Multi-channel targeted cell anti-aging artificial synthetic exosome and preparation method and application thereof

Abstract

The application relates to a multi-channel targeted cell anti-aging artificial synthetic exosome and a preparation method and application thereof. The artificial synthetic exosome comprises an exosome carrier, nucleic acids and small molecule compounds encapsulated in the exosome carrier, and a SPACE peptide modified on the surface of the exosome carrier; the preparation raw materials of the exosome carrier comprise neutral phospholipids, cationic phospholipids, cholesterol and a membrane structure stabilizer; the nucleic acids comprise PDRN and an miRNA antagonist; and the small molecule compounds comprise ginsenoside CK and silymarin. The application encapsulates multiple efficacy components in the exosome carrier, constructs a multi-target synergistic anti-aging system of damage repair, gene regulation, collagen neogenesis and energy metabolism activation, and the constructed artificial synthetic exosome is uniform in particle size and stable in structure, thereby providing a brand-new anti-aging strategy for the cosmetic technical field.

Description

Technical Field

[0001] This application belongs to the field of cosmetic technology, specifically relating to a multi-pathway targeted cell anti-aging artificial exosome, its preparation method and application. Background Technology

[0002] Skin aging is a complex biological process involving multiple factors and levels, encompassing cumulative DNA damage, dysregulation of gene expression, degradation of the extracellular matrix, and decline in mitochondrial energy metabolism. Therefore, an ideal anti-aging skincare strategy should be able to synergistically intervene at multiple levels simultaneously, rather than targeting only a single point.

[0003] Currently, there are many active ingredients with specific skin care effects in the cosmetics field. However, each component usually only acts on a certain aspect of skin aging. There is a lack of co-delivery carrier systems that can simultaneously carry multiple active ingredients with different physicochemical properties, making it difficult to achieve multi-target synergistic anti-aging effects such as DNA damage repair, gene expression regulation, collagen regeneration, and energy metabolism activation.

[0004] Meanwhile, existing anti-aging products already possess active skin targeting and transdermal absorption capabilities, but in order to achieve efficient enrichment and deep penetration of active ingredients in skin tissue, continuous upgrades and performance improvements are needed; and the encapsulation rate and delivery effect of active substances need to be further enhanced.

[0005] Exosomes are vesicle-like structures secreted by cells, ranging in size from 30 to 150 nm. Their core function is as "intercellular messengers"—carrying bioactive substances such as nucleic acids (mRNA, miRNA), proteins, and lipids to facilitate intercellular signal transduction and substance transport. Based on this characteristic, exosomes have shown great potential for applications in drug delivery, skin repair, and disease diagnosis. However, the industrial application of natural exosomes faces significant bottlenecks: extremely low yields, high purification difficulty, poor batch stability, and uncontrollable targeting.

[0006] To address the shortcomings of natural exosomes, the artificial synthesis of exosomes has become a key focus of technological research and development. By mimicking the "lipid bilayer vesicle structure" of natural exosomes, artificially designed materials are used as carriers to load active substances as needed and modify them with targeting molecules, achieving the industrialization goal of "controllable yield, adjustable composition, and precise targeting." Existing artificially synthesized exosomes, through internal loading of nucleic acid substances and surface targeting peptides, have significant advantages in drug delivery and skin repair.

[0007] Therefore, constructing a structurally and functionally stable synthetic exosome to achieve multi-pathway targeted anti-aging by loading different active ingredients has become one of the urgent technical problems to be solved. Summary of the Invention

[0008] To address the shortcomings of existing technologies, this application aims to provide a multi-pathway targeted cellular anti-aging synthetic exosome, its preparation method, and its applications. This application constructs a multi-target synergistic anti-aging system that encapsulates multiple functional components in an exosome carrier, enabling damage repair, gene regulation, collagen regeneration, and energy metabolism activation. Furthermore, the constructed synthetic exosomes exhibit uniform particle size and stable structure, providing a novel anti-aging strategy for the cosmetics technology field.

[0009] To achieve this objective, the present application adopts the following technical solution: In a first aspect, this application provides a multi-pathway targeted cell anti-aging artificial exosome, the artificial exosome comprising an exosome carrier, nucleic acids and small molecule compounds loaded in the exosome carrier, and SPACE peptides modified on the surface of the exosome carrier; The raw materials for preparing the exosome carrier include neutral phospholipids, cationic phospholipids, cholesterol, and membrane structure stabilizers; The nucleic acid includes PDRN and miRNA antagonists; The small molecule compounds include ginsenoside CK and silymarin.

[0010] Firstly, in the preparation of exosome carriers, neutral phospholipids with high phase transition temperatures can ensure excellent vesicle stability, but their encapsulation efficiency for nucleic acids is low. Cationic phospholipids, carrying a positive charge, can efficiently encapsulate negatively charged nucleic acid-like active ingredients (PDRN, miRNA antagonists) through electrostatic interactions, solving the key technical problem of low nucleic acid encapsulation efficiency of conventional neutral liposomes. This application specifically combines neutral phospholipids with high phase transition temperatures with cationic phospholipids possessing a skin-inspired structure, ensuring both vesicle structural stability and efficient nucleic acid encapsulation, while simultaneously endowing the vesicles with skin affinity.

[0011] Secondly, this application simultaneously encapsulates nucleic acids (PDRN, miRNA antagonists), ginsenoside CK, and silymarin within the vesicles, forming a multi-target synergistic anti-aging system; the multi-pathway targeted cell anti-aging described in this application refers to anti-aging through targeted cell action, specifically: miRNA antagonists regulate the expression of aging-related genes at the post-transcriptional level, intervening in the synthesis of key molecules such as SIRT1 and collagen from the source, setting the direction for subsequent repair; PDRN provides repair raw materials for damaged cells through the DNA rescue pathway, while activating adenosine A2A receptors to promote fibroblast proliferation and collagen synthesis, directly performing repair functions downstream of gene regulation; ginsenoside CK maintains collagen regeneration while inhibiting the degradation of collagen fibers by matrix metalloproteinases, and participates in regulating the hydroxylation modification of collagen to optimize its three-dimensional network structure; silymarin activates the AMPK pathway to increase ATP energy levels and scavenge free radicals to protect structural proteins such as collagen and elastin from oxidative damage.

[0012] The signals from the four components converge in key pathways such as NF-κB and AMPK, forming a functional closed loop connecting upstream and downstream processes in four dimensions: gene regulation, DNA repair, collagen remodeling, and energy metabolism. This application demonstrates that nucleic acids (PDRN / miRNA antagonists), ginsenoside CK, and silymarin have a significant synergistic effect in enhancing anti-aging efficacy, and the anti-aging effect resulting from this synergy surpasses the simple additive effect of the individual components.

[0013] Furthermore, this application modifies the surface of exosome vesicles with SPACE peptides, a skin-penetrating peptide that promotes molecular penetration through the stratum corneum and can be internalized by keratinocytes and fibroblasts, significantly improving the transdermal delivery efficiency of active ingredients. This application binds the SPACE peptides to the exosome surface via cationic phospholipids, utilizing the physicoelectrostatic anchoring and high affinity synergistic effect between the cationic phospholipids and the SPACE peptides, resulting in significantly improved linkage stability.

[0014] In some specific embodiments, the neutral phospholipids include hydrogenated lecithin.

[0015] In some specific embodiments, the cationic phospholipid includes linoleamide propyl PG-dimethylammonium chloride phosphate.

[0016] Linoleamide propyl PG-dimethylammonium chloride phosphate is a natural biomimetic phospholipid with cationic properties. It is a Gemini-type cationic quaternary ammonium salt of safflower oil, with an HLB value of 17-19, and is readily soluble in water. This ingredient possesses the skin-friendly properties and cationic characteristics of phospholipids, enabling it to adhere to the skin surface. As a biomimetic phospholipid complex, it is designed to mimic naturally occurring phospholipids in the body.

[0017] In some specific embodiments, the mass ratio of the neutral phospholipid to the cationic phospholipid is 1:1-14:1, preferably 2:1-6:1.

[0018] The specific point values ​​in the range of 1:1 to 14:1 can be 1:1, 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, etc.

[0019] By controlling the mass ratio of neutral phospholipids and cationic phospholipids within the above-mentioned range, this application can obtain exosomes with both high encapsulation efficiency and stability.

[0020] In some specific embodiments, the raw materials for preparing the exosome carrier include 3-7 parts of neutral phospholipids, 0.5-3 parts of cationic phospholipids, 0.3-1 parts of cholesterol, and 0.08-0.4 parts of membrane structure stabilizer.

[0021] Specifically, the specific point values ​​for 3-7 parts can be 3, 4, 5, 6, 7, etc.; the specific point values ​​for 0.5-3 parts can be 0.5, 1, 1.5, 2, 2.5, 3, etc.; the specific point values ​​for 0.3-1 parts can be 0.3, 0.5, 0.7, 0.9, 1, etc.; and the specific point values ​​for 0.08-0.4 parts can be 0.08, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, etc.

[0022] By controlling the neutral phospholipids, cationic phospholipids, cholesterol, and membrane structure stabilizers within the aforementioned ranges, this application can further improve the encapsulation efficiency of exosome vesicles for nucleic acid functional components, while simultaneously enhancing the structural stability of exosomes.

[0023] In some specific embodiments, the membrane structure stabilizer includes any one or a combination of at least two of phytosphingosine, ceramide, or squalane.

[0024] In some specific embodiments, the raw materials for preparing the exosome carrier also include a humectant.

[0025] In some specific embodiments, the raw materials for preparing the exosome carrier also include 7-30 parts of a humectant.

[0026] In some specific embodiments, the humectant includes a polyol.

[0027] In some specific embodiments, the membrane structure stabilizer comprises a combination of phytosphingosine, ceramide, and squalane.

[0028] In some specific embodiments, the membrane structure stabilizer includes 0.03-0.1 parts of phytosphingosine, 0.001-0.02 parts of ceramide, and 0.05-0.2 parts of squalane.

[0029] In some specific embodiments, the membrane structure stabilizer includes 0.05-0.08 parts of phytosphingosine, 0.005-0.01 parts of ceramide, and 0.08-0.15 parts of squalane.

[0030] In some specific embodiments, the polyol includes butanediol.

[0031] By adding the aforementioned membrane structure stabilizer, this application can further enhance the structural stability of exosomes and improve the encapsulation effect of exosome vesicles on nucleic acid functional components.

[0032] The specific point values ​​for the above 0.7-30 parts can be 7 parts, 10 parts, 15 parts, 20 parts, 25 parts, 30 parts, etc.; the specific point values ​​for 0.03-0.1 parts can be 0.03 parts, 0.05 parts, 0.07 parts, 0.09 parts, 0.1 parts, etc.; the specific point values ​​for 0.001-0.02 parts can be 0.001 parts, 0.005 parts, 0.01 parts, 0.015 parts, 0.02 parts, etc.; and the specific point values ​​for 0.05-0.2 parts can be 0.05 parts, 0.08 parts, 0.11 parts, 0.14 parts, 0.17 parts, 0.2 parts, etc.

[0033] In some specific embodiments, the amino acid sequence of the SPACE peptide is shown in SEQ ID NO.1.

[0034] The specific sequence of SEQ ID NO.1 is: ACTGSTQHQCG.

[0035] In some specific embodiments, the miRNA antagonist includes any one or a combination of at least two of miR-23a antagonists, miR-34a antagonists, miR-29 antagonists, or miR-129 antagonists.

[0036] In some specific embodiments, the nucleotide sequence of the miR-23a antagonist is shown in SEQ ID NO.2 (GGAAAUCCCUGGCAAUGUGAU).

[0037] In some specific embodiments, the nucleotide sequence of the miR-34a antagonist is shown in SEQ ID NO.3 (ACAACCAGCUAAGACACUGCCA).

[0038] In some specific embodiments, the nucleotide sequence of the miR-29 antagonist is shown in SEQ ID NO.4 (AUACUUUUUGGGUAAGGGCUUU).

[0039] In some specific embodiments, the nucleotide sequence of the miR-129 antagonist is shown in SEQ ID NO.5 (GCAAGCCCAGACCGCAAAAAG).

[0040] In some specific embodiments, the mass ratio of the PDRN to the miRNA antagonist is 10:1 to 100:1, for example, it can be 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, etc.

[0041] In some specific embodiments, the mass ratio of ginsenoside CK to silymarin is 1:1 to 5:1, for example, it can be 1:1, 2:1, 3:1, 4:1, 5:1, etc.

[0042] In some specific embodiments, the mass ratio of the nucleic acid to the small molecule compound is 1:8 to 2:1, for example, it can be 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, etc.

[0043] In some specific embodiments, the mass ratio of the SPACE peptide to the raw material for preparing the exosome carrier is 0.0001:1-0.001:1, for example, it can be 0.0001:1, 0.0003:1, 0.0005:1, 0.0007:1, 0.0009:1, 0.001:1, etc.

[0044] In some specific embodiments, the ratio of the total mass of the nucleic acid and small molecule compound to the mass of the raw materials for preparing the exosome carrier is 0.03:1-0.3:1, for example, it can be 0.03:1, 0.05:1, 0.1:1, 0.15:1, 0.2:1, 0.25:1, or 0.3:1.

[0045] The specific point values ​​in the range of 10:1-100:1 can be 10:1, 20:1, 30:1, 40:1, 50:1, 60:1, 70:1, 80:1, 90:1, 100:1, etc.; the specific point values ​​in the range of 1:1-5:1 can be 1:1, 2:1, 3:1, 4:1, 5:1, etc.; and the specific point values ​​in the range of 1:8-2:1 can be 1:8, 1:7, 1:6, 1:5, 1:4, 1:3, 1:2, 1:1, 2:1, etc.

[0046] Secondly, this application provides a method for preparing synthetic exosomes with multi-pathway targeted cell anti-aging as described in the first aspect, the method comprising the following steps: (1) Mix and dissolve the raw materials for the preparation of exosome carriers, small molecule compounds, and SPACE peptides to obtain the alcohol phase; Nucleic acid is dissolved in water to obtain an aqueous phase; (2) The aqueous phase is added to the alcohol phase and emulsified and homogenized to obtain the artificially synthesized exosomes.

[0047] In some specific embodiments, the temperature of the mixture before obtaining the alcohol phase in step (1) is 60-70°C.

[0048] In some specific embodiments, the stirring speed of the emulsification process in step (2) is 6000-10000 rpm, the temperature is 50-80℃, and the time is 2-10 min.

[0049] In some specific embodiments, the homogenization process in step (2) is performed at a pressure of 1500-2000 bar, with 4-6 cycles and a temperature of 10-25°C.

[0050] Specific point values ​​within the 60-70℃ range can be selected as 60℃, 62℃, 64℃, 66℃, 68℃, 70℃, etc.; specific point values ​​within the 50-80℃ range can be selected as 50℃, 60℃, 70℃, 80℃, etc.; specific point values ​​within the 10-25℃ range can be selected as 10℃, 15℃, 20℃, 25℃, etc.; specific point values ​​within the 1:25-1:900 range can be selected as 1:25, 1:100, 1:200, 1:300, 1:400, 1:500, 1:600, 1:700, 1:800, 1:900, etc.; specific point values ​​within the 6000-10000 rpm range can be selected as 6000 rpm, 7000 rpm, 8000 rpm, 9000 rpm, 10000 rpm, etc.; and specific point values ​​within the 2-10 min range can be selected as 2 min, 4 min, 6 min, 8 min, etc. For min, 10 min, etc., specific point values ​​in the 1500-2000 bar range can be selected such as 1500 bar, 1600 bar, 1700 bar, 1800 bar, 1900 bar, 2000 bar, etc., and 4-6 times, for example, 4 times, 5 times, 6 times.

[0051] Thirdly, this application provides the application of the synthetic exosomes with multi-pathway targeted cell anti-aging as described in the first aspect in the preparation of cosmetics with anti-aging effects.

[0052] Compared with the prior art, this application has the following beneficial effects: This application simultaneously encapsulates PDRN, miRNA antagonists, ginsenoside CK, and silymarin in exosomes, forming a functional closed loop connecting upstream and downstream from four dimensions: gene regulation, DNA repair, collagen remodeling, and energy metabolism. The synergistic effect of this combination leads to an anti-aging effect that surpasses the simple summation of the individual components.

[0053] This application specifically combines neutral phospholipids with high phase transition temperatures with cationic phospholipids that have a skin-inspired structure. This ensures the structural stability of exosome vesicles, achieves efficient encapsulation of nucleic acids and small molecule compounds, and endows the vesicles with skin affinity. Furthermore, SPACE peptides are modified onto the surface of exosome vesicles with cationic phospholipids, promoting molecular penetration of the stratum corneum into the epidermis and dermis, significantly improving the transdermal delivery efficiency of active ingredients. Detailed Implementation

[0054] To further illustrate the technical means and effects adopted in this application, the following describes the technical solution of this application in conjunction with preferred embodiments, but this application is not limited to the scope of the embodiments.

[0055] The sources of each component / raw material involved in the following specific embodiments are shown in Table 1.

[0056] Table 1 The amino acid sequence of the SPACE peptide involved in the following specific embodiments is shown in SEQ ID NO.1, and the specific sequence is: ACTGSTQHQCG.

[0057] The miRNA antagonist involved in the following specific embodiments is a miR-34a antagonist, the nucleotide sequence of which is shown in SEQ ID NO.3, and the specific sequence is: ACAACCAGCUAAGACACUGCCA.

[0058] Example 1 This embodiment provides a synthetic exosome.

[0059] (1) Preparation of raw materials: Hydrogenated lecithin 5 parts, linoleamide propyl PG-dimethylammonium chloride phosphate 1.5 parts, cholesterol 0.7 parts, phytosphingosine 0.06 parts, ceramide 0.008 parts, squalane 0.1 parts, 1,3-butanediol 15 parts, PDRN 0.8 parts, miRNA antagonist 0.01 parts, ginsenoside CK 1 part, silymarin 0.3 parts, SPACE peptide 0.01 parts, deionized water to make up to 100 parts.

[0060] (2) Preparation method: S1, hydrogenated lecithin, linoleamide propyl PG-dimethylammonium chloride phosphate, cholesterol, phytosphoin, ceramide, squalane, ginsenoside CK, silymarin, SPACE peptide and 1,3-butanediol are mixed, heated to 65°C and stirred at 300 rpm until completely dissolved to obtain the alcohol phase; PDRN, miRNA antagonist and deionized water were mixed and stirred at 300 rpm until completely dissolved to obtain an aqueous phase; S2, under the condition of water bath at 65℃, the aqueous phase is added to the alcohol phase and emulsified and sheared at 8000 rpm for 3 min to obtain the primary emulsion; the primary emulsion is transferred to a high-pressure homogenizer and homogenized 5 times under a pressure of 1800 bar, while maintaining the system temperature at 20℃ throughout the process.

[0061] Example 2 This embodiment provides a synthetic exosome.

[0062] (1) Preparation of raw materials: Hydrogenated lecithin 4 parts, linoleamide propyl PG-dimethylammonium chloride phosphate 2 parts, cholesterol 0.5 parts, phytosphingosine 0.05 parts, ceramide 0.005 parts, squalane 0.08 parts, 1,3-butanediol 10 parts, PDRN 0.6 parts, miRNA antagonist 0.05 parts, ginsenoside CK 0.62 parts, silymarin 0.5 parts, SPACE peptide 0.005 parts, deionized water to make up to 100 parts.

[0063] (2) Preparation method: S1, hydrogenated lecithin, linoleamide propyl PG-dimethylammonium chloride phosphate, cholesterol, phytosphoin, ceramide, squalane, ginsenoside CK, silymarin, SPACE peptide and 1,3-butanediol are mixed, heated to 60°C and stirred at 400 rpm until completely dissolved to obtain the alcohol phase; PDRN, miRNA antagonist and deionized water were mixed and stirred at 400 rpm until completely dissolved to obtain an aqueous phase; S2, under the condition of water bath at 60℃, the aqueous phase is added to the alcohol phase and emulsified and sheared at 9000 rpm for 2 min to obtain the primary emulsion; the primary emulsion is transferred to a high-pressure homogenizer and homogenized 6 times at a pressure of 1600 bar, while maintaining the system temperature at 25℃ throughout the process.

[0064] Example 3 This embodiment provides a synthetic exosome.

[0065] (1) Preparation of raw materials: Hydrogenated lecithin 6 parts, linoleamide propyl PG-dimethylammonium chloride phosphate 1 part, cholesterol 0.8 parts, phytosphingosine 0.08 parts, ceramide 0.01 parts, squalane 0.15 parts, 1,3-butanediol 16 parts, PDRN 0.7 parts, miRNA antagonist 0.008 parts, ginsenoside CK 1.2 parts, silymarin 0.25 parts, SPACE peptide 0.015 parts, deionized water to make up to 100 parts.

[0066] (2) Preparation method: S1, hydrogenated lecithin, linoleamide propyl PG-dimethylammonium chloride phosphate, cholesterol, phytosphoin, ceramide, squalane, ginsenoside CK, silymarin, SPACE peptide and 1,3-butanediol are mixed, heated to 55°C and stirred at 500 rpm until completely dissolved to obtain the alcohol phase; PDRN, miRNA antagonist and deionized water were mixed and stirred at 500 rpm until completely dissolved to obtain an aqueous phase; S2, under the condition of water bath at 70℃, the aqueous phase is added to the alcohol phase and emulsified and sheared at 7000 rpm for 6 min to obtain the primary emulsion; the primary emulsion is transferred to a high-pressure homogenizer and homogenized 4 times under a pressure of 2000 bar, while maintaining the system temperature at 15℃ throughout the process.

[0067] Example 4 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the hydrogenated lecithin is adjusted to 3.5 parts and the linoleamide propyl PG-dimethylammonium chloride phosphate is adjusted to 3 parts in the raw materials, that is, the mass ratio of hydrogenated lecithin to linoleamide propyl PG-dimethylammonium chloride phosphate is 1.17:1; the other parameters and preparation methods are the same as in Example 1.

[0068] Example 5 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the hydrogenated lecithin is adjusted to 6 parts and the linoleamide propyl PG-dimethylammonium chloride phosphate is adjusted to 0.5 parts, that is, the mass ratio of hydrogenated lecithin to linoleamide propyl PG-dimethylammonium chloride phosphate is 12:1; the remaining parameters and preparation methods are consistent with Example 1.

[0069] Example 6 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the linoleamide propyl PG-dimethylammonium chloride phosphate is replaced with an equal weight proportion of cationic phospholipid (2,3-dioleoxypropyl)trimethylammonium chloride (DOTAP) in the preparation raw materials; all other parameters and preparation methods are consistent with Example 1.

[0070] Example 7 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the hydrogenated lecithin, linoleamide propyl PG-dimethylammonium chloride phosphate, and cholesterol are adjusted to 3 parts and 1.2 parts respectively in the raw materials; the other parameters and preparation methods are the same as in Example 1.

[0071] Example 8 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the hydrogenated lecithin is adjusted to 4 parts, the linoleamide propyl PG-dimethylammonium chloride phosphate is adjusted to 0.5 parts, and the cholesterol is adjusted to 2.7 parts; the remaining parameters and preparation methods are consistent with Example 1.

[0072] Example 9 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the PDRN content is adjusted to 0.7 parts and the miRNA antagonist content is adjusted to 0.11 parts in the raw materials, that is, the mass ratio of PDRN to miRNA antagonist is adjusted to 6.4:1; the other parameters and preparation methods are consistent with Example 1.

[0073] Example 10 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the PDRN content is adjusted to 0.803 parts and the miRNA antagonist content is adjusted to 0.007 parts in the raw materials, that is, the mass ratio of PDRN to miRNA antagonist is adjusted to 114.7:1; the other parameters and preparation methods are consistent with Example 1.

[0074] Example 11 This embodiment provides an artificially synthesized exosome, which differs from Example 1 only in that the amount of ginsenoside CK in the raw materials is adjusted to 0.5 parts and the amount of silymarin is adjusted to 0.8 parts, that is, the mass ratio of ginsenoside CK to silymarin is adjusted to 0.6:1; the other parameters and preparation methods are consistent with Example 1.

[0075] Example 12 This embodiment provides an artificially synthesized exosome, which differs from Example 1 only in that the amount of ginsenoside CK in the raw materials is adjusted to 1.15 parts and the amount of silymarin is adjusted to 0.15 parts, that is, the mass ratio of ginsenoside CK to silymarin is adjusted to 7.7:1; the other parameters and preparation methods are consistent with those of Example 1.

[0076] Example 13 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the SPACE peptide in the preparation raw materials is adjusted to 0.001 parts, that is, the mass ratio of SPACE peptide to the preparation raw materials of exosome carrier is 0.00004:1; the other parameters and preparation methods are consistent with Example 1.

[0077] Example 14 This embodiment provides a synthetic exosome, which differs from Example 1 only in that the SPACE peptide in the preparation raw materials is adjusted to 0.05 parts, that is, the mass ratio of SPACE peptide to the preparation raw materials of exosome carrier is 0.0022:1; the other parameters and preparation methods are consistent with Example 1.

[0078] Comparative Example 1 This comparative example provides a synthetic exosome, which differs from Example 1 only in that linoleamide propyl PG-dimethylammonium chloride phosphate is removed from the raw materials, and the hydrogenated lecithin is adjusted to 6.5 parts accordingly; the remaining parameters and preparation methods are consistent with Example 1.

[0079] Comparative Example 2 This comparative example provides a synthetic exosome, which differs from Example 1 only in that hydrogenated lecithin is removed from the raw materials, and accordingly, linoleamide propyl PG-dimethylammonium chloride phosphate is adjusted to 6.5 parts; the remaining parameters and preparation methods are consistent with Example 1.

[0080] Comparative Example 3 This comparative example provides a synthetic exosome, which differs from Example 1 only in that the SPACE peptide is removed from the raw materials and the reduced weight is made up by water; all other parameters and preparation methods are consistent with Example 1.

[0081] Comparative Example 4 This comparative example provides a synthetic exosome, which differs from Example 1 only in that the total weight proportions of PDRN, miRNA antagonist, ginsenoside CK, and silymarin in the raw materials are kept unchanged, while PDRN and miRNA antagonist are removed. Correspondingly, ginsenoside CK is adjusted to 1.623 parts and silymarin is adjusted to 0.487 parts; all other parameters and preparation methods are consistent with Example 1.

[0082] Comparative Example 5 This comparative example provides a synthetic exosome, which differs from Example 1 only in that the total weight proportions of PDRN, miRNA antagonist, ginsenoside CK, and silymarin in the raw materials are kept unchanged, while ginsenoside CK is removed. Accordingly, PDRN is adjusted to 1.521 parts, miRNA antagonist to 0.019 parts, and silymarin to 0.57 parts; all other parameters and preparation methods are consistent with Example 1.

[0083] Comparative Example 6 This comparative example provides a synthetic exosome, which differs from Example 1 only in that the total weight proportions of PDRN, miRNA antagonist, ginsenoside CK, and silymarin in the raw materials are kept unchanged, while silymarin is removed. Accordingly, PDRN is adjusted to 0.933 parts, miRNA antagonist to 0.012 parts, and ginsenoside CK to 1.166 parts; all other parameters and preparation methods are consistent with Example 1.

[0084] Comparative Example 7 This comparative example provides a synthetic exosome, which differs from Example 1 only in that phytosphingosine, ceramide, and squalane are removed from the raw materials, and the reduced weight is made up by water; all other parameters and preparation methods are consistent with Example 1.

[0085] Application Example 1 This application example provides an essence, formulated by weight percentage as follows: 10% synthetic exosomes obtained in Example 1, 3% sodium hyaluronate, 3% trehalose, 5% panthenol, 3% 1,3-propanediol, 10% glycerin, and the balance being water. All components are homogenized to obtain the essence.

[0086] Comparative Application Example 1 This comparative application example 1 provides an essence, which differs from application example 1 only in that the synthetic exosomes prepared in example 1 are replaced with an equal mass of synthetic exosomes from comparative example 1; its formulation is consistent with application example 1.

[0087] Compare and apply examples 2-4 Comparative Application Examples 2, 3, and 4 each provide an essence, the only difference from Application Example 1 being that the synthetic exosomes obtained in Example 1 are replaced with equal masses of synthetic exosomes from Comparative Examples 4, 5, and 6 respectively; the rest of the formulation is the same as that of Application Example 1.

[0088] Comparative Application Example 5 This comparative application example provides a blank serum, which differs from Application Example 1 only in that the synthetic exosomes of Example 1 are removed, and the reduced mass is made up by water; its formulation is consistent with Application Example 1.

[0089] Test Example 1 Encapsulation rate test.

[0090] Free nucleic acids and nucleic acids encapsulated in exosome vesicles were separated using ultrafiltration centrifugation: 10 mL of exosome samples from each example and comparative example were precisely measured and placed in ultrafiltration centrifuge tubes (MWCO 300 kDa). The tubes were centrifuged at 4℃ and 4000 r / min for 30 min, and the filtrate (containing free nucleic acid miRNA antagonists and PDRN) was collected. An equal volume of sample was taken, and after demulsification with Triton X-100, the total nucleic acid content was determined. The free and total nucleic acid contents were determined using RiboGreen fluorescence spectrometry, with an excitation wavelength of 480 nm and an emission wavelength of 520 nm. The nucleic acid encapsulation efficiency was calculated using the following formula: Encapsulation efficiency (%) = (Total nucleic acid content - Free nucleic acid content) / Total nucleic acid content × 100%.

[0091] The encapsulation efficiency test results of each embodiment and comparative exception are shown in Table 2.

[0092] Table 2 Comparison of data from Example 1 with Comparative Examples 1, 2, and 6 shows that neutral phospholipids and cationic phospholipids have significant effects in maintaining the structure of exosomes and encapsulating active ingredients; and linoleamide propyl PG-dimethylammonium chloride phosphate can better enhance the nucleic acid encapsulation effect of exosomes compared with other cationic phospholipids.

[0093] A comparison of the data from Example 1 and Comparative Example 7 shows that the addition of membrane structure stabilizers (phytosphingosine, ceramide, and squalane) can further enhance the encapsulation effect of exosome vesicles on functional components such as nucleic acids.

[0094] A comparison of the data from Example 1 with Examples 4-5 and 7-8 shows that the preparation materials for the exosome carrier include 3-7 parts of neutral phospholipids, 0.5-3 parts of cationic phospholipids, and 0.3-1 parts of cholesterol. The mass ratio of neutral phospholipids to cationic phospholipids is 2:1-6:1, which can further enhance the encapsulation effect of neutral phospholipids and cationic phospholipids and improve the encapsulation rate of exosomes for functional components such as nucleic acids.

[0095] Test Example 2 Stability testing.

[0096] (1) The exosome samples obtained from each example and comparative example were sealed and stored in a constant temperature and humidity chamber at 45℃±2℃ and 75% RH. The average particle size and PDI of the samples before storage and after the third month of storage were measured (the results are shown in Table 3). (2) The exosome samples obtained from each example and comparative example were sealed and stored at 5℃±2℃, 25℃±2℃ and 45℃±2℃ for 3 months, respectively, and the appearance of the samples before storage and after the 3rd month of storage was observed (the results are shown in Table 4).

[0097] Table 3 Table 4 A comparison of the data from Example 1 with Comparative Examples 1, 2, and 6 shows that neutral phospholipids and cationic phospholipids have significant effects in maintaining the stability of exosome vesicles; and linoleamide propyl PG-dimethylammonium chloride phosphate can better improve the stability of exosome vesicles compared to other cationic phospholipids.

[0098] A comparison of the data from Example 1 and Comparative Example 7 shows that the addition of membrane structure stabilizers (phytosphingosine, ceramide, and squalane) can further enhance the stability of exosome structures.

[0099] A comparison of the data from Example 1 with Examples 4-5 and 7-8 shows that the preparation materials for the exosome carrier include 3-7 parts of neutral phospholipids, 0.5-3 parts of cationic phospholipids, and 0.3-1 parts of cholesterol. The mass ratio of neutral phospholipids to cationic phospholipids is 2:1-6:1, which can further enhance the stabilizing effect of neutral phospholipids and cationic phospholipids and improve the stability of exosomes.

[0100] Test Example 3 Transdermal absorption test.

[0101] Ginsenoside CK was selected as a marker for transdermal absorption to test the transdermal absorption capacity of exosomes.

[0102] Transdermal experiments were conducted on exosomes from each embodiment and comparative example using an in vitro porcine skin model and a Franz diffusion cell system under constant temperature conditions of 32±1℃.

[0103] The extracted pig skin is fresh pig back skin, 0.5-1 mm thick, stored at 4℃ and used within 6 hours. Before use, it is assessed by a TEWL value (<15 g / m²). 2 / h) Verify skin integrity.

[0104] The prepared ex vivo skin was fixed between the drug delivery pool and the receiving pool, with an effective permeation area of ​​2.80 cm² in the diffusion pool. 2The stratum corneum faces the supply chamber, while the dermis side contacts the receiving solution to remove air bubbles. The receiving solution is physiological saline. 1 g of exosomes obtained in each example and comparative example is accurately weighed and applied to the skin, ensuring close contact. A small glass bead is placed in the receiving chamber to help agitate the receiving solution. The supply chamber is sealed with plastic wrap to prevent moisture evaporation, which could cause gelation and skin dryness, hindering the experiment. The receiving chamber is kept at a constant temperature of 37°C using a water bath. After 6 hours, all the receiving solution is collected as a sample solution, filtered through a 0.22 μm microporous membrane, and 20 μL is injected into a high-performance liquid chromatograph to determine the concentration and cumulative release of ginsenoside CK, calculating the cumulative transdermal percentage. Cumulative transdermal percentage (%) = Qn / Qtotal × 100%; Qn: The cumulative mass of active material permeated into the receiving cell at time t (μg); Qtotal: Total mass (μg) of active ingredients initially added on the supply side; The results of the cumulative transdermal percentage determination of the exosomes to be tested are shown in Table 5.

[0105] Table 5 Comparison of data from Example 1, Examples 13-14, and Comparative Example 3 shows that the addition of SPACE peptide can significantly enhance the transdermal absorption of active ingredients in exosomes. Furthermore, controlling the mass ratio of SPACE peptide to the raw materials for preparing exosome carriers at 0.0001:1-0.001:1 can further enhance the ability of SPACE peptide to promote molecular penetration of the stratum corneum and further improve the transdermal absorption of active ingredients.

[0106] A comparison of the data from Example 1 with Examples 4-5 and 7-8 shows that the preparation materials for the exosome carrier include 3-7 parts of neutral phospholipids, 0.5-3 parts of cationic phospholipids, and 0.3-1 parts of cholesterol. The mass ratio of neutral phospholipids to cationic phospholipids is 2:1-6:1, which can further control the exosome particle size within a reasonable range, thereby improving the transdermal absorption effect of the active ingredients in the exosomes.

[0107] Comparison of data from Example 1 with Comparative Examples 1, 2, and 6 shows that neutral phospholipids and cationic phospholipids play a significant role in maintaining the stability of exosome vesicles and can affect transdermal absorption by influencing exosome particle size. In addition, linoleamide propyl PG-dimethylammonium chloride phosphate can further enhance the transdermal absorption of active ingredients compared to other cationic phospholipids.

[0108] A comparison of the data from Example 1 and Comparative Example 7 shows that the addition of membrane structure stabilizers (phytosphingosine, ceramide, and squalane) can further improve the structural stability of exosomes, control the particle size of exosomes, and enhance the transdermal absorption of active ingredients.

[0109] Test Example 4 Cellular anti-aging efficacy test.

[0110] (1) Using the human dermal fibroblasts (HDFs) model, the anti-aging efficacy of the samples was evaluated by detecting the effect of the samples on the expression level of type I collagen (COL1A1) mRNA.

[0111] The specific method is as follows: HDFs were passaged, and when the cell density reached 80-90%, they were cultured at a rate of 15,000 / cm³. 2 Cells were seeded at a density in 6-well plates (medium: DMEM containing 10% FBS and 1% antibiotics); after overnight adhesion, the original medium was discarded. Except for the blank control group (no model established, 2 mL of complete medium was added), 2 mL of complete medium containing 500 µM H2O2 was added to each well. The plates were then incubated for 48 h to establish an oxidative stress-induced cell senescence model. The experimental groups and treatments are as follows: Blank control group: No model was established, 2 mL of complete culture medium was added; Model group: After modeling, add 2 mL of complete culture medium; Drug administration group: After modeling, each group was given 2 mL of maintenance culture medium containing 0.1% of the corresponding example or comparative example of artificially synthesized exosomes.

[0112] After 48 h of culture, the original culture medium was discarded, and the cells were washed once with DPBS. After digestion with trypsin, the cells were washed once more with DPBS. 500 μL of RNA extraction lysis buffer was added to each well, and the cells were resuspended by pipetting until no cell pellet was visible and the suspension was basically clear, indicating that the cells had been fully lysed. RNA extraction was performed for each group according to the RNA extraction kit procedure. The extracted RNA was dissolved in enzyme-free water, and its concentration was determined using a micro-spectrophotometer. Reverse transcription was performed according to the kit method, using 1000 ng of RNA for reverse transcription and qPCR. The relative expression level of the COL1A1 gene, which is related to collagen synthesis, was detected by qPCR.

[0113] (2) A human skin fibroblast energy metabolism disorder model was constructed by UVA irradiation, the intracellular ATP content was detected, and the activation effect of each artificially synthesized exosome sample on the energy metabolism of damaged cells was evaluated.

[0114] The specific method is as follows: Collect HDFs in the logarithmic growth phase, according to 4 × 10 4 Cells were seeded into 24-well plates. They were incubated for 24 h in an incubator (37°C, 5% CO2). Blank control group (500 μL PBS), model group (500 μL PBS), and sample group (exosomes diluted to 0.05% concentration, 500 μL for each example and comparative example) were added to each well, with three replicates per group. After addition, the cells were incubated for another 24 h. The model group and sample group were subjected to 30 J / cm² treatment. 2 The cells in each group were irradiated with UVA, while the blank control group was not irradiated with UVA. All cells were then incubated for 24 hours. The ATP reagent kit was used according to the instructions, and the ATP content in each group was measured. The increase in ATP content relative to the model group was calculated.

[0115] The test results are shown in Table 6.

[0116] Table 6 The data in the table above show that the artificially synthesized exosomes involved in this invention can significantly upregulate COL1A1 expression levels, promote collagen synthesis, and increase ATP content, thus exhibiting excellent anti-aging effects.

[0117] The data from Example 1 and Comparative Examples 4-6 show that nucleic acid (PDRN / miRNA antagonist), ginsenoside CK and silymarin have a significant synergistic effect in improving anti-aging effects, and the anti-aging effect brought about by the synergistic effect surpasses the simple sum of the components.

[0118] As can be seen from the comparison of the data in Examples 9-12, controlling the mass ratio of PDRN and miRNA antagonists to 10:1-100:1, or the mass ratio of ginsenoside CK and silymarin to 1:1-5:1, can further synergistically exert anti-aging effects on multiple targets.

[0119] Comparison of data from Example 1 with Comparative Example 3 and Examples 13-14 shows that the introduction of SPACE peptide can significantly enhance the transdermal absorption of active ingredients such as ginsenoside CK in exosomes, thereby improving the effects of exosomes in promoting COL1A1 expression and restoring energy metabolism in damaged cells. Furthermore, controlling the mass ratio of SPACE peptide to the raw materials for exosome carrier preparation within the range of 0.0001:1-0.001:1 can further enhance the ability of SPACE peptide to promote molecular penetration of the stratum corneum, improve the transdermal absorption of active ingredients, and thus enhance the anti-aging effect of exosomes.

[0120] A comparison of the data from Example 1 with Comparative Examples 1, 2, and 6 shows that neutral phospholipids and cationic phospholipids have significant effects in maintaining the stability of exosome vesicles and encapsulating the active ingredients. Furthermore, linoleamide propyl PG-dimethylammonium chloride phosphate can better enhance the encapsulation effect of exosome vesicles compared to other cationic phospholipids, thereby enhancing the effects of the active ingredients in promoting COL1A1 expression and restoring energy metabolism in damaged cells.

[0121] A comparison of the data from Example 1 with Examples 4-5 and 7-8 shows that the preparation of the exosome carrier is limited to 3-7 parts of neutral phospholipids, 0.5-3 parts of cationic phospholipids, and 0.3-1 parts of cholesterol. The mass ratio of neutral phospholipids to cationic phospholipids is 2:1-6:1, which can further enhance the stabilizing and encapsulating effects of neutral phospholipids and cationic phospholipids, and improve the overall effect of exosomes in promoting COL1A1 expression and restoring energy metabolism in damaged cells.

[0122] The data from Example 1 and Comparative Example 7 show that the membrane stabilizer composed of phytosphingosine, ceramide, and squalane can further improve the structural stability of exosomes, control the particle size of exosomes, and enhance the transdermal absorption of active ingredients, thereby promoting the effects of exosomes on collagen synthesis and energy metabolism.

[0123] Test Example 5 Human anti-aging efficacy test.

[0124] (1) Subject screening Healthy female volunteers aged 35-60 with noticeable facial wrinkles (crow's feet, frown lines, or nasolabial folds) were selected. They had not used skincare products containing anti-aging ingredients in the past three months and agreed not to use other anti-aging products during the testing period. Twenty valid participants were selected for each group.

[0125] The groups are as follows: Blank serum control group: The blank serum provided in Example 5 was compared with the serum used in the comparison application; Sample group: The serums provided in Application Example 1 and Comparative Application Examples 1-4.

[0126] (2) Sample usage method After cleansing their faces morning and evening, participants applied 1 mL of the tested serum evenly to their entire face and gently massaged until absorbed. The entire testing period lasted 4 weeks (28 days), during which participants were not allowed to use other anti-aging products.

[0127] (3) Testing environment and subject preparation Each test is conducted in a constant temperature and humidity environment, with the temperature controlled at 22±1℃ and the relative humidity controlled at 50±5%RH. Before each test, the subject needs to sit quietly and rest for 30 minutes in the test environment to allow the skin condition to stabilize before the instrument test is performed.

[0128] (4) Determination of R2 and F4 values Skin elasticity was measured on fixed test areas on both sides of the subject's face using a Cutometer® MPA580 skin elasticity tester at baseline (day 0) and day 28. Measurements were repeated three times on each side, and the average value was recorded. R² and F4 values ​​were recorded, and the rate of change was calculated.

[0129] R² value change rate = (R² value on day 28 - R² value on day 0) / R² value on day 0 × 100%; F4 value change rate = (F4 value on day 28 - F4 value on day 0) / F4 value on day 0 × 100%.

[0130] The test results are shown in Table 7.

[0131] Table 7 The data in the table above show that the synthetic exosomes involved in this invention have excellent anti-aging effects.

[0132] The data from Application Example 1 and Comparative Application Examples 2-4 show that nucleic acids (PDRN / miRNA antagonists), ginsenoside CK, and silymarin have a significant synergistic effect in improving anti-aging effects, and the anti-aging effect brought about by the synergistic effect surpasses the simple sum of the individual components.

[0133] The data from Application Example 1 and Comparative Application Example 1 show that neutral phospholipids and cationic phospholipids play a significant role in maintaining the stability of exosome vesicles and the encapsulation effect on active ingredients. Cationic phospholipids can significantly improve the encapsulation effect of exosome vesicles, thereby enhancing the anti-aging effect of active ingredients.

[0134] The applicant declares that this application illustrates the technical solution of this application through the above embodiments, but this application is not limited to the above embodiments, that is, it does not mean that this application must rely on the above embodiments to be implemented. Those skilled in the art should understand that any improvements to this application, equivalent substitutions of the raw materials of this application's products, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of this application.

[0135] The preferred embodiments of this application have been described in detail above. However, this application is not limited to the specific details of the above embodiments. Within the scope of the technical concept of this application, various simple modifications can be made to the technical solution of this application, and these simple modifications all fall within the protection scope of this application.

[0136] It should also be noted that the various specific technical features described in the above embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, this application will not describe the various possible combinations separately.

Claims

1. A synthetic exosome for multi-pathway targeted cell anti-aging, characterized in that, The artificially synthesized exosomes include an exosome carrier, nucleic acids and small molecule compounds loaded in the exosome carrier, and SPACE peptides modified on the surface of the exosome carrier; The raw materials for preparing the exosome carrier include neutral phospholipids, cationic phospholipids, cholesterol, and membrane structure stabilizers; The nucleic acid includes PDRN and miRNA antagonists; The small molecule compounds include ginsenoside CK and silymarin.

2. The synthetic exosomes according to claim 1, characterized in that, The neutral phospholipids include hydrogenated lecithin; And / or, the cationic phospholipids include linoleamide propyl PG-dimethylammonium chloride phosphate; And / or, the mass ratio of the neutral phospholipid to the cationic phospholipid is 1:1-14:1, preferably 2:1-6:1; And / or, the raw materials for preparing the exosome carrier include 3-7 parts of neutral phospholipids, 0.5-3 parts of cationic phospholipids, 0.3-1 parts of cholesterol, and 0.08-0.4 parts of membrane structure stabilizer.

3. The synthetic exosomes according to claim 1 or 2, characterized in that, The membrane structure stabilizer includes any one or a combination of at least two of phytosphingosine, ceramide, or squalane; And / or, the raw materials for preparing the exosome carrier also include a humectant; And / or, the raw materials for preparing the exosome carrier also include 7-30 parts of a humectant.

4. The synthetic exosomes according to claim 3, characterized in that, The membrane structure stabilizer comprises a combination of phytosphingosine, ceramide, and squalane; And / or, the membrane structure stabilizer comprises 0.03-0.1 parts of phytosphingosine, 0.001-0.02 parts of ceramide and 0.05-0.2 parts of squalane; And / or, the moisturizer includes polyols.

5. The synthetic exosomes according to any one of claims 1-4, characterized in that, The amino acid sequence of the SPACE peptide is shown in SEQ ID NO.1; And / or, the miRNA antagonist includes any one or a combination of at least two of miR-23a antagonists, miR-34a antagonists, miR-29 antagonists, or miR-129 antagonists.

6. The synthetic exosomes according to any one of claims 1-5, characterized in that, The mass ratio of the PDRN to the miRNA antagonist is 10:1-100:1; And / or, the mass ratio of ginsenoside CK to silymarin is 1:1-5:1; And / or, the mass ratio of the nucleic acid to the small molecule compound is 1:8-2:

1.

7. The synthetic exosomes according to any one of claims 1-6, characterized in that, The mass ratio of the SPACE peptide to the raw materials for preparing the exosome carrier is 0.0001:1-0.001:1; And / or, the ratio of the total mass of the nucleic acid and small molecule compound to the mass of the raw materials for preparing the exosome carrier is 0.03:1-0.3:

1.

8. A method for preparing synthetic exosomes with multi-pathway targeted cell anti-aging as described in any one of claims 1-7, characterized in that, The preparation method includes the following steps: (1) Mix and dissolve the raw materials for the preparation of exosome carriers, small molecule compounds, and SPACE peptides to obtain the alcohol phase; Nucleic acid is dissolved in water to obtain an aqueous phase; (2) The aqueous phase is added to the alcohol phase and emulsified and homogenized to obtain the artificially synthesized exosomes.

9. The preparation method according to claim 8, characterized in that, The mixing and dissolution temperature before obtaining the alcohol phase in step (1) is 60-70℃; And / or, the stirring speed of the emulsification process in step (2) is 6000-10000 rpm, the temperature is 50-80℃, and the time is 2-10 min; And / or, the homogenization process in step (2) is performed at a pressure of 1500-2000 bar, with 4-6 cycles, and at a temperature of 10-25°C.

10. The use of the synthetic exosomes with multi-pathway targeted cell anti-aging as described in any one of claims 1-7 in the preparation of cosmetics with anti-aging effects.

Images