Method of hydrodynamic transfection for preparation of mouse hepatoma model

Abstract

The application discloses a method for preparing a mouse liver cancer model by hydrodynamic transfection and belongs to the technical field of biological medicines. The method comprises the following steps: constructing a pT3-EF1a-VASN plasmid by one-step LR recombination; mixing and preparing LentiCRISPRv2-sgP53, LentiCRISPRv2-sgPten, pT3-N90-beta-catenin, pT3-EF1a-C-met, pT3-EF1a-VASN and pCMV / SB11 plasmids according to a predetermined ratio; rapidly injecting the mixture into the tail vein of a mouse within 5 seconds at a set dose; and keeping the mouse warm after injection and sacrificing the mouse to take out liver tissues at the end of the experiment. The application solves the problems of a long tumorigenesis cycle, high cost and low microenvironment simulation degree of the existing model, comprehensively utilizes the liver specificity of high-pressure hydrodynamic transfection and the cancer-promoting characteristics of VASN, realizes rapid tumorigenesis and accurate model preparation for researching the relationship between VASN and liver cancer, can quickly establish a mouse liver cancer model highly simulating the human liver cancer occurrence process, and significantly improves the efficiency and representativeness of model construction.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a method for preparing a mouse liver cancer model by hydrodynamic transfection. Background Technology

[0002] Hepatocellular carcinoma (HCC), a common malignant tumor of the digestive tract, has long maintained a high incidence and mortality rate, posing a serious threat to human life and health. The mechanisms of HCC development are complex, involving multiple gene drivers, microenvironmental alterations, and immune evasion. Therefore, establishing animal models that can realistically simulate the characteristics of human HCC development and evolution is a core foundation for conducting basic research on HCC and preclinical evaluation of anti-HCC drugs.

[0003] Currently, existing animal models used for liver cancer research mainly include chemically induced models, xenograft models, and genetically engineered mouse models. Chemical induction typically utilizes chemical carcinogens such as diethylnitrosamine in combination with a specific high-fat diet or liver injury treatment to induce liver cancer in experimental animals over a prolonged period. However, tumors induced by this method often have limitations such as wide distribution and unclear mutation lineages, making it difficult to accurately define their association with specific gene regulation. Xenograft models involve directly implanting human liver cancer cell lines or ex vivo tumor tissue from liver cancer patients into severely immunodeficient mice, relying on the immunodeficient background to achieve rapid tumor proliferation. Although this method results in rapid tumor formation, the lack of normal immune system function means that the growth microenvironment of the transplanted tumor cannot simulate the natural immune microenvironment in humans, resulting in inherent limitations in studying the molecular mechanisms related to immunotherapy. Genetically engineered mouse models, through transgenic and CRISPR / Cas9 gene editing technologies, induce liver cancer by overexpressing or knocking out oncogenes or tumor suppressor genes in mice under a specific germline background. While this technology can accurately reflect the relationship between specific gene mutations and the occurrence of liver cancer, it suffers from the drawback of an extremely long modeling cycle. It often requires several months or even more than a year of feeding, mating, and genotyping to obtain a certain number of model mice. This greatly increases the cost of experiments and limits the implementation of large-scale experiments, seriously affecting the progress of scientific research.

[0004] Furthermore, when studying targets highly related to angiogenesis and cellular stress, such as VASN, traditional models often struggle to achieve rapid enrichment and dynamic overexpression of target genes in the liver microenvironment within a short period. Existing induced or transplanted models cannot simultaneously balance experimental speed, preservation of the immune microenvironment, and ease of regulation of specific oncogenes / tumor suppressors. Therefore, the field of liver cancer research currently lacks a rapid and relatively inexpensive method for preparing animal models. This method needs to be effective in adult mice with a complete immune system and can simultaneously and synergistically simulate the abnormal expression of multiple genes and efficiently mimic the human liver cancer development process to meet the growing demands of scientific research and drug efficacy evaluation. Summary of the Invention

[0005] This invention overcomes the problems of long tumor formation cycle, high cost, and low microenvironment simulation in existing models. It comprehensively utilizes the liver specificity of high-pressure hydrodynamic transfection and the tumor-promoting properties of VASN to achieve rapid tumor formation and accurate model preparation for studying the relationship between VASN and liver cancer. It can quickly establish a mouse liver cancer model that highly simulates the human liver cancer development process, significantly improving the efficiency and representativeness of model construction.

[0006] To achieve the above objectives, the present invention adopts the following solution: A method for preparing a mouse hepatocellular carcinoma model by hydrodynamic transfection, comprising the following steps: Step 1: Mix the VASN expression fragment containing the attL site with the expression vector containing the attR site, and add the LR recombinase system containing Int, IHF, and Xis. Incubate to complete the directed recombination and obtain the pT3-EF1α-VASN plasmid. Step 2: LentiCRISPRv2-sgP53 plasmid, LentiCRISPRv2-sgPten plasmid, pT3-N90-β-catenin plasmid, pT3-EF1α-C-met plasmid, pT3-EF1α-VASN plasmid and pCMV / SB11 transposase plasmid are mixed in a mass ratio of 2:2:2:2:2:1 and sterile Ringer's solution is used as solvent to prepare a mixed plasmid solution with a total concentration of 6.6 μg / mL. Step 3: The mixed plasmid solution was injected into the selected mice via the tail vein within 5 seconds at an injection dose of 0.1 mL / g body weight. Step 4: Place the mice that have completed the injection in Step 3 in a warm environment. After the experiment, euthanize the mice and remove their liver tissue. The liver tissue is then cryopreserved or fixed with paraformaldehyde solution.

[0007] Preferably, in step one, before mixing the VASN expression fragment containing the attL site with the expression vector containing the attR site, the VASN expression fragment containing the attL site amplified by two-step PCR is subjected to agarose gel electrophoresis. The gel block containing the target VASN expression fragment is excised under UV transilluminator, and the DNA in the gel block is extracted and purified using a silica gel centrifuge column method. The purified VASN expression fragment is then obtained by elution with nuclease-free water. The purified VASN expression fragment is then mixed with the expression vector containing the attR site at a molar ratio of 1.5:1 to 2.5:1 to form a reaction mixture, and the total DNA concentration of the reaction mixture is controlled to be 0.25 μg / μL–0.35 μg / μL. μg / μL; After adding the LR recombinase system containing Int, IHF, and Xis to the reaction mixture, the reaction system was pre-cooled in an ice-water bath for 10 minutes, and then transferred to a constant temperature metal bath and incubated at 25°C for 1 hour to complete the directed recombination; After the directed recombination was completed, 0.5 times the volume of the reaction system proteinase K solution was added to the reaction system, and the reaction was carried out at 37°C for 15 minutes to degrade the Int and IHF recombinases. 0.5 times the volume of the reaction system chloroform was added for extraction to remove the protease and lipids, and the pT3-EF1α-VASN plasmid was obtained by isopropanol precipitation.

[0008] Preferably, after obtaining the pT3-EF1α-VASN plasmid using the isopropanol precipitation method, 0.5 μg-1 μg of the plasmid is taken and transformed into E. coli DH5α competent cells, which are then plated on solid LB agar plates containing ampicillin and cultured at 37°C for 12-14 hours. Twenty single colonies are randomly selected from the culture plates and inoculated into liquid LB agar containing ampicillin, and cultured at 37°C and 200-220 °C. The bacterial culture was expanded in a shaker at rpm. Plasmid DNA was extracted from each single colony from the expanded culture. Paired-end sequencing was performed using primers that specifically recognize the open reading frame of the VASN gene and primers that recognize the multiple cloning site of the pT3-EF1α vector backbone. The sequencing results were compared with the VASN gene reference sequence and the pT3-EF1α vector sequence to screen for recombinant plasmid clones with completely correct inserted sequences and no nucleotide mutations or reading frame shifts. The bacterial culture corresponding to the clones was expanded and the plasmids were extracted. The purity was determined by ultraviolet spectrophotometry. The qualified pT3-EF1α-VASN plasmids were stored at -80℃ for later use.

[0009] Preferably, before step two, the following is also included: The LentiCRISPRv2-sgP53 plasmid, LentiCRISPRv2-sgPten plasmid, pT3-N90-β-catenin plasmid, pT3-EF1α-C-met plasmid, pT3-EF1α-VASN plasmid, and pCMV / SB11 transposase plasmid were purified by removing endotoxins to ensure that the endotoxin content of each plasmid was less than 0.1 EU / μg DNA.

[0010] Preferably, the directional recombination in step one is completed by incubation at 25°C for 1 hour.

[0011] Preferably, the mice mentioned in step three are SPF-grade 9-week-old male C57BL / 6J mice.

[0012] This invention includes at least the following beneficial effects: (1) By organically combining high-pressure hydrodynamic transfection technology, a specific combination of oncogenic plasmids and VASN overexpression plasmids, the entire process of model construction integrates the complete process steps from source plasmid preparation to final tissue collection. This enables the synergistic expression and knockout of multiple genes in adult mice with a complete immune system, constructing a liver cancer model that is highly similar to the pathogenesis of human liver cancer and has a typical morphology, effectively overcoming the differences between traditional models and humans in terms of immune microenvironment and tumorigenesis mechanism; (2) By using one-step LR recombination and subsequent strict purification, clone screening and sequence verification methods to construct V ASN overexpression plasmid significantly improves the accuracy and purity of specific target plasmid preparation, which can greatly reduce the probability of subsequent modeling failure due to insertion fragment errors or mutations, and provides reliable materials for model preparation; (3) By accurately setting the physical parameters of tail vein injection, puncture angle and pressure hemostasis, combined with dividing the liver tissue into multiple tissue blocks after injection and performing multi-dimensional pathological and molecular detection, the physical conduction path of the entire injection operation is more stable. At the same time, it is possible to obtain a complete dataset of RNA expression, protein abundance, cell morphological heterogeneity and immunohistochemical localization on the same experimental individual, which effectively improves the reproducibility of model construction. Attached Figure Description

[0013] Figure 1 This is a schematic diagram illustrating the principle of the method of the present invention; Figure 2 The values ​​represent the body weight, liver weight, and liver specific gravity of a mouse liver cancer model; among which, Figure 2 A represents the mouse's body weight. Figure 2 B represents the liver weight of the mouse. Figure 2 C represents the specific gravity of the mouse liver; Figure 3 This image shows the gross appearance of the liver and the results of HE pathological staining in a mouse hepatocellular carcinoma model; among them... Figure 3AD represents the HE staining results of liver tissues from the NC group, HCC group, VASN-OE group, and VASN-CKO group (4×). Figure 3 EH represents the HE staining results of the above four groups of liver tissues (10×). Figure 3 IL represents the gross appearance of the liver in the four groups mentioned above; Figure 4 In a high-pressure hydrodynamic mouse model of liver cancer Vasn Relative expression level of mRNA; Figure 5 Immunohistochemical detection and scoring of VASN protein in a high-pressure hydrodynamic mouse model of liver cancer; among which, Figure 5 A represents the immunohistochemical results of the NC group mice. Figure 5 B represents the immunohistochemical results of the HCC group mice. Figure 5 C represents the immunohistochemical results of the VASN-OE group mice. Figure 5 D represents the immunohistochemical results of the VASN-CKO group mice. Figure 5 E is a bar chart of the VASN immunohistochemical scores of the four groups of liver tissues mentioned above. Detailed Implementation

[0014] The present invention will now be described in further detail with reference to the accompanying drawings, so that those skilled in the art can implement it based on the description.

[0015] like Figure 1 As shown, the method for preparing a mouse liver cancer model by hydrodynamic transfection provided by the present invention includes the following steps: Step 1: Mix the VASN expression fragment containing the attL site with the expression vector containing the attR site, and add the LR recombinase system containing Int, IHF, and Xis. Incubate at 25°C for 1 hour to complete the directional recombination and obtain the pT3-EF1α-VASN plasmid.

[0016] Based on the principle of the phage att site-specific recombination system, a target plasmid, pT3-EF1α-VASN plasmid, was constructed to specifically overexpress the VASN protein in mouse liver. First, a VASN expression fragment containing the attL site was prepared. The attL site is a specific DNA sequence recognized by recombinase and undergoing crossover. Simultaneously, an expression vector containing the attR site was prepared. The attR site is also a specific sequence for recombinase binding and directional recombination. The VASN expression fragment carrying the attL site and the expression vector carrying the attR site were mixed to form a reaction system. Then, an LR recombinase system containing Int, IHF, and Xis was added. Int is a phage-encoded integrase responsible for catalyzing DNA strand breakage and rejoining; IHF is an integrative host factor that assists Int in binding to the target site and promotes DNA strand bending, ensuring correct alignment of the attL and attR sites; and Xis is an excision enzyme that guides the reaction in the correct direction during the LR recombination reaction. The three enzymes work synergistically to achieve precise site-specific recombination between the attL and attR sites. The reaction system was incubated at 25°C for 1 hour to ensure recombinase activity and avoid DNA denaturation and enzyme inactivation caused by high temperature. One hour of incubation was sufficient for the recombination reaction to proceed fully and achieve high recombination efficiency. After directional recombination, the pT3-EF1α-VASN recombinant plasmid was obtained, with the VASN expression fragment correctly linked to the vector backbone. This plasmid contains the EF1α promoter, which can drive the continuous and efficient transcriptional expression of the downstream VASN gene in mouse liver cells.

[0017] Step 2: LentiCRISPRv2-sgP53 plasmid, LentiCRISPRv2-sgPten plasmid, pT3-N90-β-catenin plasmid, pT3-EF1α-C-met plasmid, pT3-EF1α-VASN plasmid and pCMV / SB11 transposase plasmid are mixed in a mass ratio of 2:2:2:2:2:1 and sterile Ringer's solution is used as solvent to prepare a mixed plasmid solution with a total concentration of 6.6 μg / mL.

[0018] A mixture of plasmids with different biological functions that synergistically drive liver cancer development was prepared to create a mixed plasmid solution for in vivo transfection. Specifically, LentiCRISPRv2-sgP53 plasmid, LentiCRISPRv2-sgPten plasmid, pT3-N90-β-catenin plasmid, pT3-EF1α-C-met plasmid, pT3-EF1α-VASN plasmid constructed in step one, and pCMV / SB11 transposase plasmid were added to the same reaction vessel at a mass ratio of 2:2:2:2:2:1. Specifically, the LentiCRISPRv2-sgP53 and LentiCRISPRv2-sgPten plasmids were used to knock out the tumor suppressor genes P53 and Pten in mouse hepatocytes using the CRISPR / Cas9 system, respectively; the pT3-N90-β-catenin and pT3-EF1α-C-met plasmids were used to overexpress the persistently activating β-catenin mutant and the C-met proto-oncogene, respectively, and their abnormal activation could promote hepatocyte proliferation and induce malignant transformation; the pT3-EF1α-VASN plasmid was used to overexpress the VASN protein, which plays a regulatory role in tumor angiogenesis and cellular stress response; the transposase encoded by the pCMV / SB11 plasmid can recognize the terminal repeat sequences of transposons on both sides of the pT3 series plasmids, and efficiently integrate the oncogene expression cassette carried by the transposon into the mouse hepatocyte genome, ensuring the stable transcription of exogenous genes. Using an appropriate mass ratio ensures efficient transposase catalysis while maintaining the synergistic effect of various oncogenes, thus maintaining the expression levels of exogenous genes in a balance conducive to the induction and progression of liver cancer. Sterile Ringer's solution is used as the solvent to dissolve the mixed plasmids. Ringer's solution is an isotonic equilibrium salt solution with an ionic composition similar to that of mammalian extracellular fluid, preventing non-specific damage to hepatocytes or vascular endothelial cells due to osmotic pressure differences. Furthermore, its sodium, potassium, and calcium ions maintain normal cellular physiological electrical activity. After dissolution, the solution is thoroughly shaken and mixed, precisely controlling the total concentration to 6.6 μg / mL. This concentration ensures sufficient gene copy number to enter hepatocytes for effective expression while avoiding excessively high plasmid DNA concentrations that could increase solution viscosity, thereby affecting fluid flow and high-pressure delivery efficiency during tail vein injection. The resulting solution is the mixed plasmid solution for subsequent injection.

[0019] Step 3: Select SPF-grade 9-week-old male C57BL / 6J mice and inject the mixed plasmid solution into the mice via the tail vein within 5 seconds at an injection dose of 0.1 mL / g body weight.

[0020] The prepared mixed plasmid solution was introduced into the liver system of SPF-grade 9-week-old male C57BL / 6J mice using high-pressure hydrodynamic tail vein injection. The selection of SPF-grade mice ensures that the experimental animals are raised under specific pathogen-free conditions, avoiding interference from potential infection-induced liver inflammation or immune status changes that could affect the modeling results. Nine-week-old male C57BL / 6J mice were chosen because they are adults with normal liver metabolic function, and their tail veins are mature and elastic, facilitating puncture. Compared to female mice, the incidence of liver cancer in male mice is more consistent with that in human males, making them more suitable for studying the pathogenesis of liver cancer. The injection dose was strictly calculated according to the standard of 0.1 mL / g body weight, approximately 10% of the mouse's body weight. Injecting such a large volume of fluid into the bloodstream in a short time would rapidly cause a transient increase in cardiac preload and inferior vena cava pressure. The tail vein was chosen as the injection route because it directly connects to the inferior vena cava, providing the most direct channel to the liver circulation. The injection was completed within 5 seconds, which is the time limit requirement for high-pressure hydrodynamic transfection. Injection within a very short time allows the blood system to be subjected to instantaneous fluid shock pressure, generating sufficiently high hydrostatic pressure that causes the injected solution to flow retrogradely into the liver. Due to the gaps between the endothelial cells of the hepatic sinusoidal capillaries and the discontinuity of the basement membrane, the high hydrostatic pressure can penetrate the capillary walls, forming transient micropores on the membranes of adjacent hepatocytes. This allows the target plasmids in the mixed plasmid solution to physically penetrate into the hepatocytes, thus completing in vitro DNA delivery. During this process, other organs such as the kidneys, lungs, and heart also receive small amounts of the injected fluid; however, due to the liver's unique anatomical structure with its dual blood supply, its transfection efficiency is far higher than that of other organs, thus achieving high selectivity for liver transfection.

[0021] Step 4: Place the mice that have completed the injection in Step 3 in a warm environment. After the experiment, euthanize the mice and remove their liver tissue. The liver tissue is then cryopreserved or fixed with paraformaldehyde solution.

[0022] After injection, the mice should be immediately placed in a warm environment. Throughout the entire feeding period from injection to the end of the experiment, the mice's weight and other physiological signs should be observed regularly. Once the experiment reaches the predetermined time point, the mice should be euthanized using methods commonly used in this field. Immediately after euthanasia, the intact liver tissue should be removed via laparotomy. This procedure must be performed quickly to avoid autolysis or enzymatic degradation. Subsequently, the removed liver tissue is processed according to the requirements of different subsequent detection indicators: one option is to aliquot the liver tissue into cryovials, flash-freeze it in liquid nitrogen, and then transfer it to a -80°C ultra-low temperature freezer for long-term storage, suitable for subsequent molecular biological detection such as RNA extraction and protein extraction; another option is to immerse the liver tissue in 10 times its volume of 4% paraformaldehyde solution. This reagent can form stable chemical bonds by cross-linking the aldehyde groups with the amino groups of proteins, thereby fixing the cell morphology and protein distribution within the liver tissue and maintaining good structural integrity during subsequent paraffin embedding, sectioning, and various staining operations.

[0023] By implementing the above steps, this method can successfully prepare a tissue model with typical mouse hepatocellular carcinoma characteristics. Through efficient recombination to construct specific overexpression plasmids, combined with a multi-gene synergistic knockout and overexpression strategy, exogenous genes are delivered to hepatocytes via physical high-pressure shock. Finally, experimental materials are obtained through standardized sample collection and processing. The entire technical solution constitutes a complete and reproducible process for preparing a mouse hepatocellular carcinoma model. This process not only enables controlled research on the role of VASN protein in hepatocellular carcinoma induction, but also simulates the pathophysiological process of multi-gene-driven pathogenesis and cellular microenvironment interactions in human hepatocellular carcinoma by simultaneously knocking out P53 and Pten and overexpressing β-catenin, C-met, and VASN. This provides a stable and reliable animal model platform for elucidating the pathogenesis of hepatocellular carcinoma and for researching anti-hepatocellular carcinoma drugs.

[0024] To further illustrate the significant effectiveness of the technical solution of this application, the following embodiments are provided: Example 1

[0025] This embodiment provides a method for extracting various plasmids for high-pressure hydrodynamic transfection to ensure the quality and purity of plasmid solutions for subsequent injection.

[0026] First, the bacterial strains were revived and amplified. Engineered bacterial strains carrying LentiCRISPRv2-sgP53, LentiCRISPRv2-sgPten, pT3-N90-β-catenin, pT3-EF1a-C-met, pT3-EF1α-VASN, pCMV / SB11, and their corresponding empty vectors were streaked onto solid LB agar plates containing ampicillin at a working concentration of 100 μg / mL. Single colonies grown on the plates were selected and inoculated into liquid LB agar plates, and cultured at 37°C and 250 rpm for 12 hours with shaking for large-scale amplification.

[0027] After the bacterial culture was fully amplified, large-scale plasmid extraction and purification were performed. 200 mL of the amplified bacterial culture was centrifuged at 4000 × g for 10 minutes at room temperature, and the bacterial pellet was collected. The supernatant was discarded, and 10 mL of Solution I / RNase A solution was added. The pellet was resuspended completely by pipetting. Then, 10 mL of Solution II solution was added, and the mixture was gently inverted 10 times. The mixture was allowed to stand at room temperature for 2-3 minutes to allow for complete lysis. Next, 5 mL of pre-chilled N3 Buffer solution was added, and the mixture was gently inverted several times until a white flocculent precipitate appeared. The precipitate was allowed to stand at room temperature for 2 minutes to neutralize completely. The lysate was centrifuged at 8000 × g for 10 minutes at 4°C, and the supernatant was collected.

[0028] Prepare the filtration apparatus. Take a filter syringe, pull out the stopcock, place the syringe vertically on a 50 mL centrifuge tube rack, and cap the syringe outlet with the blue cap. Take a binding column, add 5 mL of Buffer GPS to the column, incubate at room temperature for 3 to 10 minutes, then centrifuge at 3000 to 5000 × g for 5 minutes, and discard the filtrate. Add 10 mL of sterile water to the column, centrifuge, discard the filtrate, and insert the column into a 50 mL collection tube. Pour the supernatant of the centrifuged lysate into the filter syringe, and slowly push the stopcock to allow the liquid to pass through the filter. Add 0.1 times the volume of ETR Solution to the filtered filtrate, invert and mix 10 times, incubate on ice for 10 minutes, inverting and mixing twice during this period, until the lysate becomes clear. Heat the lysate in a 42°C water bath for 5 minutes, until the lysate becomes cloudy. Centrifuge at 4000×g for 5 minutes at 25℃, take the supernatant, add 0.5 times the volume of anhydrous ethanol, gently invert and mix 6 to 7 times, and let stand at room temperature for 2 minutes.

[0029] Insert the HiBind DNA Maxi Column into a 50 mL collection tube. Add 3 mL of GPS Buffer to the HiBind DNA Maxi Column, incubate at room temperature for 4 minutes, then centrifuge at 4000×g for 3 minutes at room temperature and discard the filtrate. Transfer no more than 20 mL of the mixture to the HiBind DNA Maxi Column, centrifuge at 4000×g for 3 minutes at room temperature and discard the filtrate. Repeat this process until all the mixture is bound to the column. Then, insert the HiBind DNA Maxi Column back into the same collection tube, add 10 mL of HBC Buffer, centrifuge at 4000×g for 3 minutes at room temperature and discard the filtrate. Add 15 mL of DNA Wash Buffer, centrifuge at 4000×g for 3 minutes at room temperature and discard the filtrate. Wash once more with 10 mL of DNA Wash Buffer. Insert the HiBind DNA Maxi Column back into the same collection tube and centrifuge at 4000×g for 10 minutes at room temperature to dry the column matrix. Insert the HiBind DNA Maxi Column into a new 50 mL collection tube, add 1 to 3 mL of Endo-free Elution Buffer to the column matrix, incubate at room temperature for 5 minutes, centrifuge at 4000×g for 5 minutes, and elute to collect the plasmid DNA. Store the eluted plasmid DNA at -20℃ for later use.

[0030] Example 2

[0031] This embodiment demonstrates a specific method for constructing a mouse liver cancer model using high-pressure hydrodynamic transfection technology combined with a specific plasmid combination, and verifies the effect of VASN overexpression on liver cancer model formation through group comparison.

[0032] SPF-grade 9-week-old male C57BL / 6J mice were used in the experiment. The oncogenic plasmids LentiCRISPRv2-sgP53, LentiCRISPRv2-sgPten, pT3-N90-β-catenin, and pT3-EF1a-C-met were mixed with the transposase plasmid pCMV / SB11 at a mass ratio of 2:2:2:2:1 and dissolved in sterile Ringer's solution to prepare a solution with a total concentration of 5.4 μg / mL. The solution was rapidly injected via the tail vein over 5 seconds at a dose of 0.1 mL / g body weight.

[0033] To investigate the role of the VASN gene in the development and progression of hepatocellular carcinoma (HCC), 18 mice were randomly divided into three groups: (1) empty vector control group (NC group, n=6), which was injected with empty vector plasmids LentiCRISPRv2, pT3-EF1a and pCMV / SB11 mixture according to the same dose and method; (2) HCC model group (HCC group, n=6), which was injected with the above-mentioned carcinogenic plasmid mixture; (3) VASN overexpression + HCC model group (VASN-OE group, n=6), which added an equal amount of VASN overexpression plasmid pT3-EF1α-VASN to the HCC group plasmid system. In addition, 6 SPF-grade 9-week-old mice with conditional liver cancer were also included. Vasn Knockout mice were designated as the fourth group: (4) conditional VASN knockout + liver cancer model group (VASN-CKO group, n=6), which were injected with the carcinogenic plasmid mixture from group (2) above. Except for the plasmid composition, the injection dosage and method were consistent among the groups. After injection, the mice were placed in a warm environment to avoid death.

[0034] During the experiment, the mice's weight changes were recorded weekly, and their coat condition, mental state, and food intake were closely observed. After the experiment, all mice were euthanized by carbon dioxide asphyxiation and bled out via cardiac puncture. Once the circulating blood was largely drained, the liver tissue was immediately harvested via abdominal dissection. The liver tissue was processed according to the requirements of subsequent experiments: one portion was stored at -80℃, and the other portion was fixed in 10 times its volume of 4% paraformaldehyde solution.

[0035] Experimental results are as follows Figure 2 As shown, where A: mouse body weight; B: mouse liver weight; C: mouse liver specific gravity; Note: ns P >0.05, ** P <0.01, *** P <0.001, **** P <0.0001. Comparison of body weight, liver weight, and liver specific gravity among the groups of mice revealed: Figure 2 As shown in A, the VASN-CKO group had a lower body weight than the other three groups. P <0.01); Figure 2 The results show the body weight, liver weight, and liver specific gravity of mice in each group, such as... Figure 2 As shown in B and C, in terms of liver weight and liver specific gravity, the HCC group and VASN-OE group were significantly higher than the VASN-CKO group and NC group. P <0.001), while there was no statistically significant difference between the VASN-CKO group and the NC group ( P >0.05). These results indicate that VASN overexpression can lead to liver lesions and an increase in liver weight and liver proportion; while liver... VasnConditional gene knockout suppressed weight gain in mice without causing death.

[0036] Example 3

[0037] This embodiment performs pathological analysis of a mouse liver cancer model. The liver tissue prepared in Example 2 is used to prepare pathological sections and perform HE staining to verify the histological characteristics of the liver cancer model.

[0038] First, paraffin sections were prepared. The fixed tissue block was placed in an embedding cassette and rinsed with running water for 30 minutes. Then, it underwent graded dehydration with ethanol, clearing with xylene, and paraffin infiltration. The tissue was placed in an embedding mold, 2-3 drops of paraffin were added, and the mold was fixed on a cooling stage for 10 seconds. After the mold was filled, more paraffin was added, and the mixture was cooled for 1 hour. The solidified paraffin tissue block was removed from the embedding frame and cut into uniform paraffin sections with a thickness of 3-5 μm using a microtome. The cut paraffin sections were flattened in a water bath at approximately 45-50°C, retrieved using a glass slide and numbered. After baking at 60°C for 4-6 hours, they were stored in a desiccator.

[0039] HE staining was performed. Tissue sections were baked at 60°C for 15 minutes, then dewaxed by immersing them sequentially in xylene I and xylene II solutions for 10 minutes each. Subsequently, the sections were hydrated by immersing them sequentially in a gradient of 100%, 95%, 90%, and 75% ethanol for 3 minutes each, followed by rinsing three times with double-distilled water for 2 minutes each. The sections were then stained with hematoxylin dye for 3 to 5 minutes, followed by rinsing twice with double-distilled water for 2 minutes each. The sections were then treated with 1% hydrochloric acid-alcohol differentiation solution for 5 to 10 seconds, followed by rinsing with tap water. They were then blued again with tap water for 5 minutes. The sections were stained with eosin for 2 to 3 minutes, followed by rinsing with distilled water for 2 to 3 seconds. The sections were then rapidly dehydrated sequentially by immersing them in 75%, 85%, 95%, 100% ethanol I, and 100% ethanol II solutions for 2 seconds each, followed by immersion in xylene I and xylene II solutions for 2 minutes each. The sections were mounted with neutral resin, allowed to air dry, and then observed and photographed under a microscope for analysis.

[0040] like Figure 3The images show the liver appearance and HE staining results of mice in each group. The results indicate that the livers of mice in the NC group showed typical lobular structures, regular arrangement of hepatic cords and sinusoids, and centrally located, round hepatocyte nuclei with eosinophilic cytoplasm. Both the HCC and VASN-OE groups showed clearly visible grayish-white spherical nodules in their livers. Specifically, compared to the NC group, the livers of both groups were significantly enlarged, with a rough surface and numerous grayish-white spherical tumor-like nodules ranging in diameter from 0.5 to 8 mm. The lesions were more pronounced in the VASN-OE group. HE staining revealed that the normal liver structure of both the HCC and VASN-OE groups was disrupted, and microscopic examination revealed obvious tumor cell nests, exhibiting highly malignant hepatocellular carcinoma pathological characteristics, including significant nuclear atypia, frequent mitotic figures, multiple nucleoli, and disordered cell arrangement. Furthermore, compared to the HCC group, the VASN-OE group showed a significant increase in hepatocyte steatosis. In the VASN-CKO group, the liver appearance was nearly normal, with only occasional extremely small white spots (<0.5 mm in diameter). HE staining showed that the liver tissue structure was basically intact, with regular arrangement of hepatic cords and sinusoids. Only scattered inflammatory necrosis was observed, and no tumor cell nesting was observed. These results indicate that a mouse model of hepatocellular carcinoma was successfully established using high-pressure hydrodynamic transfection technology; VASN overexpression can accelerate the malignant progression of hepatocellular carcinoma, while conditional knockout of the liver... Vasn Genes can resist malignant transformation of hepatocytes induced by oncogenic plasmids.

[0041] Example 4

[0042] This embodiment uses a mouse liver cancer model. Vasn The expression levels of mRNA and VASN protein were detected in the liver tissues of mice in each group using real-time quantitative PCR technology. Vasn The mRNA expression level of the gene was measured, and the VASN protein expression level was detected by immunohistochemistry to evaluate the model construction effect and the impact on VASN expression regulation.

[0043] Total RNA was extracted from liver tissue using the Trizol method. Liver tissues from each group were collected separately, and 0.5 mL of Trizol lysis buffer was added. The tissues were thoroughly lysed by pipetting and mixing. 1 / 5 volume of chloroform was added, and the mixture was inverted 20 times, incubated at room temperature for 5 minutes, and then centrifuged at 12000g for 10 minutes at 4°C. The supernatant was transferred to a new 1.5 mL EP tube, and an equal volume of isopropanol was added. The mixture was inverted and mixed, incubated at room temperature for 5 minutes, and then centrifuged at 12000g for 10 minutes at 4°C. The supernatant was discarded, and the precipitate was washed with 1 mL of freshly prepared 75% ethanol. The precipitate was incubated at room temperature for 5 minutes, and the supernatant was discarded. This washing process was repeated once. The precipitate was air-dried in a clean bench for 10 minutes, and 30 to 100 μL of RNase-free ddH2O was added to dissolve the RNA precipitate. 2 μL of RNA sample was used for concentration determination; an OD260 / 280 ratio between 1.9 and 2.2 was considered a complete RNA sample. An appropriate amount of RNA sample was subjected to 1% agarose gel electrophoresis. The appearance of two clear 28S and 18S bands with a ratio of approximately 2:1 indicates that the RNA is of good integrity.

[0044] RNA reverse transcription was performed. The 10 μL reaction mixture contained 500 ng Total RNA, 2 μL 5×PrimeScriptRT Master Mix, and RNase-free dH2O to a final volume of 10 μL. After gentle mixing, reverse transcription was performed at 37°C for 15 minutes, followed by enzyme inactivation at 85°C for 5 seconds, and then stored at 4°C.

[0045] Real-time quantitative PCR was performed. The amplification reaction system was prepared according to the kit instructions. The reaction conditions were: pre-denaturation at 95°C for 30 seconds, denaturation at 95°C for 5 seconds, annealing / extension at 60°C for 34 seconds, for a total of 40 cycles. Mouse Gapdh was used as an internal control gene. Vasn The primer sequences are: Forward primer CACCGTACTATCGACTGCCC, Reverse primer AGTACAGGCCAATGAAGCCC. A 2-phase primer was used. -ΔΔCt The relative expression level is calculated using this method.

[0046] Figure 4 The liver tissue of mice in each group was shown Vasn The relative expression levels of mRNA were detected, and the results showed that, compared with the NC group, the liver tissues of the HCC group and the VASN-OE group, which had developed tumor space-occupying lesions, showed significantly higher levels. Vasn mRNA significantly increased ( P <0.05, while the VASN-CKO group without tumor space-occupying lesions showed a decrease ( P<0.05). The HCC and VASN-OE groups showed significantly higher expression levels than the NC group, while the VASN-CKO group showed significantly lower expression levels than the NC group. These results indicate that elevated VASN expression levels were also observed in the mouse hepatocellular carcinoma model constructed by high-pressure hydrodynamic transfection, and that VASN molecular expression levels are closely related to the occurrence and development of hepatocellular carcinoma. VASN overexpression can promote the occurrence and malignant progression of hepatocellular carcinoma, while conditional knockout of VASN... Vasn Genes can significantly inhibit the formation of liver cancer.

[0047] Immunohistochemical staining was performed to detect VASN protein expression levels. Prepared paraffin sections were stained with anti-VASN (1:200, Biorbyt) as the primary antibody and incubated overnight at 4°C in a humidified chamber. Then, HRP-labeled goat anti-rabbit IgG secondary antibody was added, and the reaction was carried out at 37°C for 20 minutes. Random areas were photographed using a Nikon inverted microscope, and integrated optical density values ​​were measured in ImageJ software for immunohistochemical scoring. Figure 5 As shown, the immunohistochemical staining results and scores of VASN protein in the liver tissue of mice in each group were obtained. The results showed that the expression level of VASN protein in the liver tissue of the VASN-OE group was significantly higher than that in the HCC group. P <0.05, indicating that the exogenous VASN overexpression plasmid was successfully expressed in the liver in vivo; the VASN protein expression level in the liver tissue of mice in the VASN-CKO group was lower than that in the NC group ( P The score <0.01 indicates that the VASN-CKO group achieved effective hepatic VASN gene knockdown. Among the groups, the VASN-OE group showed the deepest staining and highest score, while the VASN-CKO group showed the lightest staining and lowest score. These results demonstrate that VASN expression levels are also elevated in mouse hepatocellular carcinoma transfected by high-pressure hydrodynamics; VASN molecular expression levels are closely related to the occurrence and development of hepatocellular carcinoma, and VASN overexpression can promote the occurrence and malignant progression of hepatocellular carcinoma, while conditional knockdown of the liver... Vasn Genes can significantly inhibit the formation of liver cancer.

[0048] In another technical solution, before mixing the VASN expression fragment containing the attL site with the expression vector containing the attR site in step one, the VASN expression fragment containing the attL site, amplified by a two-step PCR method, is subjected to agarose gel electrophoresis. The gel block containing the target VASN expression fragment is excised under UV transilluminator, and the DNA in the gel block is extracted and purified using a silica gel centrifuge column method. The purified VASN expression fragment is then eluted with nuclease-free water to obtain the purified VASN expression fragment. The purified VASN expression fragment is mixed with the expression vector containing the attR site at a molar ratio of 1.5:1 to 2.5:1 to form a reaction mixture, and the total DNA concentration of the reaction mixture is controlled to be 0.25 μg / μL–0.35 μg / μL. μg / μL; After adding the LR recombinase system containing Int, IHF, and Xis to the reaction mixture, the reaction system was pre-cooled in an ice-water bath for 10 minutes, and then transferred to a constant temperature metal bath and incubated at 25°C for 1 hour to complete the directed recombination; After the directed recombination was completed, 0.5 times the volume of the reaction system proteinase K solution was added to the reaction system, and the reaction was carried out at 37°C for 15 minutes to degrade the Int and IHF recombinases. 0.5 times the volume of the reaction system chloroform was added for extraction to remove the protease and lipids, and the pT3-EF1α-VASN plasmid was obtained by isopropanol precipitation.

[0049] The VASN expression fragment containing the attL site used in the LR recombination reaction was pre-purified to ensure its purity met the requirements of the subsequent recombinase reaction. First, the VASN expression fragment containing the attL site obtained by two-step PCR amplification inevitably introduces primer dimers, non-specific small fragments, dNTPs, and high concentrations of salt ions into the PCR system. These impurities interfere with recombinase activity. Therefore, the amplification products were separated by agarose gel electrophoresis, using an electric field to physically separate DNA fragments of different lengths according to their molecular weight in the gel medium. After electrophoresis, under UV transmission, the gel bands containing the target VASN expression fragment of corresponding length were accurately identified and excised, excluding contamination from adjacent non-target bands. Subsequently, the excised gel was extracted and purified using a silica gel membrane centrifuge column method. The silica gel membrane specifically adsorbs DNA molecules in a high-salt buffer environment, while impurities such as proteins and sugars are eluted away. Combined with multiple centrifugation and washing operations, residual gel particles and inhibitors in the PCR reaction solution were effectively removed. Finally, the DNA adsorbed on the membrane was eluted using nuclease-free ultrapure water to obtain a high-purity linear VASN expression fragment.

[0050] The purified VASN expression fragment was mixed with the expression vector containing the attR site at a specific molar ratio to ensure a sufficient probability of effective collision between the insert fragment and the vector backbone. In this protocol, the molar ratio ranged from 1.5:1 to 2.5:1. If the fragment concentration in the experimental system was too high or too low, intermediate values ​​such as 1.8:1 or 2.2:1 could be chosen to encourage the reaction to generate the correct recombinant product and avoid vector self-ligation or the formation of polymers. Simultaneously, the total DNA concentration of the reaction mixture was strictly controlled between 0.25 μg / μL and 0.35 μg / μL. If the total DNA concentration was too high, the system viscosity increased, hindering the diffusion of the recombinase in solution and making it difficult to bind to the substrate; conversely, if the total DNA concentration was too low, the collision frequency between the enzyme molecule and the substrate decreased, causing the recombinant reaction to fail to complete within the expected time. Before formally adding the LR recombinase system containing Int, IHF, and Xis to the above reaction mixture, the entire reaction system could be pre-cooled in an ice-water bath for 10 minutes. Pre-cooling ensures that the DNA molecules and components in the mixed reaction solution reach a uniform low temperature, preventing uneven heating caused by sudden temperature changes during subsequent transfer to the constant-temperature metal bath, which could affect the balanced expression of enzyme activity. After pre-cooling, the reaction system is transferred to a pre-set 25°C constant-temperature metal bath for 1 hour to complete the directed recombination. Compared to a regular water bath, the constant-temperature metal bath provides a more precise and uniform temperature control environment, ensuring that the temperature inside all reaction tubes remains constant at 25°C throughout the incubation process. It should be noted that if the ambient temperature is low or the laboratory ventilation is poor, the incubation time may be adjusted according to the actual recombination efficiency.

[0051] After recombination incubation, 0.5 times the volume of proteinase K solution is added to the reaction system to cleave the peptide bonds of recombinant proteins such as Int, IHF, and Xis, completely inactivating them and degrading them into short peptide chains, thereby eliminating the interference of these proteins on subsequent transformation experiments. The proteinase K digestion reaction can be carried out at 37℃ for 15 minutes, which can be appropriately extended or shortened as needed. Subsequently, 0.5 times the volume of chloroform solution is added to the reaction system for liquid phase extraction to dissolve residual proteases, lipids, and impurity proteins, retaining the DNA in the aqueous phase. Thorough shaking and centrifugation effectively separate the aqueous and organic phases, discarding the organic phase and interfacial impurity layer, retaining the upper aqueous phase. Finally, an equal volume of isopropanol is added to the collected aqueous solution for precipitation. In the presence of salt, DNA molecules aggregate to form a visible flocculent precipitate. The precipitate is collected by centrifugation, washed with 70% ethanol to remove residual salt, and dried to obtain a high-purity, protein-free pT3-EF1α-VASN plasmid. Through a series of pre-purification and post-processing operations, inhibitory factors can be reduced from the source of the reaction, so that the final pT3-EF1α-VASN plasmid achieves a good balance between quality and yield, providing sufficient and high-purity substrate raw materials for in vivo transfection experiments.

[0052] In another technical approach, after obtaining the pT3-EF1α-VASN plasmid using the isopropanol precipitation method, 0.5 μg-1 μg is taken from it and transformed into E. coli DH5α competent cells, which are then plated on solid LB agar plates containing ampicillin and cultured at 37°C for 12-14 hours. Twenty single colonies are randomly selected from the culture plates and inoculated into liquid LB agar containing ampicillin, and then cultured at 37°C at 200-220 °C. The bacterial culture was expanded in a shaker at rpm. Plasmid DNA was extracted from each single colony from the expanded culture. Paired-end sequencing was performed using primers that specifically recognize the open reading frame of the VASN gene and primers that recognize the multiple cloning site of the pT3-EF1α vector backbone. The sequencing results were compared with the VASN gene reference sequence and the pT3-EF1α vector sequence to screen for recombinant plasmid clones with completely correct inserted sequences and no nucleotide mutations or reading frame shifts. The bacterial culture corresponding to the clones was expanded and the plasmids were extracted. The purity was determined by ultraviolet spectrophotometry. The qualified pT3-EF1α-VASN plasmids were stored at -80℃ for later use.

[0053] After obtaining the initial pT3-EF1α-VASN plasmid using isopropanol precipitation, a very small amount of non-target circular DNA or incompletely closed linear DNA may still remain in the precipitation product. Therefore, further biological transformation combined with a rigorous colony screening process is required to finally confirm the plasmid clone with the correct sequence. The specific procedures are as follows: Accurately measure 0.5 μg to 1 μg of the initial plasmid product and add it to a centrifuge tube containing frozen E. coli DH5α competent cells. A DNA input of 0.5 μg to 1 μg is suitable for this transformation experiment. If the input is less than 0.5 μg, the transformant yield may be insufficient due to an inadequate absolute copy number of the plasmid; if the input is more than 1 μg, the excess DNA will saturate the pores of the competent cell membrane, thus reducing the effective transformation efficiency of single-stranded DNA penetrating the cell membrane. In practice, the input is generally 0.6 μg or 0.8 μg. During transformation, after mixing the DNA with the competent cells, incubate on ice for about 30 minutes, followed by heat shock treatment. Perform precise heat shock in a 42°C water bath for 45-90 seconds to momentarily permeate the cell membrane and allow exogenous DNA to enter. Then, quickly transfer to an ice bath for cooling.

[0054] After heat shock, the transformation mixture is evenly spread onto solid LB agar plates containing 100 μg / mL ampicillin. Ampicillin specifically kills E. coli that have not successfully ingested the ampicillin resistance gene plasmid, thus achieving forward selection of positive transformants. The plates are incubated at 37°C for 12-14 hours to allow single colonies to grow to a size easily visible to the naked eye. Insufficient incubation time results in colonies that are too small to pick; excessive incubation time may cause colonies to merge, making it impossible to distinguish individual clones. In actual incubation, if the laboratory temperature is low, the incubation time can be extended to approximately 15 hours.

[0055] After culturing, a suitable number of single isolated colonies are randomly picked from solid LB agar plates for further identification. To ensure the reliability of sequencing verification results, the number of single colonies picked is set at 20, which is sufficient to cover most possible positive transformation types and avoid missing correct recombinant plasmids due to insufficient picking. Each picked single colony is inoculated into liquid LB medium containing ampicillin and cultured at 37°C in a constant temperature shaker at 200 to 220 rpm. The culture period is usually 8 to 12 hours, until the bacterial culture reaches the appropriate turbidity for late logarithmic growth. After bacterial amplification, plasmid DNA is extracted from the corresponding single colony from each culture tube. The specific extraction method can be followed according to the instructions of the endotoxin-free plasmid mass extraction kit (e.g., Omgea, D6929-04). Paired-end sequencing verification is then performed to ensure the accuracy of plasmid construction. Two primers were used for sequencing: one primer specifically recognizing the open reading frame (OPF) of the VASN gene, annealed to both ends of the VASN coding region, allowing direct determination of the internal sequence of the insert fragment; the other primer recognizing both ends of the multiple cloning site on the pT3-EF1a vector backbone, annealed to the upstream and downstream regions of the multiple cloning site, used to determine the sequence at the junction of the insert fragment and the vector backbone. The sequencing results of both primer sets were compared one-to-one with the VASN gene reference sequence and the pT3-EF1a vector sequence using local sequence alignment software. Only when the sequencing results at both ends showed that the insert fragment sequence was completely identical to the reference sequence, and there were no base deletions or extra insertions at the junction of the insert fragment and the vector, nor any mutations causing reading frame shifts, was the clone considered a correct recombinant plasmid clone.

[0056] After obtaining the correct plasmid clone, the corresponding preservative bacterial culture was scaled up on a large scale. Sufficient plasmid was extracted using a plasmid extraction kit (e.g., Omgea D6929-04, USA, following the manufacturer's instructions). The A260 / A280 absorbance ratio of the plasmid solution was then measured using UV spectrophotometry to determine its purity. If the A260 / A280 ratio was within the normal range, it indicated that protein and phenolic impurities in the plasmid had been adequately removed, and the purity met the requirements for subsequent in vivo injection. The qualified pT3-EF1α-VASN plasmid was aliquoted according to the single-experiment dosage and stored at -80°C to inhibit DNA hydrolysis and degradation. Through rigorous clone screening, sequence verification, and purity control procedures, the pT3-EF1α-VASN plasmid used in subsequent mouse experiments was ensured to have high certainty in terms of sequence structure and molecular integrity, avoiding abnormal VASN protein expression or the generation of unexpected mutant proteins in subsequent transfection experiments due to sequence errors in the plasmid itself.

[0057] In another technical approach, in step three, before injection, the mouse is transferred to an animal adaptation room with a constant temperature of 23-25℃ and a constant humidity of 50%-60% and placed for 6 hours. During injection, residual air is expelled from the syringe, ensuring the bevel of the needle aligns with the direction of the mouse's tail vein, forming a 35°-45° angle with the skin surface of the mouse's tail. The needle is inserted subcutaneously and advanced 2-3 mm along the vein until blood is observed flowing back into the syringe upon aspiration. During injection, an auxiliary clamp is used to hold and fix the mouse's tail, keeping it in contact with the operating table. A heated light source is used to irradiate the base of the mouse's tail to dilate the tail vein. After the mixed plasmid solution is injected at a constant flow rate, the needle is removed, and sterile gauze is applied to the tail vein puncture site for 3 minutes. This injection protocol effectively reduces the risk of high-pressure fluid leakage due to puncture errors, vasospasm, or local hematoma, significantly improving the reliability and consistency of high-pressure hydrodynamic transfection in mice.

[0058] In another technical solution, in step four, after harvesting mouse liver tissue, the liver tissue is divided into a first tissue block, a second tissue block, a third tissue block, and a fourth tissue block; the first tissue block is placed in an RNA preservation solution for preservation, and total RNA is extracted and detected by real-time quantitative PCR. Vasn The relative expression level of mRNA was measured. The second tissue block was preserved in protein lysis buffer, and total protein was extracted. The gray values ​​of VASN protein, β-catenin protein, and C-Met protein bands were detected by Western blotting. The third tissue block was fixed in 4% paraformaldehyde solution and prepared into paraffin sections. The paraffin sections were stained with hematoxylin and eosin (HE). The ratio of the nuclear area to the cytoplasmic area of ​​the tumor region in the HE-stained sections was measured using a microscopic imaging system to quantitatively characterize the degree of cellular atypia in the liver tissue of the hepatocellular carcinoma model. The fourth tissue block was embedded in embedding medium and prepared into frozen sections. The frozen sections were stained with immunohistochemistry, and the integrated optical density value corresponding to VASN protein in the immunohistochemically stained sections was measured using image analysis software to quantitatively characterize the protein expression abundance in the liver tissue of the hepatocellular carcinoma model.

[0059] In another technical solution, prior to step two, the following is also included: The LentiCRISPRv2-sgP53 plasmid, LentiCRISPRv2-sgPten plasmid, pT3-N90-β-catenin plasmid, pT3-EF1α-C-met plasmid, pT3-EF1α-VASN plasmid, and pCMV / SB11 transposase plasmid were purified by removing endotoxins to ensure that the endotoxin content of each plasmid was less than 0.1 EU / μg DNA.

[0060] Endotoxins are lipopolysaccharide components of the cell walls of Gram-negative bacteria, released during plasmid extraction accompanied by bacterial lysis. If they remain in the plasmid solution and are injected into mice, they strongly activate the immune response of macrophages and dendritic cells, triggering a cytokine storm. This not only interferes with the natural progression of liver tumors but may also lead to death or severe liver damage in mice shortly after injection; therefore, they must be removed. In practical applications, the endotoxin content can be controlled below the threshold of 0.1 EU / μg DNA, which is the standard for endotoxin residue in research plasmids. Alternatively, 0.05 EU / μg DNA or 0.2 EU / μg DNA can be used as a reference baseline depending on experimental requirements. After this step, the purified plasmids are mixed in the same proportions as in step two to ensure that the endotoxin load in the entire injection system is at an extremely low level. This effectively reduces non-specific inflammatory responses in mice, allowing pathological phenotypes to be more solely attributed to the oncogene encoded by the plasmid, thereby improving the specificity and accuracy of model observation results.

[0061] Before injection in step three, the mixed plasmid solution was preheated at 37°C for 10 minutes. It is important to note that if the Ringer's solution used to dissolve the plasmid has just been removed from the refrigerator or has been stored at low temperatures for an extended period, its temperature will be lower than the mouse's core body temperature. When the cryogenic liquid is injected rapidly into the tail vein within 5 seconds, the cold stimulation to the blood vessel wall directly induces vascular smooth muscle contraction, causing spasm in the tail vein and a wider area of ​​blood vessels. This results in a reduction in the diameter of the injection system, a significant increase in high-pressure resistance, and impedes the smooth conduction of the liquid to the portal vein system. Preheating effectively avoids this physical stress response. By reducing the temperature difference between the plasmid solution and the mouse's body temperature, the degree of vascular spasm and increased resistance during injection can be significantly reduced, maintaining smooth flow of the high-pressure liquid, thereby improving the reliability of in vivo transfection and the consistency of model construction.

[0062] The temperature control environment in step four is as follows: place the injected mice on a heating pad with a surface temperature of 38-40℃ and maintain this temperature for 20-30 minutes. This can significantly alleviate the shock symptoms caused by acute hypothermia after injection in mice, significantly improve the postoperative survival rate of experimental animals, avoid sample loss caused by non-experimental factors, and thus ensure the smooth progress of the entire experimental protocol.

[0063] It should be noted that although the steps are described in a specific order above, this does not mean that they must be performed in that order. In fact, some of these steps can be executed concurrently, or even in a different order, as long as the required functionality is achieved. The number of devices and processing scale described herein are for simplification of the invention; applications, modifications, and variations of this invention will be readily apparent to those skilled in the art.

[0064] Although embodiments of the present invention have been disclosed above, they are not limited to the applications listed in the specification and embodiments. They can be applied to various fields suitable for the present invention. For those skilled in the art, other modifications can be easily made. Therefore, without departing from the general concept defined by the claims and their equivalents, the present invention is not limited to the specific details and illustrations shown and described herein.

Claims

1. A method for preparing a mouse liver cancer model by hydrodynamic transfection, characterized in that, Includes the following steps: Step 1: Mix the VASN expression fragment containing the attL site with the expression vector containing the attR site, and add the LR recombinase system containing Int, IHF, and Xis. Incubate to complete the directed recombination and obtain the pT3-EF1α-VASN plasmid. Step 2: LentiCRISPRv2-sgP53 plasmid, LentiCRISPRv2-sgPten plasmid, pT3-N90-β-catenin plasmid, pT3-EF1α-C-met plasmid, pT3-EF1α-VASN plasmid and pCMV / SB11 transposase plasmid are mixed in a mass ratio of 2:2:2:2:2:1 and sterile Ringer's solution is used as solvent to prepare a mixed plasmid solution with a total concentration of 6.6 μg / mL. Step 3: The mixed plasmid solution was injected into the selected mice via the tail vein within 5 seconds at an injection dose of 0.1 mL / g body weight. Step 4: Place the mice that have completed the injection in Step 3 in a warm environment. After the experiment, euthanize the mice and remove their liver tissue. The liver tissue is then cryopreserved or fixed with paraformaldehyde solution.

2. The method for preparing a mouse liver cancer model by hydrodynamic transfection according to claim 1, characterized in that, In step one, before mixing the VASN expression fragment containing the attL site with the expression vector containing the attR site, the VASN expression fragment containing the attL site, amplified by two-step PCR, is subjected to agarose gel electrophoresis. The gel block containing the target VASN expression fragment is excised under UV transilluminator, and the DNA in the gel block is extracted and purified using a silica gel centrifuge column method. The purified VASN expression fragment is then eluted with nuclease-free water. The purified VASN expression fragment is mixed with the expression vector containing the attR site at a molar ratio of 1.5:1 to 2.5:1 to form a reaction mixture, controlling the total DNA concentration of the reaction mixture to be between 0.25 μg / μL and 0.35 μg / μL. μg / μL; After adding the LR recombinase system containing Int, IHF, and Xis to the reaction mixture, the reaction system was pre-cooled in an ice-water bath for 10 minutes, and then transferred to a constant temperature metal bath and incubated at 25°C for 1 hour to complete the directed recombination; After the directed recombination was completed, 0.5 times the volume of the reaction system proteinase K solution was added to the reaction system, and the reaction was carried out at 37°C for 15 minutes to degrade the Int and IHF recombinases. 0.5 times the volume of the reaction system chloroform was added for extraction to remove the protease and lipids, and the pT3-EF1α-VASN plasmid was obtained by isopropanol precipitation.

3. The method for preparing a mouse liver cancer model by hydrodynamic transfection according to claim 2, characterized in that, After obtaining the pT3-EF1α-VASN plasmid using the isopropanol precipitation method, 0.5 μg to 1 μg was taken from it and transformed into *E. coli* DH5α competent cells. These cells were then plated onto solid LB agar plates containing ampicillin and cultured at 37°C for 12–14 hours. Twenty single colonies were randomly selected from the culture plates and inoculated into liquid LB agar containing ampicillin, then incubated at 37°C at 200–220 °C. The bacterial culture was expanded in a shaker at rpm. Plasmid DNA was extracted from each single colony from the expanded culture. Paired-end sequencing was performed using primers that specifically recognize the open reading frame of the VASN gene and primers that recognize the multiple cloning site of the pT3-EF1α vector backbone. The sequencing results were compared with the VASN gene reference sequence and the pT3-EF1α vector sequence to screen for recombinant plasmid clones with completely correct inserted sequences and no nucleotide mutations or reading frame shifts. The bacterial culture corresponding to the clones was expanded and the plasmids were extracted. The purity was determined by ultraviolet spectrophotometry. The qualified pT3-EF1α-VASN plasmids were stored at -80℃ for later use.

4. The method for preparing a mouse liver cancer model by hydrodynamic transfection according to claim 1, characterized in that, Before step two, the following are also included: The LentiCRISPRv2-sgP53 plasmid, LentiCRISPRv2-sgPten plasmid, pT3-N90-β-catenin plasmid, pT3-EF1α-C-met plasmid, pT3-EF1α-VASN plasmid, and pCMV / SB11 transposase plasmid were purified by removing endotoxins to ensure that the endotoxin content of each plasmid was less than 0.1 EU / μg DNA.

5. The method for preparing a mouse liver cancer model by hydrodynamic transfection according to claim 1, characterized in that, The directional recombination described in step one is completed by incubation at 25°C for 1 hour.

6. The method for preparing a mouse liver cancer model by hydrodynamic transfection according to claim 1, characterized in that, The mice mentioned in step three are SPF-grade 9-week-old male C57BL / 6J mice.

Images