as a primer for replication initiation and for the second-strand synthesis by DNA polymerase. The double-stranded DNA formed during this synthesis is called a replication monomer, used for a second round of self-initiated replication to form a replication dimer. These double-stranded intermediates are processed through strand displacement mechanisms to produce single-stranded DNA for packaging and double-stranded DNA for transcription. Located within the ITR are Rep binding elements and terminal resolution sites (TRS). During AAV replication, the viral regulatory protein Rep utilizes these features to process the double-stranded intermediates. In addition to its role in AAV replication, the ITR is also involved in AAV genome packaging, transcription, negative regulation under non-permissioned conditions, and site-specific integration (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008). In some respects, these elements are included in AAV vectors.

[0279] The left-hand ORF of AAV contains rep The gene encodes four proteins—Rep78, Rep68, Rep52, and Rep40. The ORF on the right contains... capThe gene produces three viral capsid proteins (VP1, VP2, and VP3). The right-hand ORF also contains two additional frameshift ORFs for membrane-associated accessory proteins (MAAP) and assembly activating proteins (AAP). The AAV capsid contains 60 viral capsid proteins arranged in an icosahedral symmetry. VP1, VP2, and VP3 are present in a molar ratio of 1:1:10 (Daya and Berns, ClinMicrobiol Rev 21(4):583-593, 2008). In some respects, these elements are contained within an AAV vector. This AAV vector is packaged within capsid proteins that can target specific cell types, such as podocytes, mesangial cells, renal tubular epithelial cells, collecting duct cells, interstitial cells, and vascular cells.

[0280] In some aspects, recombinant adeno-associated virus (rAAV) with a capsid of interest is generated and can be used in the disclosed methods. In the AAV, the capsid comprises VP1, VP2, and VP3. In some non-limiting examples, for the production of the vector, a culturable host cell contains a nucleic acid sequence encoding an adeno-associated virus (AAV) capsid protein of interest or a fragment thereof; a functional rep gene; a minigene consisting of at least an AAV inverted terminal repeat (ITR) sequence and a transgene (e.g., a transgene encoding a therapeutic protein); and auxiliary functions sufficient to allow packaging in the capsid protein. Components required for culturing in the host cell for packaging the AAV minigene in the AAV capsid can be trans-provided to the host cell. Alternatively, any one or more components (e.g., minigene, rep Gene sequence, cap The gene sequence and / or accessory function may be provided by a stable host cell engineered to contain one or more components. In some respects, the stable host cell will contain components under the control of an inducible promoter. However, the component may be under the control of a constitutive promoter. Promoters used include, but are not limited to, the CMV promoter, CAG promoter, CB promoter, SV40 promoter, ubiquitin promoter, EF1α promoter, GAPDH promoter, PGK promoter, RSV promoter, and β-actin promoter.

[0281] In another alternative, the selected stable host cell may contain selected components under the control of a constitutive promoter, and other selected components under the control of one or more inducible promoters. For example, a stable host cell derived from 293 cells (which contain E1 helper function under the control of a constitutive promoter) but containing Rep and / or VP proteins under the control of an inducible promoter may be generated.

[0282] Miniature genes required to produce rAAV rep Gene sequence, capGene sequences and accessory functions can be delivered to packaging host cells in the form of any genetic element that transfers the sequence it carries. Selected genetic elements can be delivered by any suitable method, including those described herein. Methods for constructing vectors include genetic engineering, recombinant engineering, and synthetic techniques. See, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. Similarly, the method for generating rAAV viral particles and the choice of suitable method are not limitations of the invention. See, for example, K. Fisher et al, J. Virol., 70:520-532 (1993) and U.S. Patent No. 5,478,745.

[0283] AAV vectors may contain a promoter operatively linked to a sequence encoding a fusion protein, such as a first fusion protein comprising an N-exopeptide of an exopeptide pair and an N-inpeptide of an inpeptide pair, or a second fusion protein encoding a C-inpeptide of the inpeptide pair and a C-exopeptide of the exopeptide pair. In some aspects, the promoter is a ubiquitous promoter, such as the CMV promoter, CAG promoter, CB promoter, SV40 promoter, ubiquitin promoter, EF1α promoter, GAPDH promoter, PGK promoter, RSV promoter, and β-actin promoter.In some respects, this promoter is kidney-specific or cell-type-specific, such as the podocin (NPHS2) promoter, nephrin (NPHS1) promoter, synaptopodin promoter, WT1 promoter, podocalyxin promoter, PAX8 promoter, gamma-glutamyl transferase (GGT) promoter, sodium-glucose cotransporter 2 (SGLT2) promoter, kidney androgen regulatory protein (KAP) promoter, and megaloprotein (megaloprotein) promoter. promoters for various proteins and their related enzymes, including: carbonic anhydrase II (CAII) promoter, organic anion transporter 1 (OAT1, SLC22A6) promoter, sodium-phosphate cotransporter 2a (NPT2a) promoter, E-cadherin promoter, kidney-specific cadherin promoter, Na-K-Cl cotransporter 2 (NKCC2, SLC12A1) promoter, WNK1 promoter, WNK4 promoter, proton ATPase subunit B1 (ATP6V1B1) promoter, thiazide-sensitive Na-Cl cotransporter (NCC) promoter, and calcium-sensitive receptor. (CaSR) promoter, epithelial sodium channel (ENaC) promoter, uromodulin promoter, aquaporin 1 (AQP1) promoter, aquaporin 2 (AQP2) promoter, vasopressin receptor 2 (V2R) promoter, transient receptor potential vanillic acid 4 (TRPV4) promoter, renin promoter, parathyroid hormone receptor promoter, smooth muscle α-actin (ACTA2) promoter, COL4A1 promoter, platelet-derived growth factor receptor β (PDGFRβ) promoter, smooth muscle protein 22-α (SM22α) promoter. The first nucleic acid molecule and / or the second nucleic acid molecule are operatively linked to the CAG promoter. The promoters include: smooth muscle myosin heavy chain (SM-MHC), glial antigen 2 (NG2, chondroitin sulfate proteoglycan 4 (CSPG4)), desmin, G protein signaling regulator-5 (RGS5), fibroblast-specific protein 1 (FSP1), transcription factor 21 (TCF21), COL1A2, COL3A1, vimentin, TIE2, von Willebrand factor (vWF), CD31, and VE-cadherin. In some respects, the first nucleic acid molecule and / or the second nucleic acid molecule are operatively linked to the CAG promoter.

[0284] In some respects, the AAV genome is modified to include genes encoding selection markers, including but not limited to those expressing readily detectable proteins, such as fluorescent or luminescent proteins, or enzymes that act on substrates to produce colored, fluorescent, or luminescent substances (“detectable markers”). Other useful genes include those encoding drug resistance or providing functions that can be used to purify cells. Selection markers include the neomycin resistance gene (neo), puromycin resistance gene (puro), guanine phosphoribosyltransferase (gpt), dihydrofolate reductase (DHFR), adenosine deaminase (ada), puromycin-N-acetyltransferase (PAC), hygromycin resistance gene (hyg), multidrug resistance gene (mdr), thymidine kinase (TK), hypoxanthine-guanine phosphoribosyltransferase (HPRT), and hisD gene. Detectable markers include green fluorescent protein (GFP), blue, sapphire, yellow, red, orange, and cyan fluorescent proteins, and any variants of these. Luminescent proteins, such as luciferases (e.g., firefly luciferase or kidney luciferase), are also selected markers.

[0285] In some respects, the splitting intronic peptide systems disclosed herein may comprise two or more AAV vectors. Different AAVs may exhibit different tropisms, which refer to the preference or ability of an AAV to infect specific types of tissues or cells in an organism. The tropism of an AAV is determined at least in part by viral capsid proteins that bind to receptors on the surface of target cells. Therefore, tropism can be programmed to target one or more desired tissues (e.g., kidney tissue) by altering the sequence or structure of the capsid proteins.

[0286] To date, over 100 AAV variants have been isolated from adenovirus reservoirs or human and non-human primate tissues. AAV2, AAV3, AAV5, and AAV6 have been found in human cells, while AAV1, AAV4, AAV7, AAV8, AAV9, AAV10 (AAVrh10), AAV11, and AAV12 have been found in non-human primate samples. Genomic differences between serotypes are most concentrated in the variable region (VR) of the viral capsid, which may determine its tissue tropism. Besides the viral capsid, the tissue tropism of AAV vectors is also influenced by cell surface receptors, cellular uptake, intracellular processing, nuclear delivery of the vector genome, uncoating, and second-strand DNA conversion.

[0287] AAV1 has been reported to exhibit natural tropism in the central nervous system (CNS), pancreas, heart, retina (e.g., retinal pigment epithelium (RPE)), and muscle. AAV2 has been reported to exhibit natural tropism in neurons, vascular smooth muscle cells, hepatocytes, muscle, CNS, retina (e.g., RPE, photoreceptor cells), liver, and kidney. AAV3 has been reported to exhibit natural tropism in the retina (e.g., RPE), lung, liver, and heart. AAV4 has been reported to exhibit natural tropism in the CNS, retina (e.g., RPE), lung, and pancreas. AAV5 has been reported to exhibit natural tropism in the CNS, lung, retina (e.g., RPE, photoreceptor cells), and pancreas. AAV6 has been reported to exhibit natural tropism in the CNS, lung, liver, heart, and muscle. AAV7 has been reported to exhibit natural tropism in the liver and muscle. AAV8 has been reported to exhibit natural tropism in the CNS, heart, retina (e.g., RPE, photoreceptor cells), liver, pancreas, and muscle. AAV9 has been reported to exhibit natural tropism towards the CNS, lungs, liver, heart, and muscle. This natural tropism can be used to concentrate AAV transduction in one or more specific tissues or cell types. To restrict AAV tropism to specific tissues or cells in vivo, or to enhance transduction rates in specific tissues or cells, mosaic or chimeric AAV vectors can be developed by engineering AAV capsids to preferentially target or interact with specific cell types.

[0288] In some instances, the AAV vector is capable of transducing or preferentially transducing the kidney or kidney cells (e.g., mesangial cells, glomerular endothelial cells, parietal epithelial cells, podocytes, proximal tubule cells, loop of Henle cells, distal tubule cells, collecting duct cells, fibroblasts, pericytes, vascular smooth muscle cells, or any combination thereof). In some instances, the splitting intipeptide system transduces at least one, at least two, at least three, or at least four of the following: podocytes, mesangial cells, glomerular endothelial cells, parietal epithelial cells, proximal tubule cells, loop of Henle cells, distal tubule cells, collecting duct cells, fibroblasts, renal fibroblasts, pericytes, renal pericytes, vascular smooth muscle cells, and / or renal vascular smooth muscle cells. In a specific instance, the splitting intipeptide system transduces renal tubular epithelial cells.

[0289] For example, according to the disclosure of Provisional Patent Application No. 63 / 527,248, six AAV capsids (AAV-KP1, AAV-KP2, AAV-KP3, AAV-DJ, AAV2G9, and AAV2.7m8) were identified that transduced into the kidneys more effectively than AAV9 when administered via pyelonephrosis. This application discloses the surprising transduction of kidney cells by AAV9 and AAV-KP1 capsids when administered systemically.

[0290] The vector disclosed herein may contain a nucleic acid sequence encoding the complete AAV capsid, which may be derived from a single AAV serotype. This vector may include AAV1, AAV1_9mt100, AAV1_9mt30, AAV1_9mt76, AAV2, AAV2G9, AAV2i8, AAV2retro, AAV2R585E, AAV2R585E9_2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9AA272, AAV9AA22, AAV9W22A, AAV10, AAV11, AAV2.7m8, AAVAnc80, AAVbb.2, AAV-DJ, AAVHN1, AAVHN2, AAVHN3, AAVhu.11, AAVhu.13, AAVhu.37, AAV-KP1, AAV-KP2, AAV-KP3, AAVLK03, AAVNP40, AAVNP59, AAVPHP.B, AAVPHP.eB, AAVPHP.S, AAVpo1, AAVrh.8, AAVrh.10, AAVrh.20, AAVrh.43, and AAVShH10, or variants showing at least 70% identity with them. Sequence identity may be approximately 95%, 96%, 97%, 98%, or 99% (…). See Earley et al. , J Virol (2017) 91:e01980-16; Shen et al. , J Biol Chem (2013) 288:28814-23; Asokan et al. , Nat Biotechnl (2010) 28:79-82; Tervo et al. , Neuron (2016) 92: 372-82; Adachi et al. , Nat Commun (2014)5:3075; Dalkara et al. , Sci Transl Med (2013) 5:89ra176; Zinn et al. , Cell Rep(2015) 12:1056-1068; Gao et al. , J Virol (2004) 78:6381-88; Grimm et al. , J Virol(2008) 82:5887-11; Pekrun et al. , JCI insight (2019) 4; Lisowski et al., Nature(2014) 506:382-86; Paulk et al. , Mol Ther (2018) 26:289-303;Deverman et al. , NatBiotechnol (2016) 34:204-09; Chan et al. , Nat Neurosci (2017) 20:1172-79; Bello et al. , Gene Therapy (2009) 16:1320-28; Klimczak et al. , PLoS One (2009)4: e7467; Issa et al. Cells (2023) 12:785; U.S. Patent Application No. 63 / 527,248). In some instances, the first and / or second AAV vector comprises AAV-KP2, AAV-KP3, AAV-DJ, AAV2G9, or AAV2.7m8. In some instances, the first and / or second AAV vector is AAV9. In other aspects, the first and / or second AAV vector is AAV-KP1.

[0291] This AAV vector can transduce one or more types of kidney cells, such as cells that make up nephrons, cells in the renal interstitium, and cells that make up the renal vascular system. These cells include, but are not limited to, mesangial cells, glomerular endothelial cells, podocytes, parietal epithelial cells of Bowman's capsule, proximal tubule cells, loop of Henle cells, distal tubule cells, collecting duct cells, fibroblasts, myofibroblasts, pericytes, vascular endothelial cells, and vascular smooth muscle cells. In the method described herein, the AAV vector comprises a capsid protein comprising a capsid sequence selected from the group consisting of: AAV1, AAV1_9mt100, AAV1_9mt30, AAV1_9mt76, AAV2, AAV2G9, AAV2i8, AAV2retro, AAV2R585E, AAV2R585E9_2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9AA272, AAV9AA22, AAV9W22A, AAV10, AAV11, AAV2.7m8, AA The first and / or second AAV vectors may contain capsid proteins of VAnc80, AAVbb.2, AAV-DJ, AAVHN1, AAVHN2, AAVHN3, AAVhu.11, AAVhu.13, AAVhu.37, AAV-KP1, AAV-KP2, AAV-KP3, AAVLK03, AAVNP40, AAVNP59, AAVPHP.B, AAVPHP.eB, AAVPHP.S, AAVpo1, AAVrh.8, AAVrh.10, AAVrh.20, AAVrh.43, and AAVShH10, or variants thereof exhibiting at least 70% identity. Sequence identity may be approximately 95%, 96%, 97%, 98%, or 99%. In some instances, the first and / or second AAV vectors comprise capsid proteins derived from AAV9. In other instances, the first and / or second AAV vectors comprise capsid proteins derived from AAV-KP1.

[0292] This document discloses the use of recombinant AAV vectors for delivering cleavage proteins, such as cleavage COL4A5, into cells. If the full-length protein exceeds the packaging limits of AAV, the N-terminal and C-terminal portions of the protein are delivered into the same cell via separate AAV vectors or particles. Therefore, compositions for delivering cleavage proteins into cells (e.g., mammalian cells, human cells) are disclosed herein. The AAV particles disclosed herein may include an AAV vector (i.e., a recombinant genome of AAV) encapsulated in a viral capsid protein. Use of AAV vectors and particles is disclosed in U.S. Application No. 63 / 462,492, which is incorporated herein by reference in its entirety.

[0293] In some instances, the AAV vector comprises: (1) a heterologous nucleic acid region encoding a first or second fusion protein, (2) one or more nucleotide sequences containing a sequence (e.g., a promoter) that promotes expression of the heterologous nucleic acid region, and (3) one or more nucleic acid regions containing a sequence that promotes integration of the heterologous nucleic acid region (optionally together with one or more nucleic acid regions containing the expression-promoting sequence) into the cell genome. In some instances, the viral sequence promoting integration comprises an inverted terminal repeat (ITR) sequence.

[0294] In some instances, compositions containing AAV particles (in any form contemplated herein) further comprise a pharmaceutically acceptable carrier. In some instances, the composition is formulated in a suitable pharmaceutical solvent for administration to human or animal subjects.

[0295] This document discloses compositions comprising a first AAV vector. In some examples, the first AAV vector comprises a first signal sequence whose C-terminus is fused to a first nucleotide sequence encoding the N-terminal portion of a type IV collagen α chain, the C-terminus of which is fused to an N-intein (N-int). In some examples, the composition comprises a second AAV vector. In some examples, the second AAV vector comprises a second nucleotide sequence encoding a second signal sequence whose C-terminus is fused to a C-intein (C-int), the C-terminus of which is fused to the N-terminus of the C-terminal portion of the type IV collagen α chain. In some examples, the type IV collagen α chain is COL4A3, COL4A4, or COL4A5. In some examples, the N-terminal portion and the C-terminal portion may be linked to form a complete type IV collagen α chain.

[0296] VI. Application and Treatment Methods The splitting intipeptide system disclosed herein can be delivered to any part of the body, such as any organ (e.g., kidney, eye, and ear), any tissue, or any cell of the body, via any delivery method (e.g., systemic and / or local delivery). The splitting intipeptide system disclosed herein can also be delivered ex vivo. For example, cells can be isolated from a subject, modified or transduced with the system in vitro, and reintroduced into the subject.

[0297] In some respects, delivery may not be intentionally targeted at a specific organ, tissue, or cell. For example, systemic delivery delivers a splitting intrapeptide system through the body's circulatory system, which can reach every part of the body.

[0298] In some other respects, delivery can target one or more specific cell types, such as cells within the same tissue or organ. In some instances, such targeted delivery can be achieved through local delivery. In some other instances, such targeted delivery can be achieved through systemic delivery, with the selection or engineering of vectors that target or transduce only the intended cell type. Targeted delivery can be advantageous in terms of dose savings and reduced toxicity or side effects.

[0299] The splitting intron system disclosed herein can be administered in sufficient quantities to transduce cells of one or more desired tissues, providing adequate levels of gene transfer and expression without excessive adverse effects. Administration can be performed as a single dose, continuously, or intermittently during treatment.

[0300] This split-intipeptide system can be delivered via any route of administration (systemic or local). In some instances, the split-intipeptide system can be administered parenterally by injection, infusion, or implantation. In some instances, the system can be administered intravenously, intraventricularly, intraauricularly, intraocularly, or periocularly, orally, parenterally, subcutaneously, intramuscularly, intrapleurally, topically, or intralymphaticly; such administration can also be intra-arterial, intracardiac, subventricular, subretinal, intravitreal, intra-articular, intraparenchymal, intrarenal, or any combination thereof.

[0301] In some respects, delivery enables the first nucleic acid molecule and the second nucleic acid to be provided in any ratio, such as 10:1, 5:1, 2.5:1, 2:1, 1:1, 0.5:1, 0.25:1, 0.17:1, 0.1:1, 0.050:1, 0.025:1, 0.017:1, 0.013:1, 0.010:1, 0.005:1, 0.001:1, or a range between any two of the aforementioned values. In some instances, delivery is made such that a first adeno-associated virus (AAV) vector containing the first nucleic acid molecule and / or a second AAV vector containing the second nucleic acid molecule are provided at a ratio of 10:1, 5:1, 2.5:1, 2:1, 1:1, 0.5:1, 0.25:1, 0.17:1, 0.1:1, 0.050:1, 0.025:1, 0.017:1, 0.013:1, 0.010:1, 0.005:1, 0.001:1 or a range between any two of the aforementioned values.

[0302] Suitable forms of administration include sterile aqueous solutions or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. Dispersions can also be prepared in glycerol, liquid polyethylene glycol and mixtures thereof, and oils. Under normal storage and use conditions, these formulations may contain preservatives to prevent microbial growth. In many cases, the form is sterile and fluid to the extent that it is easy to inject. The form is also stable under manufacturing and storage conditions and resistant to contamination by microorganisms such as bacteria and fungi.

[0303] The carrier can be a solvent or dispersion medium, including, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Appropriate flowability can be maintained, for example, by using coatings (e.g., lecithin), by maintaining the desired particle size in the dispersed case, and by using surfactants. Prevention of microbial action can be achieved by various antibacterial and antifungal agents (e.g., parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc.). In some instances, isotonic agents, such as sugars or sodium chloride, are preferably included. If prolonged absorption of the composition is desired, agents that delay absorption, such as aluminum monostearate and gelatin, can be included in the composition.

[0304] For administration of aqueous solutions, the solution may be appropriately buffered if necessary, and the liquid diluent should first be isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. For example, a dose may be dissolved in 1 mL of isotonic NaCl solution and added to 1000 mL of subcutaneous infusion fluid or injected at the recommended infusion site (see, for example, Remington's Pharmaceutical Sciences, 15th edition, pp. 1035-1038 and 1570-1580). Some dosage variations will inevitably occur depending on the host's condition. The person responsible for administration will determine the appropriate dose for the individual host in any case. Sterile solutions for parenteral administration may be prepared by including an effective amount of the split integument system along with various other ingredients (as needed or desired) in a suitable solvent, followed by filtration sterilization. In some respects, pharmaceutical compositions comprise an effective amount of the split integument system disclosed herein and a pharmaceutically acceptable carrier. In other respects, the pharmaceutical composition includes an effective amount of the first nucleic acid molecule disclosed herein (optionally in an AAV vector) and a pharmaceutically acceptable carrier. In still other respects, the pharmaceutical composition includes an effective amount of the second nucleic acid molecule disclosed herein (optionally in an AAV vector) and a pharmaceutically acceptable carrier.

[0305] Pharmaceutical compositions containing AAV and pharmaceutically acceptable excipients can be produced. Such excipients include any pharmaceutical agent that does not itself induce antibody production harmful to the individual receiving the composition and can be administered without excessive toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, glycerol, and ethanol. These may include pharmaceutically acceptable salts, such as inorganic acid salts, such as hydrochloride, hydrobromide, phosphate, sulfate, etc.; and organic acid salts, such as acetate, propionate, malonate, benzoate, etc. Furthermore, excipients (such as wetting agents or emulsifiers, pH buffers, etc.) may be present in such solvents. A detailed discussion of pharmaceutically acceptable excipients is available in Remington's Pharmaceutical Sciences, 23rd Edition, Academic Press, Elsevier, (2020).

[0306] In some respects, the excipients confer protection on AAV viral particles, minimizing the loss of AAV viral particles and the loss of transduction capacity caused by formulation procedures, packaging, storage, transportation, etc. Therefore, these excipient compositions are considered to have a viral particle stabilizing effect because they provide higher AAV viral particle titers and higher levels of transduction capacity compared to their unprotected counterparts, as measured using standard assays, see, for example, published U.S. Application No. 2012 / 0219528. Thus, these compositions exhibit enhanced levels of transduction capacity and are therefore more stable than their unprotected counterparts compared to compositions lacking the specific excipients described herein.

[0307] Exemplary excipients that can be used to protect AAV virus particles from active degradation conditions include, but are not limited to, detergents, proteins (e.g., ovalbumin and bovine serum albumin), amino acids (e.g., glycine), polyols, and diols, such as, but not limited to, polyethylene glycol (PEG) of different molecular weights, such as PEG-200, PEG-400, PEG-600, PEG-1000, PEG-1450, PEG-3350, PEG-6000, PEG-8000, and any molecular weight between these values, with a preferred molecular weight of 1500 to 6000, propylene glycol (PG), and sugar alcohols (e.g., carbohydrates, preferably sorbitol). Detergents, when present, can be anionic, cationic, amphoteric, or nonionic detergents. An exemplary detergent is a nonionic detergent. A suitable type of nonionic detergent is sorbitan ester, such as polyoxyethylene sorbitan monolaurate (TWEEN®-20), polyoxyethylene sorbitan monopalmitate (TWEEN®-40), polyoxyethylene sorbitan monostearate (TWEEN®-60), polyoxyethylene sorbitan tristearate (TWEEN®-65), polyoxyethylene sorbitan monooleate (TWEEN®-80), polyoxyethylene sorbitan trioleate (TWEEN®-85), and polyoxyethylene-polyoxypropylene block copolymer (Pluronic F68), such as TWEEN®-20 and / or TWEEN®-80. These excipients are commercially available from various suppliers, such as Sigma, St. Louis, and Mo.

[0308] The amounts of various excipients present in any disclosed composition vary. For example, protein excipients (e.g., BSA, if present) may be present at a concentration of 1.0 wt.% to about 20 wt.%, preferably 10 wt.%. If an amino acid (e.g., glycine) is used in the formulation, it may be present at a concentration of about 1 wt.% to about 5 wt.%. Carbohydrates (e.g., sorbitol, if present) may be present at a concentration of about 0.1 wt.% to about 10 wt.%, for example about 0.5 wt.% to about 15 wt.%, or about 1 wt.% to about 5 wt.%. If polyethylene glycol is present, it is typically present in the order of about 2 wt.% to about 40 wt.%, for example about 10 wt.% to about 25 wt.%. If propylene glycol is used in the formulation, it is typically present at a concentration of about 2 wt.% to about 60 wt.%, for example about 5 wt.% to about 30 wt.%. If a detergent (e.g., sorbitol ester (TWEEN®)) is present, it may be present at a concentration of about 0.05 wt.% to about 5 wt.%, for example, about 0.1 wt.% to about 1 wt.%, see published U.S. Patent Application No. 2012 / 0219528. In one example, an aqueous viral particle stabilizer comprises a carbohydrate (e.g., sorbitol) at a concentration of about 0.1 wt.% to about 10 wt.%, for example, about 1 wt.% to about 5 wt.%, and a detergent (e.g., sorbitol ester (TWEEN®)) at a concentration of about 0.05 wt.% to about 5 wt.%, for example, about 0.1 wt.% to about 1 wt.%. Viral particles are typically present in the composition in an amount sufficient to provide the therapeutic effect as defined above when one or more doses are administered.

[0309] The appropriate dosage depends on factors such as the subject being treated (e.g., human or non-human primate or other mammal), the subject's age and general condition, the severity of the condition, and the method of administration of the AAV vector / virus particles. An appropriate effective dose can be readily determined by the clinician. Therefore, the effective dose will fall within a relatively wide range that can be determined through clinical trials. This method may include measuring outcomes, such as renal function. This method may include administering other agents, such as AAV vector transduction enhancers, including histone deacetylase inhibitors, proteasome inhibitors, immunosuppressants including corticosteroids, calcineurin inhibitors, and sirolimus, and agents that degrade immunoglobulins, including IdeS and IdeZ. This method may also be used in conjunction with ultrasound-targeted microbubble disruption, which enhances AAV vector transduction. This method may also include inducing lifestyle modifications in the subject.

[0310] For example, for intravenous injection, i.e., direct injection into the subject, the effective dose can be approximately 10. 5 Up to 10 16AAV virus particles, for example 10 8 Up to 10 15 The dosage is on the order of AAV viral particles. The dosage, of course, depends on transduction efficiency, promoter strength, messenger stability and its encoded protein, as well as clinical factors. The effective dose can be easily determined using a dose-response curve.

[0311] Dosage therapy can be administered via a single-dose or multiple-dose regimen to ultimately deliver the amount specified above. Furthermore, the appropriate number of doses can be administered to the subject. Therefore, for example, 10 doses can be given to the subject in a single dose. 5 Up to 10 16 One AAV virus particle, or two, four, five, six or more doses totaling, resulting in delivery of, for example, 10 5 Up to 10 16 One AAV virus particle.

[0312] In some respects, the AAV has a speed of approximately 1×10 11 To approximately 1×10 14 The dosage is administered in doses of viral genome (vg) / kg. In some instances, the AAV is administered at approximately 1×10⁻⁶. 12 Approximately 8×10 13 The AAV is administered at a dose of vg / kg. In other instances, the AAV is administered at approximately 1 × 10⁻⁶. 13 Approximately 6×10 13 The AAV is administered at a dose of vg / kg. In a specific, non-limiting example, the AAV is administered at a dose of at least about 1 × 10⁻⁶. 11 At least approximately 5×10 11 At least approximately 1×10 12 At least approximately 5×10 12 At least approximately 1×10 13 At least approximately 5×10 13 Or at least about 1×10 14 The AAV was administered at a dose of vg / kg. In other non-limiting examples, the AAV was administered at a dose not exceeding about 5 × 10⁻⁶. 11 No more than approximately 1×10 12 No more than approximately 5×10 12 No more than approximately 1×10 13 No more than approximately 5×10 13 Or no more than about 1×10 14 The AAV was administered at a dose of vg / kg. In a non-limiting example, the AAV was administered at approximately 1 × 10⁻⁶. 12 The AAV is administered at a dose of vg / kg. In a specific instance, the AAV was administered at approximately 1 × 10⁻⁶. 14The dosage is administered in viral genome (vg) / kg. The AAV can be administered in a single dose or multiple doses (e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10 doses) depending on the desired treatment outcome.

[0313] In some instances, the systems, compositions, and / or carriers disclosed herein are delivered systemically. Systemic delivery refers to the delivery of a substance (such as the split-integrant peptide system disclosed herein) such that the substance can reach various organs, tissues, and cells throughout the body of a subject, such as delivery to the subject's circulatory system. Systemic delivery can be achieved via enteral administration (absorption of the drug through the gastrointestinal tract) or parenteral administration (typically by injection, infusion, or implantation). Exemplary routes of administration include oral administration, intravenous (IV) injection or infusion, intramuscular (IM) injection, or subcutaneous (SC) injection. The split-integrant peptide system disclosed herein can be formulated for any systemic administration method and delivered systemically. In some aspects, the split-integrant peptide system is administered parenterally, such as via intravenous administration.

[0314] In some respects, systemically delivered split-intipeptide systems can achieve systemic transfection or transduction throughout the entire body of the subject. In other respects, although systemically delivered, split-intipeptide systems may exhibit a tendency to transfect or transduce only certain types of organs, tissues, or cells (e.g., kidneys), thus achieving targeted delivery. AAV tropism that can aid in targeted systemic delivery is discussed above.

[0315] In some instances, the systems, compositions, and / or carriers disclosed herein are delivered locally. Local delivery refers to the delivery of a substance (such as the split-inteptide system disclosed herein) to a specific site or local area within a subject's body. Local delivery can be used to avoid systemic absorption, thereby minimizing systemic side effects. In some instances, the split-inteptide system can be administered via direct parenchymal injection, renal vein injection, renal artery injection, renal pelvis injection, and / or retrograde transureteropelvic injection. Suitable drug forms for administration to the nasal mucosa, eyes, or ear canal include drops, ointments, and sprays. In some other aspects, local delivery is achieved by injection into a vein or artery in the target tissue or organ, such as renal vein injection and renal artery injection. In such aspects, the substance to be delivered (e.g., the split-inteptide system) may first reach the target organ and may enter target cells before circulating to other parts of the body.

[0316] In some other respects, this splitting peptide system can be locally delivered to the kidneys of a subject, as described in Provisional Patent Application No. 63 / 527,248, which is incorporated herein by reference. Pelvic injection may include surgical or percutaneous direct pelvic injection and retrograde transureteropelvic injection.

[0317] Local delivery can also leverage AAV tropism to enhance delivery to one or more target organs, tissues, or cell types. In some aspects, the splitting intipeptide systems disclosed herein can be delivered systemically or locally by combining or engineering AAV tropism to target (e.g., transfect or transduce) one or more specific organs, tissues, or cell types, such as the kidney, eye, and / or ear, with enhanced efficiency.

[0318] The systems, compositions, and methods disclosed herein are for treating subjects with Alport syndrome. In some instances, the Alport syndrome is X-linked Alport syndrome. In some instances, the Alport syndrome is autosomal Alport syndrome, such as autosomal recessive Alport syndrome or autosomal dominant Alport syndrome. In some instances, the subjects with Alport syndrome are male. In some instances, the subjects with Alport syndrome are female.

[0319] In some instances, treatment with the systems, compositions, and methods disclosed herein resulted in an improvement in renal function of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 1000%, compared to a control. In some instances, treatment with the systems, compositions, and methods disclosed herein delayed the onset of end-stage renal disease by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 1000%, compared to a control. In some instances, treatment with the systems, compositions, and methods disclosed herein, compared to a control, delays the time to dialysis by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 1000%. In some instances, treatment with the systems, compositions, and methods disclosed herein, compared to a control, delayed the time to kidney transplantation by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 1000%.In some instances, treatment with the systems, compositions, and methods disclosed herein improves life expectancy by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 100%, at least 150%, at least 200%, at least 300%, at least 400%, at least 500%, or at least 1000% compared to a control.

[0320] This method may include administering other agents to the subject. In some aspects, the subject may also be administered an effective amount of angiotensin II receptor blocker and / or angiotensin-converting enzyme inhibitor, such as candesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, valsartan, benazepril, captopril, cilazapril, enalapril, fosinopril, lisinopril, moxipril, perindopril, ramipril, quinapril, and / or landopril.

[0321] VII. Systems and Reagent Kits Systems and kits for use with the disclosed methods are also provided. In some instances, the system or kit comprises a first nucleic acid molecule encoding a fusion protein comprising an N-exopeptide of an exopeptide pair and an N-inpeptide of an inpeptide pair, for example, with a pharmaceutically acceptable carrier. In some instances, the system or kit comprises a second nucleic acid molecule encoding a fusion protein comprising a C-inpeptide of the inpeptide pair and a C-exopeptide of the exopeptide pair, for example, with a pharmaceutically acceptable carrier. In some instances, the system or kit comprises a first AAV carrier (containing the first nucleic acid molecule) and / or a second AAV carrier (containing the second nucleic acid molecule), for example, with a pharmaceutically acceptable carrier. The first nucleic acid molecule, the second nucleic acid molecule, the first AAV carrier, and / or the second AAV carrier may be provided in any suitable ratio, for example, the molar ratio of the first nucleic acid molecule to the second nucleic acid molecule is from about 1:1 to about 0.010:1.

[0322] This splitting inteptide system can provide the first nucleic acid molecule and the second nucleic acid in any ratio, such as 10:1, 5:1, 2.5:1, 2:1, 1:1, 0.5:1, 0.25:1, 0.17:1, 0.1:1, 0.050:1, 0.025:1, 0.017:1, 0.013:1, 0.010:1, 0.005:1, 0.001:1, or any range between two of the aforementioned values. In some instances, the system comprises a first adeno-associated virus (AAV) vector (containing the first nucleic acid molecule) and / or a second AAV vector (containing the second nucleic acid molecule). The first AAV carrier and the second AAV carrier can be provided in any ratio, such as 10:1, 5:1, 2.5:1, 2:1, 1:1, 0.5:1, 0.25:1, 0.17:1, 0.1:1, 0.050:1, 0.025:1, 0.017:1, 0.013:1, 0.010:1, 0.005:1, 0.001:1, or any range between two of the aforementioned values.

[0323] In some instances, the first nucleic acid molecule, the second nucleic acid molecule, the first AAV vector, and / or the second AAV vector are provided in a single container. In some instances, one or more of the first nucleic acid molecule, the second nucleic acid molecule, the first AAV vector, and / or the second AAV vector are provided in a separate container suitable for combination prior to administration to a subject. In some instances, the first nucleic acid molecule, the second nucleic acid molecule, the first AAV vector, and / or the second AAV vector are provided in a separate container suitable for simultaneous or subsequent administration to a subject. This container can be any suitable container, such as a syringe, IV bag, ampoule, dropper, container, or vial.

[0324] In some instances, the kit contains angiotensin II receptor blockers and / or angiotensin-converting enzyme inhibitors, such as candesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, valsartan, benazepril, captopril, cilazapril, enalapril, fosinopril, lisinopril, moxipril, perindopril, ramipril, quinapril, and / or landopril. These may be provided in a container with the first nucleic acid molecule, the second nucleic acid molecule, the first AAV vector, and / or the second AAV vector, or they may be provided in a separate container suitable for combination with other containers, administered simultaneously or subsequently to the subject.

[0325] In some instances, the kit contains parvovirus-dependent virus particles, parvovirus subfamily virus particles, parvoviridae virus particles, or AAV particles. In some instances, the kit contains parvovirus-dependent virus vectors, parvovirus subfamily virus vectors, parvoviridae virus vectors, or AAV particles.

[0326] VIII. Sequence Identity For sequence comparisons of amino acids or nucleic acids, a reference sequence is typically used, and the sequence to be tested is compared to it. When using a sequence comparison algorithm, the sequence to be tested and the reference sequence are input into the computer. If necessary, subsequence coordinates and sequence algorithm program parameters are specified. Default program parameters are used. The best alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482, 1981, the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443, 1970, and the similarity search method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444, 1988, computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, for example, Current Protocols in Molecular Biology (Ausubel et al., eds., 1995 ed.)).

[0327] A useful example of an algorithm is PILEUP. PILEUP uses a simplified form of the progressive alignment method described by Feng & Doolittle, J. Mol. Evol. 35:351-360, 1987. The method used is similar to that described by Higgins & Sharp, CABIOS 5:151-153, 1989. Using PILEUP, a reference sequence is compared with other test sequences to determine the percentage of sequence identity using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted terminal gaps. PILEUP is available from GCG sequence analysis software packages, such as version 7.0 (Devereaux). et al. , Nuc. Acids Res. 12:387-395, 1984).

[0328] Another example of an algorithm suitable for determining sequence identity and sequence similarity percentages is the BLAST and BLAST2.0 algorithms, described in Altschul. et al., J. Mol. Biol. 215:403-410, 1990 and Altschul et al. Nucleic Acids Res. 25:3389-3402, 1977. Software for BLAST analysis is publicly available from the National Center for Biotechnology Information (ncbi.nlm.nih.gov). The BLASTN program (for nucleotide sequences) defaults to a word length (W) of 11, alignment (B) of 50, expected value (E) of 10, M=5, N=-4, and comparison of two strands. The BLASTP program (for amino acid sequences) defaults to a word length (W) of 3, expected value (E) of 10, and a BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915, 1989).

[0329] IX. Alternative Implementation Schemes Article 1. A splitting intipeptide system, comprising: (i) A first nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, an N-exponential peptide and an N-intipeptide, wherein the N-exponential peptide comprises a first signal sequence at the N-terminus of the N-terminal portion of the type IV collagen α chain; and (ii) A second nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, a second signal sequence, a C-inteptide of the inteptide pair, and a C-extensive peptide of the extensive peptide pair, wherein the C-extensive peptide comprises the C-terminal portion of the type IV collagen α chain; and wherein The α chain of this type IV collagen is COL4A5; The N-terminal and C-terminal portions of this type IV collagen α chain are together contained within the sequence of type IV collagen α chains that separate at the cleavage point; and When the first and second nucleic acid molecules are expressed in mammalian cells, the N-exopeptide and C-exopeptide are spliced ​​together to form a mature type IV collagen α chain.

[0330] Article 2. The splitting intipeptide system according to Article 1 comprises: (i) A first adeno-associated virus (AAV) vector containing the first nucleic acid molecule; and (ii) A second AAV vector containing the second nucleic acid molecule.

[0331] Article 3. The splitting intipeptide system according to Article 2, wherein the first AAV vector and / or the second AAV vector is AAV9.

[0332] Article 4. The splitting intipeptide system according to Article 2, wherein the first AAV carrier and / or the second AAV carrier is AAV-KP1.

[0333] Article 5. The splitting intipeptide system according to Article 2, wherein the first AAV vector and / or the second AAV vector is AAV1, AAV1_9mt100, AAV1_9mt30, AAV1_9mt76, AAV2, AAV2G9, AAV2i8, AAV2retro, AAV2R585E, AAV2R585E9_2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9AA272, AAV9AA22, AAV9W22A, AAV10, AAV11, AA V2.7m8, AAVAnc80, AAVbb.2, AAV-DJ, AAVHN1, AAVHN2, AAVHN3, AAVhu.11, AAVhu.13, AAVhu.37, AAV-KP1, AAV-KP2, AAV-KP3, AAVLK03, AAVNP40, AAVNP59, AAVPHP.B, AAVPHP.eB, AAVPHP.S, AAVpo1, AAVrh.8, AAVrh.10, AAVrh.20, AAVrh.43, or AAVShH10.

[0334] Article 6. A splitting inpeptide system according to any one of Articles 1-5, wherein the inpeptide pair is Npu DnaE contains peptide pairs.

[0335] Article 7. The split integument system according to Article 6, wherein the N-integument comprises the amino acid sequence of SEQ ID NO: 26 or an amino acid sequence having at least 95% identity with it; and The C-integral peptide contains the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence that is at least 95% identical to it.

[0336] Article 8. A split intein system according to any one of Articles 1-7, wherein the first signal sequence, the N-terminal portion of the type IV collagen α chain, and the N-intein are directly fused.

[0337] Article 9. A split intein system according to any one of Articles 1-8, wherein the second signal sequence, the C-intein, and the C-terminal portion of the type IV collagen α chain are directly fused.

[0338] Article 10. A splitting intipeptide system according to any one of Articles 1-9, wherein the splitting intipeptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 1:1 to about 0.010:1.

[0339] Article 11. The splitting inteptide system according to Article 10, wherein the splitting inteptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 0.017:1 to about 0.010:1.

[0340] Article 12. A splitting inteptide system according to any one of Articles 1-11, wherein the splitting point is located within the collagen domain of the type IV collagen α chain.

[0341] Article 13. A splitting intipeptide system according to any one of Articles 1-12, wherein the first signal sequence and / or the second signal sequence is a collagen signal sequence or a chymotrypsin signal sequence.

[0342] Article 14. The splitting intipeptide system according to Article 13, wherein the first signal sequence and the second signal sequence are different.

[0343] Article 15. A splitting intipeptide system according to Article 13 or 14, wherein the collagen signal sequence comprises SEQ ID NO: 4, and / or wherein the chymotrypsin signal sequence comprises SEQ ID NO: 5.

[0344] Article 16. A splitting intipeptide system according to any one of Articles 1-15, wherein the type IV collagen α chain comprises an amino acid sequence of any one of SEQ ID NO: 15-25 or an amino acid sequence having at least 95% identity with it.

[0345] Article 17. The splitting intipeptide system according to Article 16, wherein the type IV collagen α chain comprises the amino acid sequence of SEQ ID NO: 15 or an amino acid sequence having at least 95% identity with it.

[0346] Article 18. A splitting intipeptide system according to Article 16 or 17, wherein the splitting point is located at positions 697 to 1488 relative to SEQ ID NO: 15.

[0347] Article 19a. A splitting intipeptide system according to any one of Articles 16-18, wherein: (a) The N-terminal portion contains amino acids 1-450 of the type IV collagen α chain, and the C-terminal portion contains amino acids 451 to 1685 of the type IV collagen α chain (SP1). (b) The N-terminal portion contains amino acids 1-696 of the type IV collagen α chain, and the C-terminal portion contains amino acids 697 to 1685 of the type IV collagen α chain (SP2). (c) The N-terminal portion contains amino acids 1-863 of the type IV collagen α chain, and the C-terminal portion contains amino acids 864 to 1685 of the type IV collagen α chain (SP4). (d) The N-terminal portion contains amino acids 1-878 of the type IV collagen α chain, and the C-terminal portion contains amino acids 879 to 1685 of the type IV collagen α chain (SP5). (e) The N-terminal portion contains amino acids 1-941 of the type IV collagen α chain, and the C-terminal portion contains amino acids 942 to 1685 of the type IV collagen α chain (SP7). (f) The N-terminal portion contains amino acids 1-977 of the type IV collagen α chain, and the C-terminal portion contains amino acids 978 to 1685 of the type IV collagen α chain (SP9). (g) The N-terminal portion contains amino acids 1–1070 of the type IV collagen α chain, and the C-terminal portion contains amino acids 1071 to 1685 of the type IV collagen α chain (SP11); or (h) The N-terminal portion contains amino acids 1–1135 of the type IV collagen α chain, and the C-terminal portion contains amino acids 1136–1685 (SP12) of the type IV collagen α chain; and The amino acid number is relative to SEQ ID NO: 15.

[0348] Article 19b. A splitting intipeptide system according to any one of Articles 16-18, wherein: (a) The N-terminal portion contains amino acids 27–696 of the type IV collagen α chain, and the C-terminal portion contains amino acids 697–1685 of the type IV collagen α chain (SP2). (b) The N-terminal portion contains amino acids 27–878 of the type IV collagen α chain, and the C-terminal portion contains amino acids 879–1685 of the type IV collagen α chain (SP5). (c) The N-terminal portion contains amino acids 27–888 of the type IV collagen α chain, and the C-terminal portion contains amino acids 889–1685 of the type IV collagen α chain (SP20). (d) The N-terminal portion contains amino acids 27–915 of the type IV collagen α chain, and the C-terminal portion contains amino acids 916–1685 of the type IV collagen α chain (SP6). (e) The N-terminal portion contains amino acids 27–941 of the type IV collagen α chain, and the C-terminal portion contains amino acids 942–1685 of the type IV collagen α chain (SP7). (f) The N-terminal portion contains amino acids 27–961 of the type IV collagen α chain, and the C-terminal portion contains amino acids 962–1685 of the type IV collagen α chain (SP8). (g) The N-terminal portion contains amino acids 27–977 of the type IV collagen α chain, and the C-terminal portion contains amino acids 978–1685 of the type IV collagen α chain (SP9). (h) The N-terminal portion contains amino acids 27–995 of the type IV collagen α chain, and the C-terminal portion contains amino acids 996–1685 of the type IV collagen α chain (SP10). (i) The N-terminal portion contains amino acids 27–1070 of the type IV collagen α chain, and the C-terminal portion contains amino acids 1071–1685 of the type IV collagen α chain (SP11). (j) The N-terminal portion contains amino acids 27–1098 of the type IV collagen α chain, and the C-terminal portion contains amino acids 1099–1685 of the type IV collagen α chain (SP27); or (k) The N-terminal portion contains amino acids 27–1135 of the type IV collagen α chain, and the C-terminal portion contains amino acids 1136–1685 of the type IV collagen α chain (SP12); and The amino acid number is relative to SEQ ID NO: 15.

[0349] Article 20a. A splitting intipeptide system according to any one of Articles 16-19, wherein: (a) The N-terminal portion contains DEI at its C-terminus, and the C-terminal portion contains CEPG (SEQ ID NO:230) (SP1) at its N-terminus. (b) The N-terminal portion contains IPG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP2) at its N-terminus. (c) The N-terminal portion contains ERG at its C-terminus, and the C-terminal portion contains SPGI (SEQ ID NO:231) (SP4) at its N-terminus. (d) The N-terminal portion contains PPG at its C-terminus, and the C-terminal portion contains SPGL (SEQ ID NO:222) (SP5) at its N-terminus. (e) The N-terminal portion contains EKG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP7) at its N-terminus. (f) The N-terminal portion contains PGV at its C-terminus, and the C-terminal portion contains SGPK (SEQ ID NO:225) (SP9) at its N-terminus. (g) The N-terminal portion contains a PGI at its C-terminus, and the C-terminal portion contains a SSIG (SEQ ID NO:227) (SP11) at its N-terminus; or (h) The N-terminal portion contains KGI at its C-terminus, and the C-terminal portion contains SGPP (SEQ ID NO:229) (SP12) at its N-terminus.

[0350] Article 20b. A splitting intipeptide system according to any one of Articles 16-19, wherein: (a) The N-terminal portion contains IPG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP2) at its N-terminus. (b) The N-terminal portion contains PPG at its C-terminus, and the C-terminal portion contains SPGL (SEQ ID NO:222) (SP5) at its N-terminus. (c) The N-terminal portion contains AGA at its C-terminus, and the C-terminal portion contains SGFP (SEQ ID NO:223) (SP20) at its N-terminus. (d) The N-terminal portion contains PGR at its C-terminus, and the C-terminal portion contains SGVP (SEQ ID NO:224) (SP6) at its N-terminus. (e) The N-terminal portion contains EKG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP7) at its N-terminus. (f) The N-terminal portion contains LLG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP8) at its N-terminus. (g) The N-terminal portion contains PGV at its C-terminus, and the C-terminal portion contains SGPK (SEQ ID NO:225) (SP9) at its N-terminus. (h) The N-terminal portion contains PGL at its C-terminus, and the C-terminal portion contains SGQP (SEQ ID NO:226) (SP10) at its N-terminus. (i) The N-terminal portion contains PGI at its C-terminus, and the C-terminal portion contains SSIG (SEQ ID NO:227) (SP11) at its N-terminus. (j) The N-terminal portion contains IKG at its C-terminus, and the C-terminal portion contains SVGD (SEQ ID NO:228) (SP27) at its N-terminus; or (k) The N-terminal portion contains KGI at its C-terminus, and the C-terminal portion contains SGPP (SEQ ID NO:229) (SP12) at its N-terminus.

[0351] Article 21a. A splitting intipeptide system according to any one of Articles 1-20, wherein the N-terminal portion does not contain a collagen signal sequence.

[0352] Section 21b. A splitting intipeptide system according to any one of Sections 1-20, wherein the first nucleic acid molecule and / or the second nucleic acid molecule are operatively linked to a CAG promoter.

[0353] Article 22. A splitting inteptide system according to any one of Articles 1-21, wherein the first nucleic acid molecule and / or the second nucleic acid molecule further comprises a marmot hepatitis virus post-transcriptional regulatory element; and / or The first nucleic acid molecule and / or the second nucleic acid molecule are operatively linked to the posttranscriptional regulatory element of the marmot hepatitis virus.

[0354] Article 23. A splitting intipeptide system according to any one of Articles 1-22, wherein the first nucleic acid molecule and / or the second nucleic acid molecule further encodes an SV40 polyadenylation signal.

[0355] Article 24. A pharmaceutical composition comprising an effective amount of any one of Articles 1-23, a cleavage inteptide system, and a pharmaceutically acceptable carrier, wherein the cleavage inteptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 1:1 to about 0.010:1.

[0356] Article 25. A splitting intipeptide system, comprising: (i) A first adeno-associated virus (AAV) vector comprising a first nucleic acid molecule operatively linked to a CAG promoter, wherein the first nucleic acid molecule encodes an N-external peptide and an N-external peptide that sequentially comprises external peptide pairs from N-terminus to C-terminus. Npu A fusion protein of the N-inpeptide of the DnaE inteptide pair, wherein the N-external peptide contains a collagen signal sequence located at the N-terminus of the N-terminal portion of the type IV collagen α5 (COL4A5) chain, wherein the collagen signal sequence, the N-terminal portion of the COL4A5 chain and the N-inpeptide are directly fused. (ii) A second AAV vector comprising a second nucleic acid molecule operatively linked to a CAG promoter, wherein the second nucleic acid molecule encodes a signal sequence sequentially comprising, from the N-terminus to the C-terminus, the... Npu A fusion protein of the C-inpeptide of the DnaE inteptide pair and the C-external peptide of the external peptide pair, wherein the C-external peptide comprises the C-terminal portion of the COL4A5 chain, wherein the signal sequence, the C-inpeptide, and the C-terminal portion of the COL4A5 chain are directly fused; and wherein... The N-terminal and C-terminal portions of the COL4A5 chain are together contained within the sequence of the COL4A5 chain separated at the split point; and When the first and second nucleic acid molecules are expressed in mammalian cells, the N-exopeptide and C-exopeptide are spliced ​​together to form the mature COL4A5 chain.

[0357] Section 26a. The splitting intipeptide system according to Section 25, wherein: (a) The N-terminal portion contains amino acids 1 to 450 of the COL4A5 chain, and the C-terminal portion contains amino acids 451 to 1685 of the COL4A5 chain (SP1). (b) The N-terminal portion contains amino acids 1 to 696 of the COL4A5 chain, and the C-terminal portion contains amino acids 697 to 1685 of the COL4A5 chain (SP2). (c) The N-terminal portion contains amino acids 1 to 863 of the COL4A5 chain, and the C-terminal portion contains amino acids 864 to 1685 of the COL4A5 chain (SP4). (d) The N-terminal portion contains amino acids 1 to 878 of the COL4A5 chain, and the C-terminal portion contains amino acids 879 to 1685 of the COL4A5 chain (SP5). (e) The N-terminal portion contains amino acids 1 to 941 of the COL4A5 chain, and the C-terminal portion contains amino acids 942 to 1685 of the COL4A5 chain (SP7). (f) The N-terminal portion contains amino acids 1 to 977 of the COL4A5 chain, and the C-terminal portion contains amino acids 978 to 1685 of the COL4A5 chain (SP9). (g) The N-terminal portion contains amino acids 1–1070 of the COL4A5 chain, and the C-terminal portion contains amino acids 1071–1685 of the COL4A5 chain (SP11); or (h) The N-terminal portion contains amino acids 1–1135 of the COL4A5 chain, and the C-terminal portion contains amino acids 1136–1685 (SP12) of the COL4A5 chain; and The amino acid number is relative to SEQ ID NO: 15.

[0358] Section 26b. The splitting intipeptide system according to Section 25, wherein: (a) The N-terminal portion contains amino acids 27–696 of the COL4A5 chain, and the C-terminal portion contains amino acids 697–1685 of the COL4A5 chain (SP2). (b) The N-terminal portion contains amino acids 27–878 of the COL4A5 chain, and the C-terminal portion contains amino acids 879–1685 of the COL4A5 chain (SP5). (c) The N-terminal portion contains amino acids 27–888 of the COL4A5 chain, and the C-terminal portion contains amino acids 889–1685 of the COL4A5 chain (SP20). (d) The N-terminal portion contains amino acids 27–915 of the COL4A5 chain, and the C-terminal portion contains amino acids 916–1685 of the COL4A5 chain (SP6). (e) The N-terminal portion contains amino acids 27–941 of the COL4A5 chain, and the C-terminal portion contains amino acids 942–1685 of the COL4A5 chain (SP7). (f) The N-terminal portion contains amino acids 27–961 of the COL4A5 chain, and the C-terminal portion contains amino acids 962–1685 of the COL4A5 chain (SP8). (g) The N-terminal portion contains amino acids 27–977 of the COL4A5 chain, and the C-terminal portion contains amino acids 978–1685 of the COL4A5 chain (SP9). (h) The N-terminal portion contains amino acids 27–995 of the COL4A5 chain, and the C-terminal portion contains amino acids 996–1685 of the COL4A5 chain (SP10). (i) The N-terminal portion contains amino acids 27–1070 of the COL4A5 chain, and the C-terminal portion contains amino acids 1071–1685 of the COL4A5 chain (SP11). (j) The N-terminal portion contains amino acids 27–1098 of the COL4A5 chain, and the C-terminal portion contains amino acids 1099–1685 of the COL4A5 chain (SP27); or (k) The N-terminal portion contains amino acids 27–1135 of the COL4A5 chain, and the C-terminal portion contains amino acids 1136–1685 of the COL4A5 chain (SP12); and The amino acid number is relative to SEQ ID NO: 15.

[0359] Section 27a. A splitting intipeptide system according to Section 25 or 26, wherein: (a) The N-terminal portion contains DEI at its C-terminus, and the C-terminal portion contains CEPG (SEQ ID NO:230) (SP1) at its N-terminus. (b) The N-terminal portion contains IPG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP2) at its N-terminus. (c) The N-terminal portion contains ERG at its C-terminus, and the C-terminal portion contains SPGI (SEQ ID NO:231) (SP4) at its N-terminus. (d) The N-terminal portion contains PPG at its C-terminus, and the C-terminal portion contains SPGL (SEQ ID NO:222) (SP5) at its N-terminus. (e) The N-terminal portion contains EKG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP7) at its N-terminus. (f) The N-terminal portion contains PGV at its C-terminus, and the C-terminal portion contains SGPK (SEQ ID NO:225) (SP9) at its N-terminus. (g) The N-terminal portion contains a PGI at its C-terminus, and the C-terminal portion contains a SSIG (SEQ ID NO:227) (SP11) at its N-terminus; or (h) The N-terminal portion contains KGI at its C-terminus, and the C-terminal portion contains SGPP (SEQ ID NO:229) (SP12) at its N-terminus.

[0360] Section 27b. A splitting intipeptide system according to Section 25 or 26, wherein: (a) The N-terminal portion contains IPG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP2) at its N-terminus. (b) The N-terminal portion contains PPG at its C-terminus, and the C-terminal portion contains SPGL (SEQ ID NO:222) (SP5) at its N-terminus. (c) The N-terminal portion contains AGA at its C-terminus, and the C-terminal portion contains SGFP (SEQ ID NO:223) (SP20) at its N-terminus. (d) The N-terminal portion contains PGR at its C-terminus, and the C-terminal portion contains SGVP (SEQ ID NO:224) (SP6) at its N-terminus. (e) The N-terminal portion contains EKG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP7) at its N-terminus. (f) The N-terminal portion contains LLG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP8) at its N-terminus. (g) The N-terminal portion contains PGV at its C-terminus, and the C-terminal portion contains SGPK (SEQ ID NO:225) (SP9) at its N-terminus. (h) The N-terminal portion contains PGL at its C-terminus, and the C-terminal portion contains SGQP (SEQ ID NO:226) (SP10) at its N-terminus. (i) The N-terminal portion contains PGI at its C-terminus, and the C-terminal portion contains SSIG (SEQ ID NO:227) (SP11) at its N-terminus. (j) The N-terminal portion contains IKG at its C-terminus, and the C-terminal portion contains SVGD (SEQ ID NO:228) (SP27) at its N-terminus; or (k) The N-terminal portion contains KGI at its C-terminus, and the C-terminal portion contains SGPP (SEQ ID NO:229) (SP12) at its N-terminus.

[0361] Article 28. A pharmaceutical composition comprising an effective amount of any one of Articles 25-27 of the cleaved intipeptide system and a pharmaceutically acceptable carrier.

[0362] Article 29. A method for treating a subject with Alport syndrome, comprising administering to the subject an effective amount of any one of Articles 1-23 or 25-27 of a split inteptide system, or a pharmaceutical composition described in Article 24 or 28, thereby treating the subject with Alport syndrome.

[0363] Article 30. The method according to Article 29 includes delivering the split intipeptide system to the kidney of the subject.

[0364] Article 31. The method according to Article 30, wherein delivery of the split intipeptide system to the subject's kidney comprises systemic administration.

[0365] Article 32. The method described in Article 31, wherein the systemic administration includes systemic injection or systemic infusion.

[0366] Article 33. The method according to Article 30 or Article 32, wherein delivery of the split intipeptide system to the kidney of the subject comprises local delivery of the split intipeptide system to the kidney of the subject.

[0367] Article 34. The method according to Article 33, wherein the local delivery of the split intipeptide system to the kidney of the subject includes direct parenchymal injection, renal vein injection and / or renal artery injection.

[0368] Article 35. The method according to Article 33, wherein the local delivery of the splitting intima-peptide system to the kidney of the subject comprises direct pyelonephrosis or retrograde transureteropyelosis.

[0369] Article 36. The method according to any one of Articles 29-35, wherein the dividing intipeptide system transduces at least one of mesangial cells, glomerular endothelial cells, parietal epithelial cells, podocytes, proximal tubule cells, loop of Henle cells, distal tubule cells, collecting duct cells, fibroblasts, pericytes, or vascular smooth muscle cells.

[0370] Article 37. The method according to any one of Articles 29-36, wherein the method: a) Improved the subject's renal function; b) Delay the onset of end-stage renal disease in the subject; c) Delay the time when the subject receives dialysis; d) Delay the subject's kidney transplantation; and / or e) Improve the subject's life expectancy.

[0371] Article 38. The method according to any one of Articles 29-37, wherein the Alport syndrome is X-linked Alport syndrome.

[0372] Article 39. The method according to any one of Articles 29-38, wherein the method further comprises administering an effective amount of angiotensin II receptor blocker (ARB) and / or angiotensin-converting enzyme inhibitor; The ARB includes candesartan, captopril, iprosartan, irbesartan, losartan, moxipril, olmesartan, telmisartan, and / or valsartan; and The angiotensin-converting enzyme inhibitors include benazepril, cilazapril, enalapril, fosinopril, lisinopril, perindopril, ramipril, quinapril, and / or landopril.

[0373] Example The following embodiments are provided to illustrate certain features of certain aspects of this disclosure, but the scope of the claims should not be limited to these illustrated features.

[0374] Example 1: Materials and Methods Support Vector Machine Model As previously reported by Apgar et al. (Apgar et al. , PLoS One 7, e37355 (2012)), a support vector machine (VSM) similarity prediction model was established. Using InBase and the standards adopted by Apgar et al., 188 unique exopeptides were identified, and protein sequences were obtained from GenBank (Perler). et al. , Nucleic Acids Res 30, 383-384 (2002). Seven amino acid sequences, termed "splicing cassettes," were extracted, containing XXX[C / S / T]XXX from splicing sites found in 188 native exopeptide splicing sites, where X represents any amino acid residue and C / S / T represents a conserved amino acid found at position +1 of the C-exopeptide. These were used as true positive exopeptide splicing sites. For the true negative splicing cassette control, three XXX[C / S / T]XXX sequences were randomly extracted from each of the 188 exopeptide sequences, excluding true splicing cassettes and any duplicate selections, generating a total of 188 × 3 = 564 unique true negatives. A total of 188 + 564 = 752 labeled data points were used as the training set, and an SVM model (Perler) was trained using Python's scikit-learn SVM (with a linear kernel and a cost factor of 3) as described. et al. , Nucleic Acids Res 30, 383-384 (2002)). For each true positive and negative splice site box, the model was trained 25 times using leave-one-out cross-validation with different random seeds. Then, for each box, the average of the 25 SVM scores obtained by the “predict_proba” method was determined. The SVM model demonstrated predictive power with an area under the receiver operating characteristic (ROC) curve of 0.881 ( ). Figure 2The most optimal true or false binary clarification threshold for maximizing Youden's J was determined to be 0.305. At this threshold, the confusion matrix shows that the sensitivity, specificity, and overall accuracy of the SVM model for similarity prediction are 0.761, 0.904, and 0.868, respectively. Figure 3 ).

[0375] Design of the COL4A5 integrity construct The CAG-WPRE3-SV40pA sequence was constructed from the Addgene plasmid pAAV-CAG-tdTomato (Addgene 59462). Using this plasmid as starting material, CAG-WPRE3-SV40pA (SEQ ID NO: 2) and CAG-SV40pA (SEQ ID NO: 3) plasmids were created by incorporating the WPRE3 sequence. (Choi) et al. , Mol Brain 7, 17 (2014) SEQ ID NO: 1-3 was incorporated between 130-bp AAV inverted terminal repeat (ITR) sequences in the AAV vector plasmid backbone (Addgene 59462).

[0376] The 26-amino acid-long natural signal sequence of COL4A5 (MKLRGVSLAAGLFLLALSLWGQPAEA (SEQ ID NO: 4)) or the 18-amino acid-long human chymotrypsin signal sequence (MAFLWLLSCWALLGTTFG (SEQ ID NO: 5)) was added to the N-terminus of the C half of COL4A5. Figure 6A As a control, a COL4A5 C hemipole construct without any signal peptide was created. Figure 6A All constructs were tagged with a 22-amino-acid-long FLAG tag (DYKDHDGDYKDHDIDYKDDDDK (SEQ ID NO: 6)) or a human influenza virus hemagglutinin tag (YPYDVPDYA (SEQ ID NO: 7)). For each split point (SP), the expected length of the splitting intipeptide double AAV-CAG-Col4A5 vector genome (including the two 145-nucleotide-long ITRs at both ends) with or without WPRE or WPRE3 is summarized in Figure 7 middle.

[0377] In vitro evaluation of protein trans-splicing using HEK293 cells HEK293 cells were cultured at 5 × 10⁻⁶. 5Cells were seeded at a density of 10 cells / well in 6-well plates and incubated at 37°C and 5% CO2. Twenty-four hours after seeding, cells were transfected with 3 μg of plasmid DNA using lipofectamine 2000 (11668027, Invitrogen) and Opti-MEM (31985088, Gibco) according to the manufacturer's instructions. Forty-eight hours after transfection, cells were washed with ice-cold PBS, followed by immersion in a solution supplemented with 0.5 μg of plasmid DNA. TM Lysis was performed using a lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, and 1% Triton X-100, pH 7.5) for the Mini protease inhibitor mixture (11836170001, Roche). Lysis was carried out on ice for 30 min. After lysis, the lysate was centrifuged at 16000×g and debris was removed. Total cell lysate was collected, mixed with sample buffer, and denatured at 60 °C for 20 min. The protein concentration of total cell lysate was determined using a DC protein assay kit (Bio-Rad, Hercules, CA). For Western blot analysis, cell lysates containing 100 μg of cellular protein were separated by SDS-polyacrylamide gel electrophoresis (PAGE) using a 6% gel, and then transferred to a polyvinylidene fluoride (PVDF) membrane using a Power Blotter semi-dry transfer system (Invitrogen). PVDF membranes were probed with mouse monoclonal anti-FLAG M2 antibody (F1804, Sigma-Aldrich) followed by incubation with horseradish peroxidase-conjugated anti-mouse IgG antibody (62-6520, Invitrogen) for signal detection. Signals from the PVDF blots were analyzed using Amersham ImageQuant. TM Visualization was performed using an 800 Western blot imaging system (Cytiva). An anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) antibody was used as a loading control to detect the amount of GAPDH, ensuring consistent protein loading amounts across samples.

[0378] Human podocyte experiment Differentiated human podocytes were divided into groups of 4 × 10⁻⁶. 5 Cells were seeded at a density of 10 cells / well in 6-well plates and incubated at 37°C and 5% CO2. Twenty-four hours after seeding, the culture medium was replaced with fresh medium, and incubated with 10... 5The multiple of infection (MOI) was determined by infecting podocytes with AAV-KP1 vectors expressing the cleavage intipeptide COL4A5 protein (AAV-KP1-CAG-SP2-Col4a5-Nint-FLAG-WPRE and AAV-KP1-CAG-nativeSS-Cint-SP2-Col4A5-HA-noWPRE) or tdTomato (AAV-KP1-CAG-tdTomato). Seventy-two hours post-infection, the culture medium was replaced with fresh medium. These AAV vectors were transfected using an adenovirus-free three-plasmid transfection method (Matsushita). et al. , Gene Ther 5, 938-945 (1998) were generated in HEK293 cells using the following AAV vector plasmids: pAAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE, pAAV-CAG-nativeSS-Cint-SP2-Col4A5-HA-noWPRE, and pAAV-CAG-tdTomato (Addgene59462). The resulting AAV vectors were then purified by two rounds of cesium chloride (CsCl) density gradient ultracentrifugation followed by dialysis, as previously described (Burton). et al. , Proc Natl Acad Sci USA 96, 12725-12730 (1999)). The titer of the purified AAV vector was determined by quantitative dot blot analysis (Powers). et al. , J Vis Exp (2018) . Five days post-infection, 1 mL of culture medium was collected and concentrated to 100 μL using an Amicon ultracentrifuge filter (UFC8010, Millipore) for Western blot analysis. For Western blot analysis, 20 μL of concentrated culture medium was loaded onto a 7.5% polyacrylamide gel, separated by SDS-PAGE, and then transferred to a polyvinylidene fluoride (PVDF) membrane using a Power Blotter semi-dry transfer system (Invitrogen). The PVDF membrane was detected with rabbit monoclonal anti-HA antibody (3724, Cell Signaling) and then incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibody (65-6120, Invitrogen). The signal from the PVDF blot was analyzed using Amersham ImageQuant. TM Visualization was performed using the 800 Western Imprint Imaging System (Cytiva).

[0379] Test C half ratioHEK293 cells were transfected as previously described. The following ratios of pAAV-CAG-SP2-Col4a5-Nint-FLAG-WPRE and pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-WPRE were tested: 1:1, 0.050:1, 0.025:1, 0.017:1, 0.013:1, 0.010:1, 0.005:1, and 0.001:1. Transfection was performed in 6-well plates using a total of 3 μg of plasmid DNA containing the two plasmids at the specified ratios. Transfected cells were harvested 48 hours post-transfection, and cell lysates containing 100 μg of cellular proteins were separated by SDS-PAGE using a 6% gel, followed by transfer to a PVDF membrane. The membrane was then probed with either mouse monoclonal anti-FLAG M2 antibody or rabbit polyclonal anti-human COL4A5 H53 antibody.

[0380] Evaluate the functional feasibility of COL4A5 splice site candidates and identify the splice sites. HEK293 cells were fed at a rate of 1×10⁻⁶. 6 Cells were seeded at a density of 10 cells / well in 6-well plates and incubated at 37°C and 5% CO2. After 24 hours of incubation, cells were transfected with 3 μg of plasmid DNA using lipofectamine 2000 (11668027, Invitrogen) and Opti-MEM® (31985088, Gibco) according to the manufacturer's instructions. Forty-eight hours after transfection, cells were washed with ice-cold PBS, followed by immersion in a solution supplemented with Opti-MEM®. TM Lysis was performed using lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA, and 1% Triton X-100, pH 7.5) for the Mini protease inhibitor mixture (11836170001, Roche). Lysis was carried out on ice for 30 min. After lysis, the lysate was centrifuged at 16000×g and debris was removed. Total cell lysate was collected, mixed with sample buffer, and denatured at 60 °C for 20 min. For Western blot analysis, total cell lysate was separated by SDS-PAGE using a 6% gel and transferred to a PVDF membrane using a Power Blotter semi-dry transfer system (Invitrogen). The PVDF membrane was probed with mouse monoclonal anti-FLAG M2 antibody or rabbit polyclonal anti-human COL4A5 H53 antibody.

[0381] Effect of splitting point on the steady-state expression of the N and C halves of the splitting intima-chain peptide COL4A5 constructHEK293 cells seeded in 6-well plates were transfected with 3 μg of plasmid DNA expressing N- or C-half constructs of various lengths carrying mitotic introns at different mitotic points. Forty-eight hours post-transfection, cells were harvested, and equal volumes of crude cell lysates were subjected to SDS-PAGE using 6% gel (for the N-half construct) and 10% gel (for the C-half construct). Western blot analysis was then performed using mouse monoclonal anti-FLAG M2 antibody.

[0382] Generation and propagation of LSL knock-in strains based on C57BL / 6 C57BL / 6J was used as the background strain (JAX Registry 000664). A loxP-stop-loxP cassette (containing three copies of the SV40 polyadenylation signal (i.e., the SV40pA3x sequence) with a pair of loxP sites flanking it) was introduced into mice. Col4a5 The gene is located in intron 1 of the mouse X chromosome at positions 141,510,668 and 141,510,669 (mm10). Figure 12A Three sgRNAs (Col4a5_crRNA1:GCAGTGTAGAAGTCTCCTAA (SEQ ID NO: 8), Col4a5_crRNA2: CAGTGTAGAAGTCTCCTAAA (SEQ ID NO: 9), and Col4a5_crRNA3: GCCCTGTAAGCTGACCCTTT (SEQ ID NO: 10)) were designed to be cleaved in vitro using target sequences, and Col4a5_crRNA1 was selected to be introduced into a loxP-stop-loxP cassette. A double-stranded DNA donor plasmid was constructed, carrying the loxP-stop-loxP cassette in the left homologous arm (LHA, 1.4 kb) and the right homologous arm (RHA, 1.8 kb). Cas9 / sgRNA / donor plasmid was microinjected into 1-cell embryos, and 300 microinjected embryos were transferred to pseudopregnant female recipients. DNA sequence analysis was performed on pioneer mice to validate the molecular genomic changes in the target genes. Selected primacy knock-in (KI) mice were further crossed with C57BL / 6J mice to produce N1 and N2 generations of mice. Inbred F1 generations were established from the N2 generation animals and used to establish mouse colonies.

[0383] To maintain the population, male homozygous wild-type mice were crossed with female heterozygous KI mice to obtain offspring with four different genotypes (male homozygous wild-type, male hemizygous KI, female homozygous wild-type, and female heterozygous KI). Genotyping primers were designed, with the forward primer derived from the LHA region and the reverse primer derived from the KI region. The detection of a 324-bp PCR product indicated the presence of a knock-in (KI) allele, while its absence indicated the wild-type allele.

[0384] F primer: ACCCCATCAACTTGTCAACCT (SEQ ID NO: 11) R primer: AGAGTTTGTCCTCAACCGCG (SEQ ID NO: 12) Phenotype of LSL-Col4a5 XLAS mice General appearance and weight were monitored at least weekly. The occurrence and progression of chronic kidney disease were assessed by measuring the albumin-to-creatinine ratio (ACR) in urine and by determining creatinine and blood urea nitrogen (BUN) levels in whole blood samples. For this purpose, spot urine samples were collected from mice, and albuminuria was quantified using an Albuwell M (1011, Ethos Biosciences, Logan Township, NJ) according to the manufacturer's protocol. Urinary albumin levels were normalized to urinary creatinine concentrations measured using a creatinine reagent assay (C75391250, Pointe Scientific, Canton, MI) and expressed as g / g creatinine. Blood creatinine and BUN levels were measured using an i-STAT CHEM8+ Cartridge (09P31-26, Abbott Laboratories, IL.) according to the manufacturer's instructions. Data obtained are expressed as mg / dL (creatinine) and mg / dL (BUN).

[0385] AAV9 intravenous (IV) injection and kidney immunofluorescence in Col4a5 G5X mice : 25 to 30-week-old Col4a5G5X hemizygous male mice (Rheault) et al. , J Am Soc Nephrol 15, 1466-1474 (2004) (XLAS mouse model) and age-matched wild-type (WT) male mice were used at 1×10 13AAV9-CAG-tdTomato or AAV-KP1-CAG-tdTomato vectors were injected at a dose of vg / kg (n=3 to 5 per group). For AAV vector injection, the AAV vector stock solution was diluted with 5% sorbitol / PBS and adjusted to a total volume of 300 μL. Two weeks post-injection, kidney tissue was harvested after perfusion with 4% paraformaldehyde (PFA) (15710, Electron Microscopy Sciences, Hatfield, PA). The harvested kidneys were fixed in PFA and then equilibrated in 30% sucrose (S5, Fisher Scientific, Hampton, NH) for cryoprotection. The fixed tissues were cryo-embedded in Tissue-Tek OCT complex (4583, Sakura Finetek, Torrance, CA) and cut into 5 μm thick sections using a cryostat. Immunostained sections were performed using rabbit anti-WT1 (1:100, ab89901, Abcam, Cambridge, UK) and goat anti-rabbit IgG Alexa Fluor 647 (1:500, 111-605-144, Jackson Immuno Research, West Grove, PA). Sections were then counterstained with Hoechst (1:10000, H3570, Thermo Fisher Scientific, Waltham, MA). Immunofluorescence images were acquired using an LSM 900 Zeiss laser scanning confocal microscope. To determine the percentage of tdTomato-positive podocytes, five glomeruli from each kidney were selected from sections taken near the mid-glomerulus.

[0386] Intravenous injection of AAV9-CAG-Cre vector and immunofluorescence of kidneys in Col4a5 mice Three 17-week-old LSLCol4a5 hemizygous male mice were administered 6.8 × 10⁸ g of iodine solution via intravenous (IV) injection. 11Treatment with AAV9-CAG-Cre was administered to vg. Affected mice of this age exhibited proteinuria. For this injection, the AAV carrier reservoir was diluted with 5% sorbitol / PBS and adjusted to 300 μL. Ten weeks post-injection, kidneys were harvested from one mouse after perfusion with 4% paraformaldehyde (PFA) (15710, Electron Microscopy Sciences, Hatfield, PA). Kidneys from untreated hemizygous (He) and wild-type (WT) male mice were similarly harvested as negative and positive controls, respectively. The harvested kidneys were fixed in PFA and subsequently equilibrated in 30% sucrose (S5, Fisher Scientific, Hampton, NH) for cryoprotection. The fixed tissue was cryoembedded in a Tissue-TekO.CT complex (4583, Sakura Finetek, Torrance, CA) and sectioned into 5 μm thick sections using a cryostat. COL4A5 and COL4A4 expression were examined using frozen sections from the middle region of the left kidney. Staining was performed using rat anti-COL4A5 (1:100, 7078, Chondrex, Woodinville, WA), rat anti-COL4A4 (1:50, b42 clone, received from Shigei Medical Research Institute, Japan. Kidney Int. 2004 Jul;66(1):177-86), and goat anti-rat IgG Cy3 (1:500, 112-165-167, Jackson ImmunoResearch, WestGrove, PA). Sections were then counterstained with Hoechst (1:10000, H3570, ThermoFisher Scientific, Waltham, MA). Immunofluorescence images were acquired using a BZ-X700 fluorescence microscope (Keyence, Osaka, Japan).

[0387] Intravenous injection of the cleavage-integrating peptide AAV9-Col4a5 carrier, namely AAV9-CAG-Nint2-Col4A5 and AAV9- Co-injection of CAG-Cint2-Col4A5 26-week-old Col4a5 G5X XLAS hemicolon male mice were intravenously injected via the tail vein with AAV9-CAG-Nint2-Col4A5 and AAV9-CAG-Cint2-Col4A5, with each AAV vector at a dose of 8.0 × 10⁻⁶. 11vg / mouse (n=2). For vector injection, each AAV vector stock solution was diluted with 5% sorbitol / PBS and adjusted to a total volume of 300 μL. Three weeks post-injection, kidneys were harvested from mice after perfusion with 4% paraformaldehyde (PFA) (15710, Electron Microscopy Sciences, Hatfield, PA). The harvested kidneys were fixed in PFA and then equilibrated in 30% sucrose (S5, Fisher Scientific, Hampton, NH) for cryoprotection. The fixed tissues were cryo-embedded in a Tissue-TekO.CT complex (4583, Sakura Finetek, Torrance, CA) and sectioned into 5 μm thick sections using a cryostat. Rabbit anti-HA (1:200, 3724, Cell Signaling, Danvers, MA), rat anti-COL4A5 (1:200, 7078, Chondrex, Woodinville, WA), rat anti-HA (1:200, 11867423001, Sigma, St. Louis, MO), rabbit anti-WT1 (1:100, ab89901, Abcam, Cambridge, UK), rat anti-laminus β2 / γ1 (1:100, MA1-06100, Thermo Fisher Scientific, Waltham, MA), goat anti-rabbit IgG Alexa Fluor647 (1:500, 111-605-144, Jackson Immuno Research, West Grove, PA), and goat anti-rat IgG Cy3 (1:500, 112-165-167, Jackson Immuno Research, West Grove) were used. Grove (PA) and Hoechst (1:10000, H3570, ThermoFisher Scientific, Waltham, MA) were used for staining. Immunofluorescence images were acquired using a BZ-X700 fluorescence microscope (Keyence, Osaka, Japan).

[0388] Example 2: Selection of splice sites for the cleavage of the intapeptide COL4A5 construct The COL4A5 protein consists of 51 coding exons. COL4A5 Gene encoding. COL4A5The main protein product of the gene is COL4A5, which is 1685 amino acids long. A 1691 amino acid long protein product has also been identified, containing an additional 6 amino acids derived from two hidden short exons. The 1685 amino acid long COL4A5 was selected, encoded by a 5,058 nucleotide long open reading frame (ORF), and was analyzed using the Npu DnaE intein splitting intipeptide system (Shah). et al. , J Am Chem Soc 135, 5839-5847 (2013); Padula et al. , Mol Ther Methods Clin Dev 26, 495-504 (2022); Tornabene et al. , Mol Ther Methods Clin Dev 23, 448-459 (2021); Truong et al. , Nucleic Acids Res 43, 6450-6458 (2015); Iwa et al. , FEBS Lett 580, 1853-1858 (2006)), in which COL4A5 is a non-natural exopeptide. This system is highly flexible in terms of the sequence splitting into N and C halves, except that the first amino acid residue in the C half must be cysteine ​​(Cys), serine (Ser), or threonine (Thr), and its side chain must contain a thiol group (-SH) or a hydroxyl group (-OH) (Apgar). et al. , PLoS One 7, e37355 (2012); Perler Nucleic Acids Res 30, 383-384 (2002)). The positions of Cys, Ser, and Thr in COL4A5, a 1685-amino acid long protein, were identified. Figure 1A-1C For Cys, Ser, and Thr residues, there are a total of 20, 64, and 37 positions, respectively. Regarding the gene expression cassette used for COL4A5 expression, a cassette driven by a 1-kb CAG promoter, with or without a marmot hepatitis virus post-transcriptional regulatory element (WPRE), and possessing a 0.2-kb SV40 polyadenylation signal was selected. This expression cassette can drive strong gene expression (Furusho) in podocytes. et al. , bioRxiv / 2023 / 548760 (2023) and Furusho et al. , Nat Commun15, 10728 (2024)). This therapeutic payload is designed to accommodate a protein-coding sequence of 3,360 base pairs (bp), equivalent to 1,120 amino acids, assuming a packaging size limit of approximately 5 kilobits (kb) for the AAV vector. Taking these factors into account, a total of 25 potential splitting point candidates were identified, such as Figure 1A-1C As summarized in the text.

[0389] Identifying intron insertion sites or exon cleavage sites that successfully mediate protein splicing in non-natural exon peptides remains challenging because the efficiency of protein splicing is significantly influenced by the adjacent exon peptide sequences (Shah). et al. , J Am Chem Soc 135, 5839-5847 (2013); Iwai et al. , FEBS Lett 580, 1853-1858 (2006); Zettler et al. , PLoS One 8, e72925 (2013); Amitai et al. , Proc Natl Acad Sci US A 106, 11005-11010 (2009); Cheriyan et al. , The Journal of Biology chemistry 288, 6202-6211 (2013); Lockless et al. , Proc Natl Acad Sci USA 106,10999-11004 (2009); Ho et al. , Nat Commun 12, 2200 (2021); Lee et al. , PLoS One 7, e43820 (2012)). Furthermore, protein trans-splicing methods cleave non-natural exopeptides into two separate protein molecules. This process increases the risk of unforeseen problems, including protein folding and stability issues. Additionally, potential candidate cleavage sites satisfying the Cys / Ser / Thr requirement at the +1 position of the N-half exopeptide are not necessarily tolerant of intron insertion (Ho). et al. ,, Nat Commun 12, 2200 (2021); Lee et al. , PLoS One7, e43820 (2012)). Therefore, various efforts have been made to understand the mechanisms of protein splicing and to develop new methods that can logically identify suitable cleavage sites. Several strategies have been successfully employed to identify functionally viable cleavage sites and to create cleavage-integral trans-splicing proteins. These strategies include targeting structurally flexible and phylogenetically less conserved regions as cleavage sites (Ho...). et al. , Nat Commun 12, 2200 (2021)), incorporating functionally characterized intipeptide-external peptide linker sequences or sequences surrounding cleavage sites in modified external peptides (Shah et al. , J Am Chem Soc 135, 5839-5847 (2013); Amitai et al. , Proc Natl Acad Sci USA 106, 11005-11010 (2009); Ho et al. , Nat Commun 12, 2200 (2021); Palanamy et al. , Nat Commun 10, 4967 (2019)), and a computational model using split energy spectra or machine learning to score the similarity of natural exopeptide splice site cassettes (Apgar et al. , PLoS One 7,e37355 (2012); Dagliyan et al. , Nat Commun 9, 4042 (2018)). Due to the complex nature of efficient protein splicing mechanisms, systematic screening has also been employed (Ho). et al. , Nat Commun 12, 2200 (2021); Dagliyan et al. , Nat Commun 9, 4042 (2018)). Nevertheless, the mechanisms of protein splicing and methods for logically identifying appropriate cleavage sites remain elusive.

[0390] The logical design of the splitting intron type IV collagen α chain for AAV vector-mediated gene therapy for Alport syndrome presents considerable challenges due to the various limitations involved. First, the splitting site must be selected from 25 amino acid positions to account for the size limitations of the AAV vector payload. Figure 1A-1C Secondly, of the selected sites, 20 were located in the collagen domain (CD), and 5 were located in the non-collagenous region that interrupts the CD. The CD contains evolutionarily conserved GXY motifs, forming a structurally conserved triple helix. Most pathogenic missense mutations (accounting for approximately 40% of COL4A5 mutations leading to XLAS) (Gubler) et al. , Nat Clin Pract Nephrol 4, 24-37 (2008) involves glycine residues of the GXY motif in CD. Given that heterotrimerization occurs in the early stages of type IV collagen heterotrimerization in the pre-secretory endoplasmic reticulum (ER), it is not unreasonable to assume that the cleavage of CD by its integument fusion has adverse effects on protein stability, folding, heterotrimerization, and secretion. Third, in the field of gene delivery, the integument cleavage method has been specifically used for non-secretory proteins (Padula). et al. , Mol Ther Methods Clin Dev 26, 495-504 (2022); Tornabene et al. , Sci Transl Med 11 (2019); Li et al. , Hum Gene Ther 19, 958-964 (2008)), and no studies have yet explored how to design and create split intepitide constructs for secretory proteins. Coagulation factor 8 (F8, a secretory protein) has been reconstructed from the N-half (heavy chain) and C-half (light chain) using a split intepitide dual AAV vector method (Chen et al. , Mol Ther 15, 1856-1862(2007); Esposito et al. , EMBO Mol Med 14, e15199 (2022); Zhu et al. , Sci China Life Sci 56, 262-267 (2013)); however, as Burton et al. , Proc Natl Acad Sci USA 96, 12725-12730 (1999) and Scallan et al. , Blood 102, 3919-3926 (2003) reproducibly demonstrate that cleavage of the inteptide is unnecessary for successful F8 secretion. This is because the covalent linkage of the heavy and light chains occurs naturally during F8 activation. In contrast, the COL4A5 C-half exopeptide likely requires a signaling sequence for proper intracellular transport and secretion. This necessitates additional protein engineering, which is not required for cleavage inteptide constructs of non-secreting exopeptides.

[0391] Given these challenges in designing intronic constructs, the potential COL4A5 splicing site was selected based on its similarity to the splicing sites of natural exopeptides. This is likely an important feature identified in successfully constructed non-natural exopeptides derived from intronic splitting (Apgar). et al. , PLoS One7, e37355 (2012)). An SVM model was trained on 752 splice sites to determine exon peptide splice sites. The SVM model demonstrated predictive ability, with an area under the receiver operating characteristic (ROC) curve of 0.881 ( ). Figure 2 The confusion matrix shows that the sensitivity, specificity, and overall accuracy of the SVM model for similarity prediction are 0.761, 0.904, and 0.868, respectively. Figure 3 Using this machine learning-based prediction model, a total of 6 splice site cassettes similar to the natural exopeptides were identified among 25 candidate sites.

[0392] Ten cleavage sites were selected from 25 candidate sites, including nine from the CD region and one from a non-collagenous interruption region. Figure 1A-1C Of these, three splitting sites showed similarity to natural inteptide splicing sites in terms of amino acid sequence composition. Two additional sites were selected that were close to but outside the site cluster suitable for inclusion in the AAV-CAG vector cassette. Figure 6A The same approach can be applied to gene therapy mediated by splitting intronic peptide dual AAV vectors for autosomal recessive Alport syndrome (ARAS) and autosomal dominant Alport syndrome (ADAS), which is derived from... COL4A3 Gene or COL4A4 Caused by gene mutation, using Figures 4A-4D and Figures 5A-5D .

[0393] Example 3: Design of the COL4A5 construct for splitting intron peptide After testing several different enhancers and promoters for AAV vector-mediated transgene expression in C57BL / 6 mice, the combination of the CAG promoter with the marmot hepatitis virus posttranscriptional regulatory element (WPRE) and SV40 polyadenylation signaling resulted in the strongest gene expression in the kidneys following intravenous injection of AAV9 and AAV-KP1 vectors (Furusho). et al. , bioRxiv / 2023 / 548760 (2023) and Furusho et al. , Nat Commun15, 10728 (2024)), superior to CMV enhancer-promoters with human β-globin intron sequences. Based on this observation, the CAG-WPRE-driven expression cassette was selected for a proof-of-concept study aimed at developing a split-intronic dual AAV vector-mediated gene therapy for Alport syndrome. The following alternative CAG promoter-driven expression cassettes were also used: CAG-WPRE3-SV40pA and CAG-SV40pA without WPRE. Both gene expression cassettes were derived from pAAV-CAG-tdTomato (Addgene 59462), and the WPRE3 sequence was derived from Choi. et al. , Mol Brain 7, 17 (2014).

[0394] In the method of splitting the inteptide COL4A5, since both the N- and C-half segments of COL4A5 need to be transported to the ER, a 26-amino acid-long natural signal sequence of COL4A5 or an 18-amino acid-long human chymotrypsin signal sequence is added to the N-terminus of the C-half segment of COL4A5. Figure 6A The functionality of a chymotrypsin signaling sequence fused with a non-secretory protein, in the context of human apoptosis-inducing factor mitochondrial-associated 1 (AIFM1) protein, was tested in vitro in HEK293 cells, demonstrating that AIFM1 protein is effectively secreted into the culture medium. As a control, a COL4A5 C half-construct without any signal peptide was created. Figure 6A ).

[0395] Example 4: In vitro evaluation of protein trans-splicing using HEK293 cells Plasmids carrying the splitting intron of the COL4A5 N- or C-half ORF between the two AAV2 ITRs listed in Figure 8 were constructed. A plasmid pAAV-CAG-Col4A5-FLAG-WPRE carrying the full-length COL4A5 ORF was also created as a full-length control.

[0396] The C half of the splitting inteptide COL4A5 signal peptide is used for effective expression.First, using three SP1 plasmids: pAAV-CAG-noSS-Cint-SP1-Col4A5-FLAG-WPRE, pAAV-CAG-nativeSS-Cint-SP1-Col4A5-FLAG-WPRE, and pAAV-CAG-chymoSS-Cint-SP1-Col4A5-FLAG-WPRE, we investigated whether the signal peptide could improve the effective expression of the C-half protein fragment of the cleavage inteptide COL4A5 using in vitro plasmid DNA transfection experiments. HEK293 cells were transfected with the corresponding plasmids, and protein levels were quantified by Western blotting. The results showed that the presence of the N-terminal signal sequence in the C-half construct of the cleavage inteptide COL4A5 significantly improved the expression of the C-half. Figure 6B The same experiments performed using pAAV-CAG-noSS-Cint-SP2-Col4A5-FLAG-WPRE and pAAV-CAG-noSS-Cint-SP11-Col4A5-FLAG-WPRE confirmed that no significant levels of the SP2 and SP11 cleavage inteptide COL4A5 C half-fraction product were detected. Figures 9A-9D ).

[0397] Both the natural COL4A5 signal peptide and the chymotrypsin signal peptide mediate the cleavage of the COL4A5 C half protein. Effective expression of the protein, and induction of protein transsplicing when co-expressed with the corresponding splitting intipeptide COL4A5 N half protein. The above experiments also showed that there was no significant difference in the expression level of the COL4A5 C-half protein, which is a splitting intima-in ... Figure 6B To investigate whether trans-splicing of proteins occurs when the N and C halves of the cleavage inteptide COL4A5 are co-expressed, HEK293 cell experiments were performed using the following cleavage site 1 (SP1) cleavage inteptide COL4A5 plasmid combinations in the same manner as described above: (1) pAAV-CAG-Col4A5-FLAG-WPRE (full-length control), (2) pAAV-CAG-SP1-Col4A5-Nint-FLAG-WPRE and pAAV-CAG-nativeSS-Cint-SP1-Col4A5-FLAG-WPRE, (3) pAAV-CAG-SP1-Col4A5-Nint-FLAG-WPRE and pAAV-CAG-chymoSS-Cint-SP1-Col4A5-FLAG-WPRE, and (4) pAAV-CAG-SP1-Col4A5-Nint-FLAG-WPRE and pAAV-CAG-noSS-Cint-SP1-Col4A5-FLAG-WPRE. Crude cell lysates prepared 48 hours after transfection were analyzed by Western blot using anti-FLAG antibody. Figure 6CThe results showed that full-length COL4A5 was successfully reconstructed in cells via protein trans-splicing using both native COL4A5 and chymotrypsin signal sequence C-half constructs. Unspliced ​​N-half products were observed in both C-half constructs. Split point 2 (SP2) constructs were studied in the same manner using the following splitting inteptide COL4A5 plasmids: (1) pAAV-CAG-Col4A5-FLAG-WPRE (full-length control), (2) pAAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE and pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-WPRE, (3) pAAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE only, and (4) pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-WPRE only. Crude cell lysates prepared 48 hours after transfection were analyzed by Western blot using anti-FLAG antibody. Figure 6D Both Col4A5-Nint-FLAG and Cint-Col4A5-FLAG were expressed independently, with the N-hem construct showing significantly higher expression levels than the full-length or C-hem constructs, as did the SP1 construct. Importantly, these results indicate that full-length COL4A5 was successfully reconstructed in cells via protein trans-splicing when the Col4A5-Nint-FLAG and Cint-Col4A5-FLAG constructs were co-expressed. The reconstruction was superior to that of the full-length construct, although a large number of N-hem constructs remained unspliced, presumably due to an excess of N-hem protein relative to C-hem protein.

[0398] The evidence of transsplicing into the secretory pathway in human podocytes demonstrates that proteins reconstructed via transsplicing possess functional properties. Behavior. To assess the secretory capacity of full-length COL4A5 cells reconstructed via trans-splicing, the immortalized undifferentiated human podocyte line AB8 / 13 was differentiated into terminally differentiated podocytes, such as (Saleem... et al. , J Am Soc NephrolAs described in 13, 630-638 (2002), and used to express the cleavage intipeptide COL4A5 construct. For this purpose, the AAV-KP1 vector for expressing the cleavage intipeptide COL4A5 construct of interest was developed. The AAV-KP1 vector has been shown to efficiently transduce terminally differentiated AB8 / 13 podocytes in vitro. Podocytes were infected with the AAV-KP1 vector (AAV-KP1-CAG-SP2-Col4A5-Nint-FLAG-WPRE and AAV-KP1-CAG-nativeSS-Cint-SP2-Col4A5-HA-noWPRE) or tdTomato (AAV-KP1-CAG-tdTomato) expressing the cleavage intipeptide COL4A5 protein. Five days post-infection, 1 mL of culture medium was collected and concentrated for Western blot analysis.

[0399] The results showed that fully reconstituted COL4A5 expressed by the splitting peptide-containing dual AAV-CAG-Col4A5 vector could be transported to the secretory pathway and effectively secreted by cells transduced from the AAV vector. Figure 6E These results also indicate that COL4A5 expressed by the AAV vector can form a heterotrimer with COL4A3 and COL4A4 expressed in terminally differentiated human podocytes.

[0400] In the splitting of the peptide-containing dual AAV-Col4A5 vector, the N-half vector dosage can be significantly reduced to achieve effective counter-propagation. Splicing. This article discloses that when the COL4A5 protein is split into N- and C-half segments and fused with the splitting integrities, the steady-state expression level of the N-half protein is significantly increased compared to the full-length COL4A5 and the C-half protein. Figure 6D When its encoding DNA template is delivered into cells at a 1:1 ratio, this imbalance in the expression levels of the N and C halves of the cleavage inteptide COL4A5 suggests that the amount of the C halves construct can be reduced to mediate efficient trans-splicing. To explore this possibility, in vitro experiments were performed, in which HEK293 cells were transfected with the cleavage inteptide COL4A5 plasmid as detailed previously. In this experiment, the following ratios of pAAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE and pAAV-CAG-nativeSS-Cint-SP2-Col4A5-FLAG-WPRE were tested: 1:1, 0.050:1, 0.025:1, 0.017:1, 0.013:1, 0.010:1, 0.005:1, and 0.001:1. Therefore, the results indicate that the amount of N-half plasmid DNA can be significantly reduced by up to 100 times relative to the amount of C-half plasmid to achieve efficient protein trans-splicing. Figure 10 ).

[0401] Experimental identification of the cleavage site of COL4A5-mediated most efficient protein trans-splicing.The efficiency of trans-splicing varies depending on how the exopeptide is split by the intron, as detailed above. To experimentally evaluate the functional feasibility of COL4A5 splice site candidates and identify the most efficient splice sites, in vitro plasmid transfection experiments were performed using HEK293 cells in essentially the same manner as detailed above. Total cell lysates were collected and Western blotted using either anti-FLAG M2 antibody or rabbit polyclonal anti-human COL4A5 H53 antibody. Among the initially selected 12 splice site candidates ( Figure 1A-1C Nine mitotic sites (SP1, SP2, SP3, SP4, SP5, SP7, SP9, SP11, and SP12) were initially evaluated. Western blot analysis showed that, except for SP3, SP4, and SP1, all constructs could mediate trans-splicing, resulting in the reconstruction of full-length COL4A5 in HEK293 cells. Figures 9A-9D The SP2 construct consistently produced robust trans-splicing in all four replicates. Although some inconsistencies were observed at different split points in some replicates, the SP7 construct consistently showed higher full-length trans-splicing yields of COL4A5 protein than other split points, suggesting that SP7 may be an effective split point.

[0402] Subsequently, another 17 pairs of splitting intron peptide COL4A5 constructs (SEQ ID NO: 122-193) were constructed, creating a group of 27 different SP constructs (SP1-SP12 and SP14-SP28) covering C451 to S1136. These included 25 potential splitting sites between S565 and S1111 suitable for the dual-vector system. The PTS of these 27 pairs was then tested in HEK293 cells followed by Western blotting. Sixteen (SP1, SP3, SP4, SP14-SP19, SP21-SP26, and SP28) failed to produce PTS in HEK293 cells, while 11 (SP2, SP5-SP12, SP20, and SP27) successfully generated splice products with varying efficiencies. Figure 9G Therefore, SP6 and SP7 were identified, and possibly SP2 as well (considering that...). Figure 10 The potential N-half dose reduction shown is considered an optimal splitting point candidate. Furthermore, this disclosure provides insights into motifs in COL4A that promote PTS (…). Figure 9H Using these 27 labeled data sets as the training set (SEQ ID NO: 194-220), a support vector machine (SVM) model was trained. The model was found to consistently achieve high accuracy in predicting the feasibility of splitting points across all iterations of leave-one-out cross-validation. Therefore, this disclosure provides a robust method to streamline the preparation process of novel splitting inte peptide constructs for various collagen molecules.

[0403] The effect of the splitting point on the steady-state expression of the N and C halves of the splitting intima-intima peptide COL4A5. As mentioned above and as Figure 6D As shown, when a similar amount of genetic payload encoding the corresponding protein is delivered to cells via plasmid DNA transfection, the expression level of the splitting intron N-half construct in HEK293 cells is significantly higher than that of the full-length COL4A5 or the splitting intron C-half construct. It is possible that the N-half of COL4A5 is more resistant to protein degradation than either the full-length COL4A5 or the C-half of COL4A5, and these properties are molecular weight dependent. To better understand the effects of splitting COL4A5 into the splitting intron N-half and C-half (e.g., expression levels in cells), in vitro plasmid transfection experiments were performed using HEK293 cells in essentially the same manner as detailed above. In this experiment, protein expression levels at a total of nine splitting points (SP1, SP2, SP3, SP4, SP5, SP7, SP9, and SP11) were assessed using the COL4A5 N-half and C-half constructs. Figure 11A-11B HEK293 cells were transfected with plasmids expressing N- or C-hem constructs of cleavage introns of various lengths with different cleavage points. Forty-eight hours later, crude cell lysates were SDS-PAGEed using 6% gel (for the N-hem construct) and 10% gel (for the C-hem construct), followed by Western blotting with anti-FLAG M2 antibody. No significant differences were observed in protein expression levels of the N-hem construct with different cleavage points. However, interestingly, the steady-state level of the COL4A5 C-hem construct exhibited a molecular weight-dependent decrease. It is possible that bringing the cleavage point closer to the C-terminus may be advantageous in achieving a more balanced expression of the N- and C-hem constructs, potentially yielding more trans-splicing products.

[0404] Example 5: Using loxP-stop-loxP (LSL)-Col4a5 XLAS mouse model AAV vector-mediated gene therapy for Alport syndrome Generation of LSL-Col4a5 XLAS mice. The therapeutic payload for type IV collagen α (COL4A) chain gene replacement therapy for Alport syndrome cannot be loaded into a single AAV vector because human... COL4A The gene's ORF itself is 5.01 to 5.06 kb in length, exceeding the packaging capacity of the AAV vector. Furthermore, AAV gene therapy for kidney disease remains challenging, partly because efficient gene delivery to the kidneys remains difficult, and is hampered by low transduction efficiency of AAV in target cells, including podocytes, the factory for the COL4A protein (Zincarelli). et al. , Mol Ther 16, 1073-1080 (2008); Murata et al. , Eur Radiol18, 1464-1472 (2008); Saito et al. , Clin Exp Nephrol 23, 1345-1356 (2019); Rubin et al. , Hum Gene Ther 30, 1559-1571 (2019); Asico et al. , Biochem Biophys Res Commun 497, 19-24 (2018); Shen et al. , Hum Gene Ther Methods 29, 251-258 (2018); Ikeda et al. , J Am Soc Nephrol 29, 2287-2297 (2018); Konkalmatt et al. , JCI Insight 1 (2016); Rocca et al. , Gene Ther 21, 618-628 (2014); Picconi et al. , Mol Ther Methods Clin Dev 1, 14014 (2014); Chung et al. , Nephron Extra 1, 217-223 (2011); Schievenbusch et al. , Mol Ther 18, 1302-1309 (2010); Ito et al. , BJU International 101, 376-381 (2008); Lipkowitz et al. , J Am Soc Nephrol 10, 1908–1915 (1999); Woodard et al. , J Vis Exp , 56324 (2018); Davis et al. , Physiol Genomics 51, 449-461 (2019)). To demonstrate AAV vector-mediated gene therapy for Alport syndrome, an LSLCol4a5 knock-in XLAS mouse model was developed and is disclosed in this paper. In this model, the Col4a5 protein is expressed in natural cells after Cre recombinase expression. Col4a5The expression of genes was restored under the control of enhancer-promoter. The ORF of the Cre recombinase is 1.03 kb, and the AAV-Cre vector can be used to restore the expression of genes of interest in their respective LSL mouse models. The LSL-Col4a5 XLAS mouse model was established by introducing a loxP-stop-loxP box (containing three copies of the SV40 polyadenylation signal (i.e., the SV40pA 3x sequence), flanked by a pair of loxP sites) into the mouse. Col4a Gene 5 is produced in intron 1 of the gene (located between positions 141,510,668 and 141,510,669 on the mouse X chromosome (mm10)). Figure 12A ).

[0405] Figure 12B-12E The characteristics of this mouse model were demonstrated. Statistically significant differences were observed from week 14 in body weight, urinary albumin levels, blood biomarkers, and survival probability (corrected p < 0.05) (Student t-test corrected by Bonferroni). Similar to the Col4a5 G5X XLAS mouse, the LSL-Col4a5 XLAS mouse also exhibited progressive chronic kidney disease (CKD) clinically and histologically. These observations confirm that the LSL-Col4a5 XLAS mouse is a good animal model of Alport syndrome and can be used to evaluate the in vivo efficacy of novel treatments.

[0406] Intravenous (IV) injection of AAV9 transduced podocytes in the kidneys of XLAS-associated CKD. To investigate how AAV9 transduces healthy kidneys and XLAS-associated CKD kidneys via IV injection, Col4a5 G5X hemizygous male mice (Rheault) were injected with the drug. et al. , J Am Soc Nephrol 15, 1466-1474 (2004) (an established XLAS mouse model) and age-matched wild-type (WT) male mice were injected with AAV9-CAG-tdTomato or AAV-KP1-CAG-tdTomato vectors. AAV9 and AAV-KP1 are contrasting capsids that exhibit different renal transduction characteristics and different pharmacokinetic (PK) in the blood. AAV9 and AAV-KP1 showed very slow and very rapid blood clearance, respectively, after IV injection. et al. , Mol Ther 19,1079-1089 (2011); Furusho et al. , bioRxiv / 2023 / 548760 (2023); Furusho et al. , Nat Commun15, 10728 (2024)). Urinary albumin levels at the time of injection were significantly higher in Col4a5 G5X than in WT, indicating increased permeability of the glomerular filtration barrier (Furusho). et al. , bioRxiv / 2023 / 548760 (2023) and Furusho et al. , Nat Commun 15, 10728 (2024)). Two weeks after injection, CKD kidneys showed significantly enhanced podocyte transduction utilizing AAV9 compared to healthy kidneys, reaching 35% podocyte transduction ( Figures 13A-13B Notably, the enhancement of AAV9 was greater than that of AAV-KP1, indicating that prolonged blood circulation time can be a booster of podocyte transduction factors (Furusho). et al. , bioRxiv / 2023 / 548760 (2023) and Furusho et al. , Nat Commun 15, 10728 (2024)). This establishes that IV injection of the AAV9 vector is a rational and logical approach for AAV vector-mediated gene therapy for Alport syndrome. Ding et al. , Sci Transl Med 15, eabc8226 (2023) also demonstrated enhanced podocyte transduction in the kidneys of CKD patients.

[0407] Intravenous injection of AAV9-CAG-Cre vector transduced podocytes and restored type IV gel in LSL-Col4a5 XLAS mice. Original expression. LSL Col4a5 hemicolon male mice were treated with intravenous AAV9-CAG-Cre. Immunofluorescence microscopy analysis revealed that numerous glomeruli were transduced by the AAV9-CAG-Cre vector, resulting in tdTomato expression within the glomeruli. The COL4A4 and COL4A5 signaling molecules absent in untreated hemicolon male mice were co-localized within the glomerular membrane structures, likely representing the glomerular basement membrane (GBM). Figures 14A-14B This strongly suggests that the AAV9 vector effectively transduces podocytes, leading to the restoration of heterotrimeric type IV collagen expression and its incorporation into GBM.

[0408] Demonstrated the efficacy of AAV gene therapy for X-linked Alport syndrome (XLAS) in the LSL-Col4a5 XLAS mouse model. Treatment efficacy. In the above experiment, 17-week-old Col4a5-LSL hemicryl (He) male mice were treated with the AAV9-CAG-Cre vector via intravenous (IV) injection. The weight of both mice was monitored weekly. Unexpectedly, the vector-treated XLAS mice survived to at least 36 weeks of age without weight loss, exceeding the time it took for all untreated XLAS mice to die or reach the endpoint. Figure 14CMacroscopic examination of the XLAS kidneys in these AAV vector-treated mice showed a clear improvement, with normal kidney size and shape, a relatively smooth surface, and a lack of the pronounced granular appearance observed in the untreated controls. This establishes that AAV9 IV gene therapy mediates therapeutic efficacy in XLAS mice. Notably, this gene therapy was able to halt disease progression even when administered at a late stage of this established disease.

[0409] In another experiment, 11 LSL-Col4a5 hemizygous (He) male mice (n=11) were treated with AAV9-CAG-Cre vector via retroorbital injection at 4 weeks of age. Under anesthesia, the mice received 50 μL of AAV vector solution (3.0 × 10⁻⁶). 11 AAV vector (vg / mouse) was injected into the right eye. These mice were monitored by weekly weight measurements. XLAS mice treated with AAV vector showed a similar weight trajectory to untreated XLAS mice before 20 weeks of age. Figure 14D To assess urinary albumin, spot urine was collected and the albumin-to-creatinine ratio (ACR) was measured. Urinary albumin was quantified using an Albuwell M (1011, Ethos Biosciences, Logan Township, NJ) and normalized to urinary creatinine concentrations measured using a creatinine reagent assay (C75391250, Pointe Scientific, Canton, MI). ACR values ​​are expressed in g / g creatinine. All measurements were performed according to the manufacturer's instructions. Data indicate that AAV carrier therapy effectively prevents albumin leakage into the urine at a given time point. Figure 14E This indicates that AAV9 gene therapy mediates therapeutic effects in XLAS mice, leading to improvements in biomarkers when administered early.

[0410] Therefore, using this mouse model, this disclosure demonstrates that intravenous injection of AAV9-CAG-Cre into 17-week-old LSL-Col4a5 hemizygous (He) male mice prevents the progression of CKD. Figure 14F , 14H This study confirmed that Col4a4 and Col4a5 expression was restored in the glomeruli of all mice euthanized at 10 or 22 weeks post-injection. Furthermore, AAV treatment significantly reduced glomerulosclerosis in the kidneys and improved renal tubular structure. Figure 14H When LSL-Col4a5 XLAS mice were treated with intravenous AAV9-CAG-Cre at 4 weeks of age, they showed more effective treatment results and greater improvement in biomarkers. Figure 14D-14G These observations clearly demonstrate that IV-injected AAV9 can cross GFB and translocate before the onset of CKD in XLAS mice. Guided podocytesThese findings establish that AAV9 IV gene therapy can mediate therapeutic effects in LSL-Col4a5 XLAS mice, whether administered before or after a CKD episode.

[0411] AAV9 IV gene therapy administered at 4 weeks of age extended survival by 59% ( Figure 14G Further follow-up of the mice (until all mice reached the experimental endpoint due to renal failure) showed that the therapy extended median survival from 31.5 weeks to 50.0 weeks, representing a 59% improvement. Figure 14G This further confirms the therapeutic potential of AAV9 IV gene therapy.

[0412] Example 6: Using Col4a5 G5X XLAS mice Alport syndrome gene therapy mediated by the splitting intron AAV vector The splitting intipeptide AAV9-CAG-Col4A5 vector was generated using splitting point 2 (SP2). Given that intravenous injection of the AAV9 vector into mice with CKD can effectively transduce podocytes (as shown in this article; Ding et al. , Sci Transl Med 15, eabc8226 (2023); Furusho et al. , bioRxiv / 2023 / 548760 (2023)), this study used the AAV9 capsid. SP2 was used as the cleavage site because SP2 cleavage of intron constructs has consistently proven to be a highly efficient cleavage site. The genomes of the AAV-CAG-SP2-Col4A5-Nint-FLAG-WPRE vector (4.6 kb) for cleaving the intron N-segment vector and the AAV-CAG-nativeSS-Cint-SP2-Col4A5-HA-noWPRE vector (4.8 kb) for cleaving the intron C-segment vector were used. Two AAV9 vectors carrying these genomes, namely AAV9-CAG-Nint2-Col4A5 and AAV9-CAG-Cint2-Col4A5, were generated in adherent HEK293 cells and purified by two rounds of cesium chloride (CsCl) density gradient ultracentrifugation followed by dialysis, as previously described.

[0413] Intravenous injection of the cleavage-integrating peptide AAV9-Col4a5 carrier, i.e., co-injection of AAV9-CAG-Nint2-Col4a5 and... AAV9-CAG-Cint2-Col4a5 restored podocytes and the surrounding glomerular basement membrane in Col4a5 G5X XLAS mice. COL4A5 expression in (GBM). Animals were injected intravenously with AAV9-CAG-Nint2-Col4a5 and AAV9-CAG-Cint2-Col4a5, and their kidneys were analyzed by immunofluorescence.

[0414] The AAV vector effectively transduced podocytes and expressed COL4A5 in the kidneys of XLAS mice. The membranous tdTomato staining pattern associated with WT1 (a podocyte marker) overlapped with laminin (a GBM marker), demonstrating that AAV vector-mediated gene delivery restored type IV collagen expression in GBM. Figures 15A-15C Unlike humans, wild-type mice express Col4a3, Col4a4, and Col4a5 in their renal tubules. Therefore, the tubular basement membrane (TBM) in mice is positive for these collagen α chains (see [link to original text]). Figures 14A-14B Intravenous injection of AAV9 vectors effectively transduces the proximal tubules in the kidneys of CKD patients (see also Furusho). et al. , bioRxiv / 2023 / 548760 (2023) and Furusho et al. , Nat Commun 15, 10728 (2024)). Therefore, the overlap of tdTomato or HA signaling with TBM structure indicates that type IV collagen expression in TBM is also restored. This observation is a logical consequence of the transduction of the splitting inteptide AAV-Col4a5 carrier in the renal tubules. Taken together, these observations strongly suggest that the splitting inteptide AAV-Col4a5 carrier effectively transduces podocytes in CKD kidneys and leads to the expression of trans-spliced ​​full-length functional COL4A5 protein, which forms a cross-species heterotrimeric type IV collagen with mouse Col4a3 and Col4a4 and integrates into the GBM (Heiden-mediated cytokine). et al. , Am J Pathol 163, 1633-1644 (2003)).

[0415] Example 7: Relationship between podocyte transduction % and therapeutic efficacy in AAV gene therapy for X-linked Alport syndrome (XLAS) Deposition of collagen IV protein in the glomerular basement membrane (GBM) is not limited to specific, exclusive segments assigned to individual podocytes. Instead, GBM segments contributing to collagen IV deposition by each podocyte extensively overlap, resulting in a continuous and interconnected distribution of individual podocyte collagen IV deposition segments within the GBM. This overlapping nature makes it challenging to precisely delineate specific GBM segments attributable to individual podocytes. Therefore, accurately quantifying AAV vector-mediated podocyte transduction efficiency using vector-mediated Col4a5 / COL4A5 expression as a biomarker is not feasible. However, there is reason to suggest that assessing the percentage of Col4a5 deposition in the GBM (deposition%) is an effective method for understanding the level of podocyte transduction (transduction%) required to achieve therapeutic effects in XLAS mice. Although, as stated above, the deposition percentage may slightly overestimate the true transduction percentage due to the interconnected and overlapping nature of Col4a5 deposition, it is unlikely to lead to an underestimation. Therefore, the deposition percentage was determined in the harvested kidneys of two 32-week-old LSL-Col4a5 XLAS mice (showing therapeutic effect) that were treated with intravenous AAV9-CAG-Cre at 4 weeks of age. The deposition percentages were 6.0% and 6.1% ( Figures 16A-16C This indicates that AAV gene therapy can... As low as ~6% or less The therapeutic effect was achieved through podocyte transduction, further highlighting the importance of developing AAV gene therapy for Alport syndrome.

[0416] Demonstrates the restoration of Col4a4 expression in XLAS mice treated with IV injection of the cleavage-in-the-peptide bis-AAV9-CAG-COL4A5. complex. result( Figure 16D This strongly indicates that the split-intrapeptide dual-carrier method successfully delivered fully functional COL4A5 protein into podocytes of XLAS mice, restoring the deposition of functional collagen IV α3α4α5 chain heterotrimers in GBM.

[0417] Given that the principles of this invention can be applied to many possible instances, it should be understood that the examples shown are merely illustrative and should not be considered as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. Therefore, we claim protection for all contents falling within the scope and spirit of these claims as our invention.

Claims

1. A splitting intipeptide system comprising: (i) A first nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, an N-exponential peptide and an N-intipeptide, wherein the N-exponential peptide comprises a first signal sequence located at the N-terminus of the N-terminal portion of the type IV collagen α chain; and (ii) A second nucleic acid molecule encoding a fusion protein comprising, from N-terminus to C-terminus, a second signal sequence, a C-inteptide of the inteptide pair, and a C-extensive peptide of the extensive peptide pair, wherein the C-extensive peptide comprises the C-terminal portion of the type IV collagen α chain; and wherein The type IV collagen α chain is COL4A5; The N-terminal and C-terminal portions of the type IV collagen α chain are together contained within the type IV collagen α chain sequence that separates at the split point; and When the first and second nucleic acid molecules are expressed in mammalian cells, the N-exopeptide and C-exopeptide are spliced ​​together to form a mature type IV collagen α chain.

2. The splitting intipeptide system according to claim 1, comprising: (i) A first adeno-associated virus (AAV) vector containing the first nucleic acid molecule; and (ii) A second AAV vector containing the second nucleic acid molecule.

3. The splitting inteptide system according to claim 2, wherein the first AAV vector and / or the second AAV vector is AAV9.

4. The splitting inteptide system according to claim 2, wherein the first AAV carrier and / or the second AAV carrier is AAV-KP1.

5. The splitting inteptide system according to claim 2, wherein the first AAV carrier and / or the second AAV carrier is AAV1, AAV1_9mt100, AAV1_9mt30, AAV1_9mt76, AAV2, AAV2G9, AAV2i8, AAV2retro, AAV2R585E, AAV2R585E9_2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV9AA272, AAV9AA22, AAV9W22A, AAV10, AAV11 , AAV2.7m8, AAVAnc80, AAVbb.2, AAV-DJ, AAVHN1, AAVHN2, AAVHN3, AAVhu.11, AAVhu.13, AAVhu.37, AAV-KP1, AAV-KP2, AAV-KP 3. AAVLK03, AAVNP40, AAVNP59, AAVPHP.B, AAVPHP.eB, AAVPHP.S, AAVpo1, AAVrh.8, AAVrh.10, AAVrh.20, AAVrh.43 or AAVShH10.

6. The splitting integrin system according to claim 1, wherein the integrin pairs are Npu DnaE contains peptide pairs.

7. The splitting integrin system of claim 6, wherein the N-integrin comprises the amino acid sequence of SEQ ID NO: 26 or an amino acid sequence having at least 95% identity with it; and The C-integral peptide comprises the amino acid sequence of SEQ ID NO: 27 or an amino acid sequence having at least 95% identity with it.

8. The splitting inteptide system according to claim 1, wherein, The first signal sequence, the N-terminal portion of the type IV collagen α chain, and the N-inteptide are directly fused.

9. The splitting inteptide system according to claim 1, wherein, The second signal sequence, the C-intein, and the C-terminal portion of the type IV collagen α chain are directly fused.

10. The splitting inteptide system of claim 1, wherein the splitting inteptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 1:1 to about 0.010:

1.

11. The splitting inteptide system of claim 10, wherein the splitting inteptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 0.017:1 to about 0.010:

1.

12. The splitting inteptide system of claim 1, wherein the splitting point is located within the collagen domain of the type IV collagen α chain.

13. The splitting intipeptide system according to claim 1, wherein the first signal sequence and / or the second signal sequence is a collagen signal sequence or a chymotrypsin signal sequence.

14. The splitting inteptide system of claim 13, wherein the first signal sequence and the second signal sequence are different.

15. The splitting intipeptide system of claim 13, wherein the collagen signal sequence comprises SEQ ID NO:4, and / or wherein the chymotrypsin signal sequence comprises SEQ ID NO:

5.

16. The splitting inteptide system of claim 1, wherein the type IV collagen α chain comprises an amino acid sequence of any one of SEQ ID NO:15-25 or an amino acid sequence having at least 95% identity with it.

17. The splitting inteptide system of claim 16, wherein the type IV collagen α chain comprises the amino acid sequence of SEQ ID NO:15 or an amino acid sequence having at least 95% identity with it.

18. The splitting intipeptide system of claim 16, wherein the splitting point is located at positions 697 to 1488 relative to SEQ ID NO:

15.

19. The splitting intipeptide system according to claim 16, wherein: (a) The N-terminal portion contains amino acids 27–696 of the type IV collagen α chain, and the C-terminal portion contains amino acids 697–1685 of the type IV collagen α chain (SP2). (b) The N-terminal portion contains amino acids 27–878 of the type IV collagen α chain, and the C-terminal portion contains amino acids 879–1685 of the type IV collagen α chain (SP5). (c) The N-terminal portion contains amino acids 27-888 of the type IV collagen α chain, and the C-terminal portion contains amino acids 889-1685 of the type IV collagen α chain (SP20). (d) The N-terminal portion contains amino acids 27–915 of the type IV collagen α chain, and the C-terminal portion contains amino acids 916–1685 of the type IV collagen α chain (SP6). (e) The N-terminal portion contains amino acids 27–941 of the type IV collagen α chain, and the C-terminal portion contains amino acids 942–1685 of the type IV collagen α chain (SP7). (f) The N-terminal portion contains amino acids 27–961 of the type IV collagen α chain, and the C-terminal portion contains amino acids 962–1685 of the type IV collagen α chain (SP8). (g) The N-terminal portion contains amino acids 27-977 of the type IV collagen α chain, and the C-terminal portion contains amino acids 978-1685 of the type IV collagen α chain (SP9). (h) The N-terminal portion contains amino acids 27-995 of the type IV collagen α chain, and the C-terminal portion contains amino acids 996-1685 of the type IV collagen α chain (SP10). (i) The N-terminal portion contains amino acids 27–1070 of the type IV collagen α chain, and the C-terminal portion contains amino acids 1071–1685 of the type IV collagen α chain (SP11). (j) The N-terminal portion contains amino acids 27–1098 of the type IV collagen α chain, and the C-terminal portion contains amino acids 1099–1685 of the type IV collagen α chain (SP27); or (k) The N-terminal portion contains amino acids 27–1135 of the type IV collagen α chain, and the C-terminal portion contains amino acids 1136–1685 of the type IV collagen α chain (SP12); and The amino acid number is relative to SEQ ID NO:

15.

20. The splitting inteptide system according to claim 16, wherein: (a) The N-terminal portion contains IPG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP2) at its N-terminus. (b) The N-terminal portion contains PPG at its C-terminus, and the C-terminal portion contains SPGL (SEQ ID NO:222) (SP5) at its N-terminus. (c) The N-terminal portion contains AGA at its C-terminus, and the C-terminal portion contains SGFP (SEQ ID NO:223) (SP20) at its N-terminus. (d) The N-terminal portion includes a PGR at its C-terminus, and the C-terminal portion includes an SGVP (SEQ ID NO:224) (SP6) at its N-terminus. (e) The N-terminal portion contains EKG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP7) at its N-terminus. (f) The N-terminal portion contains LLG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP8) at its N-terminus. (g) The N-terminal portion includes PGV at its C-terminus, and the C-terminal portion includes SGPK (SEQ ID NO:225) (SP9) at its N-terminus. (h) The N-terminal portion includes PGL at its C-terminus, and the C-terminal portion includes SGQP (SEQ ID NO:226) (SP10) at its N-terminus. (i) The N-terminal portion contains PGI at its C-terminus, and the C-terminal portion contains SSIG (SEQ ID NO:227) (SP11) at its N-terminus. (j) The N-terminal portion contains IKG at its C-terminus, and the C-terminal portion contains SVGD (SEQ ID NO:228) (SP27) at its N-terminus; or (k) The N-terminal portion contains KGI at its C-terminus, and the C-terminal portion contains SGPP (SEQ ID NO:229) (SP12) at its N-terminus.

21. The splitting inteptide system of claim 1, wherein the N-terminal portion does not contain a collagen signal sequence.

22. The splitting inteptide system of claim 1, wherein the first nucleic acid molecule and / or the second nucleic acid molecule are operatively linked to a CAG promoter.

23. The splitting inteptide system of claim 1, wherein the first nucleic acid molecule and / or the second nucleic acid molecule further comprises a marmot hepatitis virus post-transcriptional regulatory element; and / or The first nucleic acid molecule and / or the second nucleic acid molecule are operatively linked to the post-transcriptional regulatory element of the marmot hepatitis virus.

24. The splitting inteptide system of claim 1, wherein the first nucleic acid molecule and / or the second nucleic acid molecule further encodes an SV40 polyadenylation signal.

25. A pharmaceutical composition comprising an effective amount of the split intipeptide system of claim 1 and a pharmaceutically acceptable carrier, wherein the split intipeptide system comprises the first nucleic acid molecule and the second nucleic acid molecule in a ratio of about 1:1 to about 0.010:

1.

26. A splitting intipeptide system, comprising: (i) A first adeno-associated virus (AAV) vector, the first AAV vector comprising a first nucleic acid molecule operatively linked to a CAG promoter, wherein the first nucleic acid molecule encodes an N-external peptide and an external peptide pair sequentially comprising, from N-terminus to C-terminus. Npu A fusion protein of the N-inpeptide of the DnaE inteptide pair, wherein the N-external peptide comprises a collagen signal sequence located at the N-terminus of the N-terminal portion of the type IV collagen α5 (COL4A5) chain, wherein the collagen signal sequence, the N-terminal portion of the COL4A5 chain and the N-inpeptide are directly fused. (ii) A second AAV vector, the second AAV vector comprising a second nucleic acid molecule operatively linked to a CAG promoter, wherein the second nucleic acid molecule encodes a signal sequence sequentially comprising, from the N-terminus to the C-terminus, the... Npu A fusion protein of the C-inpeptide of the DnaE inteptide pair and the C-external peptide of the external peptide pair, wherein the C-external peptide comprises the C-terminal portion of the COL4A5 chain, wherein the signal sequence, the C-inpeptide, and the C-terminal portion of the COL4A5 chain are directly fused; and wherein... The N-terminal and C-terminal portions of the COL4A5 chain are together contained within the COL4A5 chain sequence separated at the split point; and When the first and second nucleic acid molecules are expressed in mammalian cells, the N-exopeptide and C-exopeptide are spliced ​​together to form a mature COL4A5 chain.

27. The splitting inteptide system according to claim 26, wherein: (a) The N-terminal portion contains amino acids 27–696 of the COL4A5 chain, and the C-terminal portion contains amino acids 697–1685 of the COL4A5 chain (SP2). (b) The N-terminal portion contains amino acids 27–878 of the COL4A5 chain, and the C-terminal portion contains amino acids 879–1685 of the COL4A5 chain (SP5). (c) The N-terminal portion contains amino acids 27-888 of the COL4A5 chain, and the C-terminal portion contains amino acids 889-1685 of the COL4A5 chain (SP20). (d) The N-terminal portion contains amino acids 27–915 of the COL4A5 chain, and the C-terminal portion contains amino acids 916–1685 of the COL4A5 chain (SP6). (e) The N-terminal portion contains amino acids 27–941 of the COL4A5 chain, and the C-terminal portion contains amino acids 942–1685 of the COL4A5 chain (SP7). (f) The N-terminal portion contains amino acids 27–961 of the COL4A5 chain, and the C-terminal portion contains amino acids 962–1685 of the COL4A5 chain (SP8). (g) The N-terminal portion contains amino acids 27-977 of the COL4A5 chain, and the C-terminal portion contains amino acids 978-1685 of the COL4A5 chain (SP9). (h) The N-terminal portion contains amino acids 27-995 of the COL4A5 chain, and the C-terminal portion contains amino acids 996-1685 of the COL4A5 chain (SP10). (i) The N-terminal portion contains amino acids 27–1070 of the COL4A5 chain, and the C-terminal portion contains amino acids 1071–1685 of the COL4A5 chain (SP11). (j) The N-terminal portion comprises amino acids 27–1098 of the COL4A5 chain, and the C-terminal portion comprises amino acids 1099–1685 of the COL4A5 chain (SP27); or (k) The N-terminal portion comprises amino acids 27–1135 of the COL4A5 chain, and the C-terminal portion comprises amino acids 1136–1685 of the COL4A5 chain (SP12); and The amino acid number is relative to SEQ ID NO:

15.

28. The splitting inteptide system according to claim 26, wherein... (a) The N-terminal portion contains IPG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP2) at its N-terminus. (b) The N-terminal portion contains PPG at its C-terminus, and the C-terminal portion contains SPGL (SEQ ID NO:222) (SP5) at its N-terminus. (c) The N-terminal portion contains AGA at its C-terminus, and the C-terminal portion contains SGFP (SEQ ID NO:223) (SP20) at its N-terminus. (d) The N-terminal portion includes a PGR at its C-terminus, and the C-terminal portion includes an SGVP (SEQ ID NO:224) (SP6) at its N-terminus. (e) The N-terminal portion contains EKG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP7) at its N-terminus. (f) The N-terminal portion contains LLG at its C-terminus, and the C-terminal portion contains SKGE (SEQ ID NO:221) (SP8) at its N-terminus. (g) The N-terminal portion includes PGV at its C-terminus, and the C-terminal portion includes SGPK (SEQ ID NO:225) (SP9) at its N-terminus. (h) The N-terminal portion includes PGL at its C-terminus, and the C-terminal portion includes SGQP (SEQ ID NO:226) (SP10) at its N-terminus. (i) The N-terminal portion contains PGI at its C-terminus, and the C-terminal portion contains SSIG (SEQ ID NO:227) (SP11) at its N-terminus. (j) The N-terminal portion contains IKG at its C-terminus, and the C-terminal portion contains SVGD (SEQ ID NO:228) (SP27) at its N-terminus; or (k) The N-terminal portion contains KGI at its C-terminus, and the C-terminal portion contains SGPP (SEQ ID NO:229) (SP12) at its N-terminus.

29. A pharmaceutical composition comprising an effective amount of the split intipeptide system of claim 26 and a pharmaceutically acceptable carrier.

30. A method for treating a subject with Alport syndrome, the method comprising administering to the subject an effective amount of the pharmaceutical composition of claim 29, thereby treating the subject with Alport syndrome.

31. The method of claim 30, further comprising delivering the splitting intipeptide system to the kidney of the subject.

32. The method of claim 31, wherein delivering the split intipeptide system to the kidney of the subject comprises systemic administration.

33. The method of claim 32, wherein the systemic administration comprises systemic injection or systemic infusion.

34. The method of claim 31, wherein delivering the split intipeptide system to the kidney of the subject comprises delivering the split intipeptide system locally to the kidney of the subject.

35. The method of claim 34, wherein local delivery of the split-intended peptide system to the kidney of the subject comprises direct parenchymal injection, renal vein injection, and / or renal artery injection.

36. The method of claim 34, wherein local delivery of the split-intended peptide system to the kidney of the subject comprises direct pyelonephrosis or retrograde transureteropyelosis.

37. The method of claim 30, wherein the dividing intipeptide system transduces at least one of mesangial cells, glomerular endothelial cells, parietal epithelial cells, podocytes, proximal tubule cells, loop of Henle cells, distal tubule cells, collecting duct cells, fibroblasts, pericytes, or vascular smooth muscle cells.

38. The method of claim 30, wherein the method: a) Improved renal function in the subjects; b) Delay the onset of end-stage renal disease in the subjects; c) Delay the time when the subject receives dialysis; d) Delaying the time when the subject receives a kidney transplant; and / or e) Improve the life expectancy of the subjects.

39. The method of claim 30, wherein the Alport syndrome is X-linked Alport syndrome.

40. The method of claim 30, wherein the method further comprises administering an effective amount of angiotensin II receptor blocker (ARB) and / or angiotensin-converting enzyme inhibitor; The ARBs mentioned above include candesartan, captopril, iprosartan, irbesartan, losartan, moxipril, olmesartan, telmisartan, and / or valsartan; and The angiotensin-converting enzyme inhibitors mentioned above include benazepril, cilazapril, enalapril, fosinopril, lisinopril, perindopril, ramipril, quinapril, and / or landopril.

Images