Use of a icariin derivative in the preparation of a drug for treating osteoporosis

Abstract

The application provides application of an icariin derivative in preparation of a medicine for treating osteoporosis. Specifically, the application provides application of a compound shown in formula I or a pharmaceutically acceptable salt thereof in preparation of a medicine for treating osteoporosis. The icariin derivative of the application achieves at least one of the following effects: (1) the icariin derivative with a novel structure is provided; (2) compared with icariin, the icariin derivative enhances the effect of promoting osteoporosis mouse bone marrow mesenchymal stem cell osteogenic differentiation; and (3) the icariin derivative improves the medicine water solubility and other medicine performance.

Description

Technical Field

[0001] This invention relates to the use of an icariin derivative in the preparation of a medicament for treating osteoporosis. Background Technology

[0002] Osteoporosis (OP) is a systemic skeletal disease characterized by a significant reduction in bone mass and destruction of bone microstructure, thereby significantly increasing bone fragility and the risk of fractures. Due to the increasing trend of population aging, osteoporosis has become a major public health concern worldwide. Osteoporosis causes more than 8.9 million fractures globally each year, a fracture occurring every 3 seconds. One-third of women and one-fifth of men over the age of 50 will experience an osteoporotic fracture. Osteoporotic fractures can cause chronic pain and limb deformities, reducing quality of life, leading to disability and further complications, and endangering life. Traditional Chinese medicine (TCM), as a natural treasure trove for drug research, has shown that many of its components have good anti-osteoporosis effects. Compared with Western medicine treatments, TCM not only demonstrates better pain relief in the treatment of osteoporosis but also has a relatively lower risk of adverse events. Epimedium is the dried leaf of *Epimedium brevicornu*, *Epimedium sagittatum*, *Epimedium pubescens*, or *Epimedium koreanum*, all belonging to the Berberidaceae family. Epimedium contains various flavonoids, such as icariin, epimedium glycoside, and icariin. It has a pungent and sweet taste, is warm in nature, and is used to tonify kidney yang, strengthen tendons and bones, and dispel wind and dampness.

[0003] Icaritin (ICT) has a wide range of pharmacological effects. Its soft capsule formulation, acralidine soft capsules, is used for unresectable hepatocellular carcinoma in patients who are unsuitable for or refuse standard treatment and have not previously received systemic therapy. In addition, iccaritin also has anti-osteoporosis, vascular protective, neuroprotective, and anti-inflammatory effects. Among these, the anti-osteoporosis effect of iccaritin has received considerable attention in recent years.

[0004]

[0005] However, the structural characteristics and physicochemical properties of icariin itself result in low absorption efficiency into the bloodstream. After entering the body, it is easily glucuronidated, leading to rapid excretion and short retention time in the body. Consequently, its oral bioavailability is low, affecting its efficacy. Summary of the Invention

[0006] The technical problem to be solved by this invention is to overcome the lack of drugs for treating osteoporosis in the prior art, thereby providing an application of an icariin derivative in the preparation of drugs for treating osteoporosis. The icariin derivative of this invention achieves at least one of the following effects: (1) it provides an icariin derivative with a novel structure; (2) compared with icariin, it enhances the effect of promoting osteogenic differentiation of bone marrow mesenchymal stem cells in osteoporotic mice; (3) it improves the drug's water solubility and other drug-making properties.

[0007] The present invention solves the above-mentioned technical problems through the following technical solution.

[0008] This invention provides the use of a compound of Formula I or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating osteoporosis.

[0009] ;

[0010] in,

[0011] A is either O or S;

[0012] R 1 H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 ynyl, 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, or with one or more R 1-1 Substituted C1-C6 alkyl groups, with one or more R 1-2 Substituted 2-6 heteroalkyl groups, with one or more R 1-3 Substituted C2-C6 alkenyl groups, with one or more R 1-4 Substituted C2-C6 ynyl group or with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups;

[0013] R 1-1 and R 1-2 Each of the following can be independently H, hydroxyl, halogen, C1-C6 alkyl, C1-C6 alkoxy, or -NR. 6 R 6 , 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups, with one or more R 1-1-2 The 6-10 aryl group is replaced or is replaced by one or more R groups. 1-1-3 Substituted 5-10 heteroaryl groups;

[0014] R 1-1-1 R 1-1-2 and R 1-1-3 Each of these can be independently hydroxyl, cyano, halogen, C1-C6 alkyl, C1-C6 alkoxy, or NR.6 R 6 , or by one or more R 1-1-4 Substituted C1-C6 alkyl groups;

[0015] R 1-1-4 Independently hydroxyl, halogen, C1-C6 alkoxy, -NR 6 R 6 , phenyl or ;

[0016] R 1-3 and R 1-4 Each is independently a C1-C6 alkyl or ;

[0017] R 1a R 1b and R 1c Each is independently a C1-C6 alkyl group;

[0018] R 1-5 Independently, it is a C1-C6 alkyl, C1-C6 alkoxy, or 3-10 membered cycloalkyl or ;

[0019] R 7 It can be independently hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, 3-10 membered cycloalkyl or -O- (3-10 membered cycloalkyl);

[0020] R 3 It is independently a halogen, hydroxyl, C1-C6 alkyl, or C1-C6 alkoxy group;

[0021] n is 1, 2, or 3;

[0022] R 4 For H or by one or more R 4-1 Substituted C1-C6 alkyl groups;

[0023] R 4-1 Independently for -NR 6 R 6 3-10 membered heterocyclic alkyl groups, or those containing one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups;

[0024] R 4-2 Independently halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, -NR 6 R 6 or by one or more R 4-3 Substituted C1-C6 alkyl groups;

[0025] R 4-3 It can be independently a halogen, hydroxyl, or C1-C6 alkoxy group;

[0026] R 6 Each is independently H or C1-C6 alkyl;

[0027] R 4 and R 1 Not both H;

[0028] The heteroatoms of the heteroalkyl group are selected from O, S or N, and the number of heteroatoms is 1, 2 or 3;

[0029] The heteroatoms of the heterocyclic alkyl group are selected from O, S or N, and the number of heteroatoms is 1, 2 or 3.

[0030] The heteroatom of the heteroaryl group is selected from O, S or N, and the number of heteroatoms is 1, 2 or 3.

[0031] In some embodiments, each C1-C6 alkyl group is independently methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, or sec-butyl, such as methyl.

[0032] In some embodiments, each C2-C6 alkenyl group is independently vinyl, propenyl, allyl, butenyl, or pentenyl, for example... , .

[0033] In some embodiments, each C2-C6 ynyl group is independently ethynyl, propynyl, propynyl, butynyl, or pentylyyl, for example... .

[0034] In some embodiments, each 3-10 membered cycloalkyl group is independently a 3-7 membered cycloalkyl group, such as cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

[0035] In some implementations, each 3-10 membered heterocyclic alkyl group is independently a 3-6 membered heterocyclic alkyl group.

[0036] In some embodiments, each heteroatom of a 3-10 membered heterocyclic alkyl group may independently be N or O, and the number of heteroatoms may independently be 1 or 2.

[0037] In some embodiments, each 3-10 membered heterocyclic alkyl group may independently be monocyclic or polycyclic, wherein the polycyclic group may be a bridged ring, fused ring, or spirocyclic ring; the polycyclic group may be bicyclic or tricyclic; preferably, each 3-10 membered heterocyclic alkyl group is independently a 3-6 membered monocyclic heterocyclic alkyl group; preferably piperazine, morpholino, piperidinyl, tetrahydropyrrole, or ethylene oxide, for example , , , , , or .

[0038] In some embodiments, each 2-6 membered heteroalkyl group has a heteroatom of O or N, and the number of heteroatoms can be independently one or two.

[0039] In some implementations, each 2-6 member heteroalkyl group is , , , , or ; where side a is connected to A.

[0040] In some embodiments, each C1-C6 alkoxy group may independently be methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, isobutoxy, or sec-butoxy; for example, methoxy.

[0041] In some embodiments, each 6-10 aryl group may independently be phenyl or naphthyl; preferably phenyl.

[0042] In some implementations, each halogen is fluorine, chlorine, bromine, or iodine.

[0043] In some implementations, the heteroatom of each 5-10 membered heteroaryl group can independently be N or O; the number of heteroatoms can independently be 1, 2 or 3.

[0044] In some implementations, each 5-10 nucleotide heteroaryl group may be independently monocyclic or bicyclic, preferably monocyclic.

[0045] In some embodiments, each 5-10-membered heteroaryl group is independently a 5-6-membered heteroaryl group; preferably pyridyl, pyrimidinyl, furanyl, or 1,2,3-triazole, for example... , , or .

[0046] In some implementation schemes, It can be independently TMS (tetramethylsilane), TES (triethoxysilane), IPDMS (integrated polydimethylsiloxane), DEIPS (diethylisopropylsilyl), TBS (tert-butyldimethylsilyl) or TIPS (triisopropylsilane).

[0047] In some embodiments, each C1-C6 alkylene group is independently methylene, ethylene, n-propylene, isopropylene, n-butylene, tert-butylene, isobutylene, or sec-butylene, such as methylene.

[0048] In some implementation schemes, R 1H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 ynyl, 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, or with one or more R 1-1 Substituted C1-C6 alkyl groups, with one or more R 1-2 Substituted 2-6 heteroalkyl groups, with one or more R 1-3 Substituted C2-C6 alkenyl groups, with one or more R 1-4 Substituted C2-C6 ynyl group, or with one or more R groups 1-5 Substituted 3-10 membered heterocyclic alkyl groups; preferably H, C1-C6 alkyl groups, or substituted with one or more R groups. 1-1 Substituted C1-C6 alkyl groups or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups; also preferably H, and substituted with one or more R groups. 1-1 Substituted C1-C6 alkyl groups, or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups.

[0049] In some implementations, when R 1 When it is a C1-C6 alkyl group, the C1-C6 alkyl group is a C4-C6 alkyl group, such as n-butyl.

[0050] In some implementation schemes, R 1-1 Independently hydroxyl, C1-C6 alkoxy, -NR 6 R 6 , 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups, with one or more R 1-1-2 The 6-10 aryl group is replaced or is replaced by one or more R groups. 1-1-3 Substituted 5-10 aryl groups; preferably -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups or substituted with one or more R 1-1-2 The substituted 6-10 aryl group; preferably -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups, or those with one or more R groups 1-1-2 Replaced 6-10 aryl groups.

[0051] In some implementation schemes, R 1-2Independently H, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, -NR 6 R 6 6-10 aryl groups, or those containing one or more R groups 1-1-2 Replaced 6-10 aryl groups.

[0052] In some implementation schemes, R 1-1-1 Independently C1-C6 alkyl or Preferred .

[0053] In some implementation schemes, R 1-1-2 Independently hydroxyl, cyano, halogen, C1-C6 alkyl, C1-C6 alkoxy, NR 6 R 6 or by one or more R 1-1-4 Substituted C1-C6 alkyl groups; preferably C1-C6 alkyl groups.

[0054] In some implementation schemes, R 1-1-3 It is independently a C1-C6 alkyl group, or is composed of one or more R groups. 1-1-4 Substituted C1-C6 alkyl groups.

[0055] In some implementation schemes, R 1-5 Independently C1-C6 alkyl or Preferred .

[0056] In some implementation schemes, R 7 It is independently a C1-C6 alkoxy or a 3-10 membered cycloalkyl.

[0057] In some implementation schemes, R 3 Independently halogen, C1-C6 alkyl, C1-C6 alkoxy, , , , , 3-10 membered cycloalkyl or 3-10 membered heterocycloalkyl; preferably halogen, C1-C6 alkyl or C1-C6 alkoxy; even more preferably C1-C6 alkoxy.

[0058] In some implementation schemes, R 4 For one or more R 4-1 Substituted methyl group.

[0059] In some implementation schemes, R 4-1 Independently for -NR 6 R 6 3-10 membered heterocyclic alkyl groups, or those containing one or more R groups 4-2The substituted 3-10-membered heterocyclic alkyl group; the heteroatom of the heterocyclic alkyl group is selected from N, O, or S, and contains at least one nitrogen atom; preferably a 3-10-membered heterocyclic alkyl group, or substituted with one or more R atoms. 4-2 The substituted 3-10 membered heterocyclic alkyl group; the heteroatom of the heterocyclic alkyl group is selected from N, O or S, and contains at least one nitrogen atom.

[0060] In some implementation schemes, R 4-2 It is independently hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, or is oxidized by one or more R 4-3 Substituted C1-C6 alkyl; preferably hydroxyl, C1-C6 alkyl, or substituted with one or more R 4-3 Substituted C1-C6 alkyl; preferably C1-C6 alkyl or substituted with one or more R 4-3 Substituted C1-C6 alkyl groups.

[0061] In some implementation schemes, R 4-3 Independently, it is a hydroxyl group.

[0062] In some implementation schemes, R 6 Each is independently a C1-C6 alkyl group.

[0063] In some implementations, n is 1.

[0064] In some implementation schemes, R 3 The replacement position is the opposite position.

[0065] In some implementation schemes,

[0066] A is O;

[0067] R 1 H, C1-C6 alkyl, and formed by one or more R 1-1 Substituted C1-C6 alkyl groups or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups;

[0068] R 1-1 Independently for -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups or substituted with one or more R 1-1-2 Substituted 6-10 aryl groups;

[0069] R 1-5 Independently ;

[0070] R 6 Each is independently a C1-C6 alkyl group;

[0071] R 1-1-1 Independently ;

[0072] R 1-1-2 Independently, it is a C1-C6 alkyl group;

[0073] R 7 Independently, it is a C1-C6 alkoxy or a 3-10 membered cycloalkyl group;

[0074] R 3 Independently C1-C6 alkoxy group;

[0075] n is 1;

[0076] R 4 For H or by one or more R 4-1 Substituted C1-C6 alkyl groups;

[0077] R 4-1 Independently a 3-10 membered heterocyclic alkyl group, or consisting of one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups;

[0078] R 4-2 It is independently hydroxyl, C1-C6 alkyl, or contains one or more R 4-3 Substituted C1-C6 alkyl groups;

[0079] R 4-3 Independently, it is a hydroxyl group;

[0080] R 1 and R 4 Not both H;

[0081] R 3 The replacement position is the opposite position.

[0082] In some implementation schemes,

[0083] A is O;

[0084] R 1 For H, by one or more R 1-1 Substituted C1-C6 alkyl groups or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups;

[0085] R 1-1 Independently for -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups or substituted with one or more R 1-1-2Substituted 6-10 aryl groups;

[0086] R 1-5 Independently ;

[0087] R 6 Each is independently a C1-C6 alkyl group;

[0088] R 1-1-1 Independently ;

[0089] R 1-1-2 Independently, it is a C1-C6 alkyl group;

[0090] R 7 Independently, it is a C1-C6 alkoxy or a 3-10 membered cycloalkyl group;

[0091] R 3 Independently C1-C6 alkoxy group;

[0092] n is 1;

[0093] R 4 For H or by one or more R 4-1 Substituted C1-C6 alkyl groups;

[0094] R 4-1 Independently a 3-10 membered heterocyclic alkyl group, or consisting of one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups;

[0095] R 4-2 It is independently hydroxyl, C1-C6 alkyl, or contains one or more R 4-3 Substituted C1-C6 alkyl groups;

[0096] R 4-3 Independently, it is a hydroxyl group;

[0097] R 1 and R 4 Not both H;

[0098] R 3 The replacement position is the opposite position.

[0099] In some implementation schemes,

[0100] A is O;

[0101] R 1 For H, by one or more R 1-1 Substituted C1-C6 alkyl groups or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups;

[0102] R 1-1Independently for -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups or substituted with one or more R 1-1-2 Substituted 6-10 aryl groups;

[0103] R 1-5 Independently ;

[0104] R 6 Each is independently a C1-C6 alkyl group;

[0105] R 1-1-1 Independently ;

[0106] R 1-1-2 Independently, it is a C1-C6 alkyl group;

[0107] R 7 Independently, it is a C1-C6 alkoxy or a 3-10 membered cycloalkyl group;

[0108] R 3 Independently C1-C6 alkoxy group;

[0109] n is 1;

[0110] R 4 For H or by one or more R 4-1 Substituted C1-C6 alkyl groups;

[0111] R 4-1 Independently a 3-10 membered heterocyclic alkyl group, or consisting of one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups;

[0112] R 4-2 It is independently hydroxyl, C1-C6 alkyl, or contains one or more R 4-3 Substituted C1-C6 alkyl groups;

[0113] R 4-3 Independently, it is a hydroxyl group;

[0114] R 1 and R 4 Not both H;

[0115] R 3 The replacement position is the opposite position.

[0116] In some implementation schemes, R 1 Methyl, ethyl, n-propyl, isopropyl, n-butyl, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , or .

[0117] In some implementation schemes, R 4 for , , , , , , or .

[0118] In some implementation schemes, R 4-1 for , , , , or .

[0119] In some implementation schemes, R 3 It is a methoxy group.

[0120] In some embodiments, the compound represented by Formula I is a compound represented by Formula Ia or Ib;

[0121] or ;

[0122] Where, n, R 1 R 3 and R 4 The definition is as described above.

[0123] In some embodiments, the compound represented by Formula I is a compound represented by Formula Ic or Id;

[0124] or ;

[0125] Among them, R 1 R 3 and R 4 The definition is as described above.

[0126] In some embodiments, the compound represented by Formula I is a compound represented by Formula Ie or If;

[0127] or ;

[0128] Among them, R 1 It is a C1-C6 alkyl, C2-C6 alkenyl, C2-C6 ynyl, 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, or formed by one or more R groups. 1-1 Substituted C1-C6 alkyl groups, with one or more R 1-2 Substituted 2-6 heteroalkyl groups, with one or more R 1-3 Substituted C2-C6 alkenyl groups, with one or more R 1-4 Substituted C2-C6 ynyl group or with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups;

[0129] R 1-1 Independently hydroxyl, C1-C6 alkoxy, -NR 6 R 6 , 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups, with one or more R 1-1-2 The 6-10 aryl group is replaced or is replaced by one or more R groups. 1-1-3 Substituted 5-10 heteroaryl groups;

[0130] R 1-2Independently H, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, -NR 6 R 6 6-10 aryl groups or those containing one or more R groups 1-1-2 Substituted 6-10 aryl groups;

[0131] R 1-1-1 Independently C1-C6 alkyl or ;

[0132] R 1-1-2 Independently hydroxyl, cyano, halogen, C1-C6 alkyl, C1-C6 alkoxy, NR 6 R 6 Or by one or more R 1 -1-4 Substituted C1-C6 alkyl groups;

[0133] R 1-1-3 Independently C1-C6 alkyl or composed of one or more R 1-1-4 Substituted C1-C6 alkyl groups;

[0134] R 1-1-4 Independently hydroxyl, C1-C6 alkoxy, -NR 6 R 6 , phenyl or ;

[0135] R 1-3 and R 1-4 Each is independently a C1-C6 alkyl or ;

[0136] R 1a R 1b and R 1c Each is independently a C1-C6 alkyl group;

[0137] R 1-5 Independently C1-C6 alkyl or ;

[0138] R 7 It is independently a hydroxyl group, a C1-C6 alkyl group, a C1-C6 alkoxy group, or a 3-10 membered cycloalkyl group;

[0139] R 4 For one or more R 4-1 Substituted methyl groups;

[0140] R 4-1 Independently for -NR 6 R 6 3-10 membered heterocyclic alkyl groups or those containing one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups;

[0141] R 4-2 It is independently hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, or is oxidized by one or more R 4-3 Substituted C1-C6 alkyl groups;

[0142] R 4-3 Independently, it is a hydroxyl group;

[0143] R 6 Each is independently H or C1-C6 alkyl.

[0144] In some embodiments, the compound represented by Formula I is a compound represented by Formula Ig or Ih;

[0145] or

[0146] Among them, R 1 It is a C4-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl or composed of one or more R groups. 1-1 Substituted C1-C6 alkyl groups;

[0147] R 1-1 Independently 6-10 aryl groups substituted with one or more halogens or substituted with one or more R 1-1-3 Substituted 5-10 heteroaryl groups;

[0148] R 7 It is a 3-10 membered cycloalkyl group;

[0149] R 1-1-3 Independently, it is a C1-C6 alkyl group substituted with one or more hydroxyl groups;

[0150] R 4 For one or more R 4-1 Substituted methyl groups;

[0151] R 4-1 Independently for -NR 6 R 6 ;

[0152] R 6 Each is independently H or C1-C6 alkyl.

[0153] In some embodiments, the compound represented by Formula I or a pharmaceutically acceptable salt thereof is selected from any of the following compounds:

[0154] .

[0155] In some embodiments, the compound represented by Formula I is the sole active ingredient of the drug.

[0156] The present invention also provides the use of a pharmaceutical composition in the preparation of a medicament for the prevention or treatment of osteoporosis; said pharmaceutical composition comprising a compound represented by Formula I as described above or a pharmaceutically acceptable salt thereof, and at least one pharmaceutical excipient.

[0157] The present invention also provides the use of a compound of Formula I as described above or a pharmaceutical composition as described above in the preparation of a medicament for promoting osteogenic differentiation of bone marrow mesenchymal stem cells.

[0158] The present invention also provides a method for treating or preventing osteoporosis, comprising administering (therapeuticly effective amount) of a compound of Formula I as described above or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition thereof, to a subject requiring treatment.

[0159] the term

[0160] Unless otherwise stated, the definitions of groups and terms described in this invention, including definitions as examples, exemplary definitions, preferred definitions, definitions listed in tables, and definitions of specific compounds in the examples, can be arbitrarily combined and combined with each other. Such combinations and combinations of group definitions and compound structures should fall within the scope of this specification.

[0161] The term "multiple" can mean, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more; preferably 2 or 3.

[0162] The term "alkyl" refers to a straight-chain or branched, saturated monovalent hydrocarbon group having a specified number of carbon atoms (e.g., C1-C6, C1-C4). Alkyl groups include, but are not limited to: methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, n-hexyl, etc.

[0163] The term "alkenyl" refers to a straight-chain or branched, unsaturated monovalent hydrocarbon group having a specified number of carbon atoms (e.g., C2–C6, C2–C4) and having one or more (e.g., 1, 2, or 3) carbon-carbon sp groups. 2 Double bonds. Alkenyl groups include, but are not limited to: vinyl, propenyl, allyl, butenyl, or pentenyl, for example... , .

[0164] The term "alkynyl" refers to a straight-chain or branched, unsaturated monovalent hydrocarbon group having a specified number of carbon atoms (e.g., C2–C6, C2–C4) and having one or more (e.g., 1, 2, or 3) carbon-carbon sp groups. 3 Triple bond. Alkynyl groups include, but are not limited to: ethynyl, , wait.

[0165] The term "heteroalkyl" refers to an alkyl group substituted with one or more heteroatoms, which can be N, O, or S, and the number of heteroatoms can be 1, 2, or 3; when the heteroatom is N, N can be substituted or unsubstituted, for example... or The alkyl group is defined as described above. The heteroalkyl group, for example... , , , , or ; where side a is connected to A.

[0166] The term "cycloalkyl" refers to a cyclic, saturated monovalent hydrocarbon group having a specified number of ring atoms (e.g., 3-10, 3-7), and is monocyclic. Cycloalkyl groups include, but are not limited to: , , , wait.

[0167] The term "heterocyclic alkyl" refers to a saturated monocyclic, spirocyclic, bridged, or fused cyclic group having a specified number of ring atoms (e.g., 3-10, 3-6), a specified number of heteroatoms (e.g., 1, 2, or 3), and a specified type of heteroatom (1, 2, or 3 of N, O, and S), preferably a monocyclic group. Heterocyclic alkyl groups include, but are not limited to, piperazinyl, morpholinyl, piperidinyl, tetrahydropyrrolyl, or ethylene oxide, for example... , , , , , or .

[0168] The term "halogen" refers to F, Cl, Br, and I.

[0169] The term "alkoxy" refers to the group R. X -O-,R X The definition is the same as the term "alkyl". Alkoxy groups include, but are not limited to: methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, isobutoxy, or sec-butoxy;

[0170] The term "6-10 aryl" refers to either phenyl or naphthyl.

[0171] The term "heteroaryl" refers to a monocyclic or polycyclic cyclic group having a specified number of ring atoms (e.g., 5-10, 5-8, or 5-6), a specified number of heteroatoms (e.g., 1, 2, or 3), and a specified type of heteroatom (one, two, or three of N, O, and S), and possessing aromaticity. Heteroaryl groups include, but are not limited to, pyridinyl, pyrimidinyl, furanyl, or 1,2,3-triazole, for example... , , or .

[0172] Those skilled in the art will understand that, according to conventions used in the art, the use of "" in the structural formulas describing the functional groups in this invention is appropriate. "" means that the corresponding group R is connected to other fragments or groups in the compound through this site.

[0173] The term "pharmaceuticalally acceptable salt" refers to a salt obtained by reacting a compound with a pharmaceutically acceptable (relatively non-toxic, safe, and suitable for patient use) acid or base. When a compound contains a relatively acidic functional group, a base addition salt can be obtained by contacting the free form of the compound with a sufficient amount of a pharmaceutically acceptable base in a suitable inert solvent. When a compound contains a relatively basic functional group, an acid addition salt can be obtained by contacting the free form of the compound with a sufficient amount of a pharmaceutically acceptable acid in a suitable inert solvent. See Handbook of Pharmaceutical Salts: Properties, Selection, and Use (P. Heinrich Stahl, 2002) for details.

[0174] The term "pharmaceutical excipients" refers to excipients and additives used in the production of pharmaceuticals and the dispensing of prescriptions. It includes all substances contained in pharmaceutical preparations, excluding the active ingredient. See the Pharmacopoeia of the People's Republic of China (2020 Edition), Volume IV, or the Handbook of Pharmaceutical Excipients (Raymond C Rowe, 2009 Sixth Edition).

[0175] The term “treatment” refers to a therapeutic approach. When a specific condition is involved, treatment means: (1) alleviating one or more biological manifestations of the disease or condition; (2) interfering with (a) one or more points in a biological cascade that causes or induces the condition or (b) one or more biological manifestations of the condition; (3) improving one or more symptoms, effects or side effects associated with the condition, or one or more symptoms, effects or side effects associated with the condition or its treatment; or (4) slowing the development of the condition or one or more biological manifestations of the condition.

[0176] The term "prevention" refers to the reduction of the risk of acquiring or developing a disease or disorder.

[0177] The term "therapeutic effective amount" refers to an amount of compound sufficient to effectively treat the disease or condition described herein when administered to a patient. The "therapeutic effective amount" will vary depending on the compound, the condition and its severity, and the age of the patient to be treated, but may be adjusted as needed by those skilled in the art.

[0178] Without violating common sense in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0179] The reagents and raw materials used in this invention are all commercially available.

[0180] The positive and progressive effects of this invention are that the icariin derivative of this invention achieves at least one of the following effects:

[0181] (1) A novel icariin derivative with a novel structure was provided;

[0182] (2) Compared with icariin, it enhanced the effect of promoting osteogenic differentiation of bone marrow mesenchymal stem cells in osteoporotic mice;

[0183] (3) Improved drug properties such as water solubility. Detailed Implementation

[0184] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0185] Example 1: Preparation of compound b11

[0186]

[0187] Preparation of compound b2

[0188] Compound a1 (6.080 g, 22.519 mmol) was dissolved in 100 mL of pyridine, and acetic anhydride (13 mL, 137.647 mmol) was slowly added. The mixture was heated at 70 °C for 5 h, and the reaction was monitored by TLC. After the reaction was complete, the mixture was cooled to room temperature, and some of the pyridine was distilled off. The solution was poured into ice water, stirred, filtered, and the filter cake was recrystallized from the filter cake using ethanol:acetone = 3:1 to give yellowish-white needle-like crystals b2 (8.155 g, 91%). 1 H NMR(500 MHz, CDCl3) δ 7.87 (d, J = 8.7 Hz, 2H), 7.34 (d, J = 2.2 Hz, 1H), 7.25(d, J = 4.9 Hz, 1H), 6.84 (d, J = 2.2 Hz, 1H), 6.61 (s, 1H), 2.43 (s, 3H), 2.34 (s, 4H), 2.33 (s, 3H). 13 C NMR (126 MHz, CDCl3) δ 169.57, 169.05, 168.14,161.87, 157.78, 154.11, 153.47, 150.37, 128.76, 127.74, 122.54, 113.87,109.17, 108.74, 21.33, 21.29, 21.23.

[0189] Preparation of compound b3

[0190] Compound b2 (486 mg, 1.227 mmol), K2CO3 (437 mg, 3.167 mmol), and KI (99 mg, 0.596 mmol) were added to 10 mL of acetone, heated at 55 °C under nitrogen protection, and BnBr (300 μl, 2.526 mmol) was slowly added. The reaction was carried out for 24 h, and the reaction was monitored by LC-MS until it was complete. After the reaction was completed, the mixture was filtered, the solvent was evaporated from the filtrate, and the crude product was recrystallized from ethanol to give white needle crystals b3 (384 mg, 70%). 1 H NMR (500 MHz, CDCl3) δ 7.90 – 7.83 (m, 2H), 7.46 – 7.42(m, 4H), 7.42 – 7.37 (m, 1H), 7.25 (d, J = 9.1 Hz, 3H), 6.95 (d, J = 2.4 Hz, 1H), 6.70 (d, J = 2.4 Hz, 1H), 6.57 (s, 1H), 5.16 (s, 2H), 2.44 (s, 3H), 2.34(s, 3H). 13C NMR (126 MHz, CDCl3) δ 176.53, 169.85, 169.10, 162.79, 161.38,158.92, 153.27, 150.74, 135.46, 129.10, 128.97, 128.71, 127.75, 127.72, 127.65, 122.47, 109.08, 108.61, 100.13, 70.94, 21.31.

[0191] Preparation of compounds b4 and b5

[0192] Dissolve b3 (2.562 g, 5.770 mmol) in 25 mL of methanol, add 25 mL of 7 mol / L ammonia-methanol solution, react for 2 h, and monitor by TLC. After the reaction is complete, evaporate the solvent to obtain a yellow solid as crude product b4. Add crude product b4 and K2CO3 (5.621 g, 40.732 mmol) to a reaction flask, add 60 mL of acetone, place in an ice bath, add CH3I (2.5 mL, 40.141 mmol), heat to reflux at 55 °C, react for 12 h, and monitor by TLC. After the reaction is complete, filter while hot, evaporate the solvent from the filtrate, and recrystallize from acetone to obtain a pale yellow powder b5 (2.522 g, 95%).

[0193] b4: 1 H NMR (500 MHz, DMSO-d6) δ 12.97 (s, 1H), 10.40 (s, 1H), 7.96 –7.93 (m, 2H), 7.49 – 7.46 (m, 2H), 7.44 – 7.39 (m, 2H), 7.38 – 7.33 (m, 1H), 6.95 – 6.91 (m, 2H), 6.86 – 6.84 (m, 2H), 6.45 (d, J = 2.2 Hz, 1H), 5.23 (s, 2H). 13 C NMR (126 MHz, DMSO-d6) δ 181.91, 164.11, 164.09, 161.32, 161.22,157.16, 136.14, 128.55, 128.13, 127.86, 121.04, 115.98, 104.78, 103.05,98.59, 93.51, 69.96.

[0194] b5: 1H NMR (500 MHz, DMSO-d6) δ 8.00 – 7.95 (m, 2H), 7.53 – 7.48 (m,2H), 7.45 – 7.41 (m, 2H), 7.39 – 7.35 (m, 1H), 7.11 – 7.06 (m, 2H), 6.95 (d,J = 2.2 Hz, 1H), 6.67 (s, 1H), 6.58 (d, J = 2.3 Hz, 1H), 5.25 (s, 2H), 3.83(d, J = 9.8 Hz, 6H). 13 C NMR (126 MHz, DMSO-d6) δ 175.60, 162.64, 161.77,160.27, 159.66, 159.05, 136.17, 128.54, 128.17, 128.01, 127.67, 123.01,114.46, 108.40, 106.79, 96.73, 94.16, 69.96, 56.09, 55.48.

[0195] Preparation of compound b6

[0196] Dissolve b5 (729 mg, 1.879 mmol), Togni reagent II (1-Trifluoromethyl-1,2-benziodoxol-3(1H)-one, 760 mg, 2.405 mmol), and CuI (37 mg, 0.195 mmol) in 10 mL of anhydrous DMF. Under nitrogen protection, the reaction was carried out at 80 °C for 24 h. The reaction was then stopped, extracted with dichloromethane, washed with saturated brine, dried over anhydrous Na2SO4, filtered, concentrated, and separated by silica gel column chromatography (PE:EA = 3:1) to obtain a pale yellow solid b6 (319 mg, 37%). 1 H NMR (500 MHz, DMSO-d6) δ 7.60– 7.55 (m, 2H), 7.47 (dt, J = 6.3, 1.4 Hz, 2H), 7.43 – 7.38 (m, 2H), 7.38 –7.33 (m, 1H), 7.12 – 7.07 (m, 2H), 6.82 (d, J = 2.3 Hz, 1H), 6.66 (d, J = 2.3Hz, 1H), 5.22 (s, 2H), 3.85 (d, J = 6.1 Hz, 6H). 13C NMR (126 MHz, DMSO-d6) δ171.76, 163.55, 161.58, 160.38, 158.40, 135.98, 130.54, 128.54, 128.21,128.00, 123.93, 113.78, 107.52, 97.57, 94.05, 70.16, 56.35, 55.46.

[0197] Preparation of compound b7

[0198] Dissolve b6 (3.485 g, 7.643 mmol) in 70 mL of anhydrous acetonitrile. Add AlCl3 (1.5 g, 11.278 mmol) under an ice bath. Under nitrogen protection, heat to reflux at 80 °C for 2 h. After cooling to room temperature, add AlCl3 (1.5 g, 11.278 mmol) again under an ice bath. Under nitrogen protection, heat to reflux at 80 °C for another 2 h. Monitor by TLC. After the reaction is complete, quench the reaction with 6 mol / L hydrochloric acid solution. Extract with ethyl acetate, wash with saturated brine, dry with anhydrous Na2SO4, filter, concentrate, and separate by silica gel column chromatography (PE:EA = 5:1) to obtain white solid b7 (2.753 g, 79%). 1 H NMR (500 MHz, DMSO-d6) δ 12.28 (s, 1H),7.64 – 7.58 (m, 2H), 7.45 (d, J = 6.7 Hz, 2H), 7.42 – 7.38 (m, 2H), 7.37 –7.33 (m, 1H), 7.15 – 7.10 (m, 2H), 6.82 – 6.78 (m, 1H), 6.59 – 6.55 (m, 1H), 5.24 (d, J = 3.1 Hz, 2H), 3.85 (s, 3H). 13 C NMR (126 MHz, DMSO-d6) δ 178.45,165.03, 161.87, 161.12, 156.70, 135.91, 130.71, 128.54, 128.18, 127.85,123.73, 113.82, 104.21, 99.64, 93.93, 70.17, 55.50.

[0199] Preparation of compound b8

[0200] Dissolve b7 (3.173 g, 7.179 mmol), K2CO3 (4.965 g, 35.978 mmol), and 3,3-dimethylallyl bromide (2.4 ml, 20.940 mmol) in 50 ml of DMF. Heat the mixture at 50 °C for 5 h and monitor the reaction by TLC. After the reaction is complete, extract with dichloromethane, wash with saturated brine, dry with anhydrous Na2SO4, filter, concentrate, and separate by silica gel column chromatography (PE:EA = 10:1) to obtain a pale yellow solid b8 (2.989 g, 82%). 1 H NMR (500 MHz, DMSO-d6) δ 7.61 – 7.55 (m, 2H), 7.47 (d, J= 6.9 Hz, 2H), 7.43 – 7.39 (m, 4H), 7.38 – 7.33 (m, 1H), 7.13 – 7.08 (m, 2H), 6.82 (d, J = 2.2 Hz, 1H), 6.69 (d, J = 2.3 Hz, 1H), 5.49 – 5.43 (m, 1H), 5.23(s, 2H), 4.63 (d, J = 6.5 Hz, 2H), 3.84 (s, 3H), 1.78 – 1.70 (m, 6H). 13 C NMR(126 MHz, DMSO-d6) δ 171.69, 163.42, 161.54, 159.52, 158.42, 137.26, 136.01,130.52, 128.55, 128.21, 127.99, 123.97, 119.37, 113.79, 98.56, 94.06, 70.12, 65.97, 55.47, 25.46, 18.13.

[0201] Preparation of compounds b9 and b10

[0202] Dissolve b8 (1.696 g, 3.326 mmol), Eu(fod)3 (344 mg, 0.332 mmol), and NaHCO3 (262 mg, 3.119 mmol) in 20 mL of chlorobenzene. Under nitrogen protection, heat at 85 °C for 24 h and monitor the reaction by TLC. After the reaction is complete, evaporate the solvent and separate by silica gel column chromatography (PE:EA = 5:1) to obtain a pale yellow solid b9 (1.172 g, 69%) and a white solid b10 (492 mg, 29%).

[0203] b9: 1H NMR (500 MHz, DMSO-d6) δ 12.34 (s, 1H), 7.64 (d, J = 8.7 Hz,2H), 7.47 – 7.43 (m, 2H), 7.41 (dd, J = 8.4, 6.6 Hz, 2H), 7.38 – 7.32 (m,1H), 7.16 – 7.11 (m, 2H), 6.74 (s, 1H), 5.29 (s, 2H), 5.11 – 5.05 (m, 1H), 3.85 (s, 3H), 1.56 (d, J = 1.7 Hz, 3H), 1.44 (d, J = 1.4 Hz, 3H). 13 C NMR (126MHz, DMSO-d6) δ 178.91, 162.40, 161.97, 159.64, 153.08, 136.16, 131.47,130.81, 128.53, 128.12, 127.62, 123.84, 121.39, 113.87, 107.92, 103.59,97.40, 70.29, 55.53, 25.41, 21.31, 17.50.

[0204] b10: 1 H NMR (500 MHz, DMSO-d6) δ 7.57 (d, J = 8.6 Hz, 2H), 7.49 –7.39 (m, 4H), 7.38 – 7.32 (m, 1H), 7.13 – 7.08 (m, 2H), 6.86 – 6.83 (m, 1H), 5.25 (s, 2H), 4.59 – 4.51 (m, 1H), 3.84 (s, 3H), 1.41 – 1.33 (m, 6H), 1.13 (s, 3H). 13 C NMR (126 MHz, DMSO-d6) δ 171.61, 161.54, 159.55, 157.72, 156.93,136.17, 130.46, 128.62, 128.12, 127.46, 124.14, 120.80, 113.76, 104.38,93.85, 90.55, 70.09, 55.47, 42.99, 25.07, 20.61, 14.01.

[0205] Preparation of compound b11

[0206] B9 (766 mg, 1.502 mmol), Pd / C (324 mg), and 1,4-cyclohexadiene (1.4 ml, 14.823) were dissolved in 10 ml of methanol and heated at 50 °C for 3 h. The reaction was monitored by TLC. After the reaction was completed, the mixture was filtered through diatomaceous earth, concentrated, and purified by C18 reverse silica gel column chromatography (acetonitrile:water = 1:1) to obtain a yellowish-white solid, B11 (559 mg, 89%). 1 H NMR (500 MHz, DMSO-d6) δ 12.24 (s,1H), 8.35 (s, 1H), 7.61 (d, J = 8.7 Hz, 2H), 7.12 (d, J = 8.8 Hz, 2H), 6.32(s, 1H), 5.14 – 5.07 (m, 1H), 3.85 (s, 3H), 3.25 (d, J = 7.2 Hz, 2H), 1.57(d, J = 1.5 Hz, 3H), 1.51 (d, J = 1.4 Hz, 3H). 13 C NMR (126 MHz, DMSO-d6) δ178.00, 166.88, 165.43, 161.77, 153.95, 145.23, 130.72, 130.68, 124.12,122.14, 113.80, 110.40, 106.64, 102.11, 99.78, 55.50, 25.42, 21.19, 17.56.

[0207] Example 2: Preparation of compounds a6, b17-b41, and b51

[0208] The general preparation method for compounds a6, b17-b41, and b51: Dissolve compound b11 (1 eq) in an appropriate amount of acetone, and add the following formula: The halogenated hydrocarbons (1.5 eq) and K2CO3 (3 eq) shown were heated to reflux at 60 °C and monitored by TLC. After the reaction was completed, the mixture was filtered, concentrated, and separated with silica gel using petroleum ether and ethyl acetate as mobile phases.

[0209]

[0210] a6: Pale yellow solid, yield 83%. 1 H NMR (500 MHz, CDCl3) δ 12.45 (s, 1H), 7.61 –7.51 (m, 2H), 7.03 – 6.99 (m, 2H), 6.43 (s, 1H), 5.12 – 5.06 (m, 1H), 3.91(s, 3H), 3.90 (s, 3H), 3.36 (d, J = 7.1 Hz, 2H), 1.63 (dd, J = 17.8, 1.4 Hz, 6H). 13 C NMR (126 MHz, CDCl3) δ 179.67, 163.84, 162.48, 160.88, 153.58,132.30, 130.92, 130.90, 124.48, 121.78, 121.75, 113.92, 108.36, 104.31,96.09, 56.30, 55.63, 25.86, 21.65, 17.90.

[0211] b17: Pale yellow solid, yield 23%. 1H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.56 (d, J = 8.6 Hz, 2H), 7.04 – 6.98 (m, 2H), 6.41 (s, 1H), 5.14 – 5.07 (m, 1H), 4.12 (q, J = 7.0 Hz, 2H), 3.90 (s, 3H), 3.37 (d, J = 7.2 Hz, 2H), 1.65 (d, J= 1.5 Hz, 3H), 1.63 (d, J = 1.3 Hz, 3H), 1.46 (t, J = 7.0 Hz, 3H). 13 C NMR(126 MHz, CDCl3) δ 179.64, 163.28, 162.46, 160.79, 153.64, 132.14, 130.91,124.53, 121.85, 113.98, 113.93, 108.36, 96.75, 64.72, 55.64, 25.91, 21.74,17.98, 14.77.

[0212] b18: Pale yellow solid, yield 73%. 1 H NMR (500 MHz, CDCl3) δ 12.41 (s, 1H), 7.61 –7.47 (m, 2H), 7.08 – 6.96 (m, 2H), 6.41 (d, J = 2.7 Hz, 1H), 5.14 – 5.06 (m,1H), 4.66 (hept, J = 6.1 Hz, 1H), 3.90 (s, 3H), 3.35 (d, J = 7.2 Hz, 2H), 1.63 (dd, J = 10.0, 1.4 Hz, 6H), 1.38 (d, J = 6.1 Hz, 6H). 13 C NMR (126 MHz, CDCl3) δ 179.54, 167.36, 162.53, 162.44, 162.39, 160.66, 153.88, 131.97,130.89, 130.87, 124.55, 123.95, 121.94, 113.98, 113.93, 110.08, 109.23,109.04, 104.09, 71.25, 55.63, 31.65, 25.89, 22.10, 22.07, 21.82, 18.03.

[0213] b19: Pale yellow solid, yield 81%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.60 –7.53 (m, 2H), 7.04 – 6.98 (m, 2H), 6.41 (s, 1H), 5.13 – 5.06 (m, 1H), 4.05(t, J = 6.4 Hz, 2H), 3.90 (s, 3H), 3.37 (d, J = 7.1 Hz, 2H), 1.86 – 1.77 (m,2H), 1.64 (d, J = 1.5 Hz, 3H), 1.61 (d, J = 1.4 Hz, 3H), 1.57 – 1.46 (m, 2H),0.99 (td, J = 7.4, 2.9 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.62, 167.42,163.44, 162.44, 160.83, 160.80, 153.61, 132.06, 130.89, 124.52, 121.94,113.97, 113.92, 108.35, 104.15, 96.74, 68.78, 55.63, 31.18, 25.89, 21.74,19.35, 17.94, 13.92.

[0214] b20: Pale yellow solid, yield 91%. 1 H NMR (500 MHz, CDCl3) δ 12.43 (s, 1H), 7.60 –7.53 (m, 2H), 7.04 – 6.98 (m, 2H), 6.41 (s, 1H), 6.04 (ddt, J = 17.1, 10.4,5.2 Hz, 1H), 5.43 (dq, J = 17.2, 1.6 Hz, 1H), 5.33 (dp, J = 10.6, 1.3 Hz, 1H), 5.12 (dddd, J = 8.6, 5.7, 2.9, 1.5 Hz, 1H), 4.63 (dt, J = 5.2, 1.5 Hz,2H), 3.90 (s, 3H), 3.40 (d, J = 7.1 Hz, 2H), 1.64 (d, J = 1.4 Hz, 3H), 1.61(d, J = 1.4 Hz, 3H).13 C NMR (126 MHz, CDCl3) δ 179.65, 162.74, 162.47,160.72, 153.68, 132.27, 132.20, 130.91, 124.47, 121.76, 118.36, 113.93,108.61, 104.42, 97.08, 69.58, 55.63, 25.88, 21.77, 18.01.

[0215] b21: Pale yellow solid, yield 78%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.58 –7.53 (m, 2H), 7.03 – 6.98 (m, 2H), 6.42 (s, 1H), 5.46 (dddt, J = 8.1, 6.4,2.9, 1.4 Hz, 1H), 5.10 (ddq, J = 8.6, 5.8, 1.4 Hz, 1H), 4.60 (d, J = 6.6 Hz, 2H), 3.90 (s, 3H), 3.37 (d, J = 7.2 Hz, 2H), 1.80 (d, J = 1.4 Hz, 3H), 1.75(d, J = 1.3 Hz, 3H), 1.64 (d, J = 1.4 Hz, 3H), 1.60 (d, J = 1.4 Hz, 3H). 13 CNMR (126 MHz, CDCl3) δ 179.63, 163.25, 162.44, 160.70, 153.64, 138.97,132.11, 130.90, 124.52, 121.90, 118.90, 113.91, 108.58, 104.20, 97.10, 65.97,55.63, 25.91, 21.77, 18.45, 17.93.

[0216] b22: Pale yellow solid, yield 44%. 1H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.61 –7.54 (m, 2H), 7.05 – 6.96 (m, 2H), 6.39 (s, 1H), 5.10 (tdd, J = 5.8, 2.8, 1.5Hz, 1H), 4.36 (dd, J = 10.9, 2.8 Hz, 1H), 3.99 (dd, J = 11.0, 5.9 Hz, 1H), 3.90 (s, 3H), 3.39 (ddt, J = 6.7, 5.6, 2.7 Hz, 3H), 2.95 – 2.92 (m, 1H), 2.78(dd, J = 4.9, 2.6 Hz, 1H), 1.65 (d, J = 1.4 Hz, 3H), 1.63 (d, J = 1.4 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.70, 162.53, 162.49, 160.79, 153.72,132.40, 130.93, 124.39, 121.65, 114.02, 113.96, 108.66, 104.69, 96.80, 69.71,55.64, 49.85, 44.59, 25.89, 21.78, 17.97.

[0217] b23: Pale yellow solid, yield 55%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.58 –7.54 (m, 2H), 7.03 – 6.99 (m, 2H), 6.39 (s, 1H), 5.10 (tt, J = 7.2, 1.5 Hz,1H), 4.36 (dd, J = 10.9, 2.8 Hz, 1H), 3.99 (dd, J = 11.0, 5.9 Hz, 1H), 3.90(s, 3H), 3.39 (ddt, J = 8.6, 3.9, 2.6 Hz, 3H), 2.94 (dd, J = 4.9, 4.1 Hz, 1H), 2.77 (dd, J = 4.9, 2.6 Hz, 1H), 1.65 (d, J = 1.4 Hz, 4H), 1.63 (d, J =1.3 Hz, 3H). 13C NMR (126 MHz, CDCl3) δ 179.69, 162.52, 162.49, 160.77,153.71, 132.39, 130.92, 124.37, 121.64, 114.01, 113.95, 108.66, 104.67,96.79, 69.70, 55.64, 49.85, 44.58, 25.88, 21.77, 17.96.

[0218] b24: Pale yellow solid, yield 61%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.56 (d, J = 8.7 Hz, 2H), 7.01 (d, J = 8.8 Hz, 2H), 6.54 (s, 1H), 5.12 – 5.08 (m,1H), 4.79 (d, J = 2.4 Hz, 2H), 3.90 (s, 3H), 3.41 – 3.37 (m, 2H), 2.57 (t, J= 2.4 Hz, 1H), 1.66 – 1.61 (m, 6H). 13 C NMR (126 MHz, CDCl3) δ 179.72, 162.54,161.64, 160.63, 153.73, 132.47, 130.92, 124.38, 121.57, 114.02, 113.96,109.05, 104.91, 97.29, 76.64, 56.70, 55.64, 25.87, 21.75, 17.99.

[0219] b25: Light yellow solid, yield 83%. 1 H NMR (500 MHz, CDCl3) δ 12.42 (s, 1H), 7.56 (d, J = 8.7 Hz, 2H), 7.01 (d, J = 8.8 Hz, 2H), 6.52 (s, 1H), 5.10 (tp, J =7.2, 1.3 Hz, 1H), 4.76 (s, 2H), 3.90 (s, 4H), 3.39 (d, J = 7.1 Hz, 2H), 1.65 (d, J = 1.4 Hz, 3H), 1.64 (d, J = 1.4 Hz, 3H), 0.18 (s, 9H). 13C NMR (126 MHz, CDCl3) δ 179.72, 162.51, 161.91, 160.62, 153.69, 132.41, 130.92, 130.90,124.42, 121.64, 113.96, 108.94, 104.79, 98.80, 97.35, 94.10, 57.57, 55.64, 25.90, 21.79, 18.02.

[0220] b26: Light yellow solid, yield 85%. 1 H NMR (500 MHz, CDCl3) δ 12.43 (s, 1H), 7.59 –7.52 (m, 2H), 7.04 – 6.98 (m, 2H), 6.43 (s, 1H), 5.08 (ddt, J = 7.1, 5.7, 1.5Hz, 1H), 4.13 (t, J = 6.2 Hz, 2H), 3.90 (s, 4H), 3.75 (t, J = 4.7 Hz, 4H), 3.36 (d, J = 7.1 Hz, 2H), 2.58 (d, J = 7.1 Hz, 2H), 2.53 – 2.49 (m, 5H), 2.04(t, J = 6.6 Hz, 2H), 1.62 (dd, J = 16.2, 1.4 Hz, 6H). 13 C NMR (126 MHz, CDCl3)δ 179.62, 163.15, 162.47, 160.81, 153.62, 132.08, 130.90, 124.45, 121.96,113.99, 113.92, 108.31, 104.28, 96.78, 67.09, 66.93, 55.63, 55.48, 53.83,26.19, 25.89, 21.73, 18.03.

[0221] b27: Light yellow solid, yield 91%. 1H NMR (500 MHz, CDCl3) δ 12.43 (s, 1H), 7.59 –7.52 (m, 2H), 7.04 – 6.98 (m, 2H), 6.40 (s, 1H), 5.03 (d, J = 7.3 Hz, 1H), 4.34 (s, 2H), 3.90 (s, 3H), 3.58 (s, 4H), 3.35 (d, J = 6.8 Hz, 2H), 3.12 (s,1H), 2.92 – 2.67 (m, 3H), 1.64 (d, J = 1.5 Hz, 3H), 1.61 – 1.59 (m, 3H), 1.46(s, 9H). 13 C NMR (126 MHz, CDCl3) δ 179.64, 162.55, 160.93, 153.75, 132.47,130.91, 124.34, 121.82, 114.03, 113.96, 108.35, 96.76, 55.65, 53.19, 28.49,25.86, 21.78, 18.10.

[0222] b28: Yellow solid, yield 83%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.59 –7.52 (m, 2H), 7.04 – 6.99 (m, 2H), 6.75 (t, J = 2.1 Hz, 2H), 6.34 (s, 1H),6.17 (t, J = 2.1 Hz, 2H), 5.09 – 5.02 (m, 1H), 4.34 (t, J = 4.8 Hz, 2H), 4.30 (dd, J = 5.7, 3.8 Hz, 2H), 3.90 (s, 3H), 3.37 (d, J = 7.0 Hz, 2H), 1.65 (d, J= 1.5 Hz, 3H), 1.59 (d, J = 1.4 Hz, 3H). 13C NMR (126 MHz, CDCl3) δ 180.96,163.80, 163.66, 162.08, 154.96, 133.56, 132.20, 125.65, 123.08, 122.43,115.22, 110.21, 109.86, 105.93, 97.88, 70.15, 56.93, 50.08, 27.08, 23.06,19.35.

[0223] b29: Yellow solid, yield 76%. 1 H NMR (500 MHz, DMSO-d6) δ 7.63 (d, J = 8.4 Hz, 2H), 7.23 – 7.03 (m, 2H), 6.62 (s, 1H), 5.09 (t, J = 7.3 Hz, 1H), 4.19 (t, J= 5.6 Hz, 2H), 3.85 (s, 3H), 3.29 (d, J = 7.3 Hz, 2H), 2.65 (t, J = 5.7 Hz, 2H), 2.21 (s, 6H), 1.56 (s, 3H), 1.54 (s, 3H). 13 C NMR (126 MHz, DMSO-d6) δ178.72, 167.52, 162.72, 161.94, 153.14, 131.23, 130.79, 123.91, 121.59,113.87, 110.62, 103.60, 97.08, 67.32, 57.53, 55.55, 45.54, 25.45, 21.24,17.57.

[0224] b30: Light yellow solid, yield 94%. 1H NMR (500 MHz, CDCl3) δ 12.43 (s, 1H), 7.55 (d, J = 8.6 Hz, 2H), 7.01 (dd, J = 9.0, 2.4 Hz, 2H), 6.42 (s, 1H), 5.09 (td,J = 6.5, 3.1 Hz, 1H), 4.23 (t, J = 5.4 Hz, 2H), 3.90 (s, 3H), 3.75 (d, J =4.6 Hz, 4H), 3.36 (d, J = 7.0 Hz, 2H), 2.91 (d, J = 5.4 Hz, 2H), 2.64 (s,5H), 1.67 – 1.63 (m, 3H), 1.61 (d, J = 1.3 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ179.64, 162.81, 162.49, 160.81, 153.68, 132.21, 130.90, 124.41, 121.86,114.00, 113.93, 108.45, 104.45, 96.83, 67.00, 66.90, 57.43, 55.63, 54.23,54.20, 25.88, 21.77, 18.06.

[0225] b31: Light yellow solid, yield 90%. 1 H NMR (500 MHz, CDCl3) δ 12.43 (s, 1H), 7.56 (d, J = 8.7 Hz, 2H), 7.03 – 6.99 (m, 2H), 6.41 (s, 1H), 5.10 (dddt, J = 7.1,5.6, 2.9, 1.4 Hz, 1H), 4.01 (t, J = 6.4 Hz, 3H), 3.90 (s, 3H), 3.38 (d, J =7.1 Hz, 2H), 1.90 – 1.81 (m, 2H), 1.64 (d, J = 1.4 Hz, 3H), 1.61 (d, J = 1.4Hz, 3H), 1.06 (t, J = 7.4 Hz, 3H). 13C NMR (126 MHz, CDCl3) δ 179.62, 163.43,162.45, 160.81, 153.63, 132.06, 130.90, 124.54, 121.95, 113.98, 113.93,108.37, 96.75, 70.58, 55.63, 25.89, 22.56, 21.74, 17.95, 10.66.

[0226] b32: Yellowish-white solid, yield 56%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.56 (d, J = 8.3 Hz, 2H), 7.36 – 7.31 (m, 2H), 7.01 (dd, J = 9.0, 2.3 Hz, 2H), 6.92 (dd, J = 8.8, 2.8 Hz, 2H), 6.50 (s, 1H), 5.08 (d, J = 4.1 Hz, 3H), 3.90(s, 3H), 3.82 (s, 3H), 3.38 (d, J = 7.1 Hz, 2H), 1.63 (s, 3H), 1.51 (s, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.65, 162.98, 162.47, 160.74, 159.80, 153.66,132.24, 130.90, 129.33, 127.92, 124.46, 121.80, 114.22, 114.19, 113.98,113.93, 108.69, 104.41, 97.28, 70.70, 55.62, 55.45, 25.88, 21.82, 17.91.

[0227] b33: Yellow solid, yield 27%. 1H NMR (500 MHz, CDCl3) δ 12.42 (d, J = 1.8 Hz,1H), 7.55 (d, J = 8.5 Hz, 2H), 7.04 – 6.98 (m, 2H), 6.41 (s, 1H), 5.11 – 5.04(m, 1H), 4.61 (dq, J = 6.6, 3.3 Hz, 1H), 3.90 (s, 3H), 3.66 (ddd, J = 12.0,7.6, 3.6 Hz, 2H), 3.45 – 3.38 (m, 2H), 3.37 (d, J = 7.1 Hz, 2H), 1.98 (d, J =13.3 Hz, 2H), 1.83 – 1.77 (m, 2H), 1.67 – 1.62 (m, 3H), 1.60 (s, 3H), 1.47(s, 8H). 13 C NMR (126 MHz, CDCl3) δ 179.56, 167.47, 162.49, 161.48, 160.68,154.89, 153.99, 132.21, 130.89, 124.41, 121.89, 113.95, 109.17, 104.42,97.43, 73.11, 55.64, 30.50, 28.57, 25.86, 21.83, 18.09.

[0228] b34: Pale yellow solid, yield 46%. 1 H NMR (500 MHz, CDCl3) δ 12.42 (s, 1H), 7.58 –7.51 (m, 2H), 7.01 (dd, J = 9.0, 2.3 Hz, 2H), 6.27 (s, 1H), 5.19 – 5.13 (m,1H), 4.61 (s, 2H), 3.90 (s, 3H), 3.44 (d, J = 7.1 Hz, 2H), 1.64 (d, J = 1.4Hz, 3H), 1.61 (d, J = 1.3 Hz, 6H), 1.49 (s, 9H). 13C NMR (126 MHz, CDCl3) δ179.70, 166.88, 162.52, 161.99, 160.66, 153.84, 132.33, 130.93, 130.92,124.40, 121.70, 113.94, 109.00, 104.93, 96.63, 83.10, 66.09, 55.64, 28.19, 25.87, 21.81, 17.99.

[0229] b35: Pale yellow solid, yield 57%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.56 (d, J = 8.5 Hz, 2H), 7.06 – 6.96 (m, 2H), 6.26 (s, 1H), 5.14 (ddt, J = 8.5,7.0, 1.4 Hz, 1H), 4.81 (s, 2H), 3.90 (s, 3H), 3.47 (d, J = 7.0 Hz, 2H), 2.20 (tt, J = 7.8, 4.6 Hz, 1H), 1.64 (d, J = 1.4 Hz, 3H), 1.61 (d, J = 1.3 Hz,3H), 1.21 – 1.15 (m, 2H), 1.01 (dt, J = 7.8, 3.4 Hz, 2H). 13 C NMR (126 MHz, CDCl3) δ 205.28, 179.68, 162.54, 161.91, 160.78, 153.86, 124.34, 121.65,113.96, 108.82, 96.78, 73.28, 55.64, 25.86, 21.87, 17.99, 17.37, 12.19.

[0230] b36: Yellowish-white solid, yield 75%. 1H NMR (500 MHz, CDCl3) δ 12.45 (s, 1H), 7.56 (d, J = 8.5 Hz, 2H), 7.45 – 7.40 (m, 2H), 7.34 (d, J = 8.3 Hz, 2H), 7.05 –6.98 (m, 2H), 6.50 (s, 1H), 5.14 (s, 2H), 3.90 (d, J = 0.9 Hz, 3H), 3.41 (d,J = 7.1 Hz, 2H), 1.64 (d, J = 1.5 Hz, 3H), 1.52 (d, J = 1.4 Hz, 3H), 1.33 (d,J = 0.9 Hz, 10H). 13 C NMR (126 MHz, CDCl3) δ 179.65, 163.00, 162.46, 160.75,153.67, 151.50, 132.89, 132.25, 130.91, 130.89, 127.34, 127.08, 125.74,124.47, 121.84, 113.92, 108.69, 104.43, 97.29, 70.70, 55.62, 34.76, 31.45,25.88, 21.84, 17.91.

[0231] b37: Pale yellow solid, yield 85%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.58 –7.52 (m, 2H), 7.30 – 7.26 (m, 2H), 7.03 – 6.99 (m, 2H), 6.95 (tt, J = 7.3,1.1 Hz, 1H), 6.91 (dt, J = 7.7, 1.0 Hz, 2H), 6.46 (s, 1H), 5.07 (dddd, J =8.5, 5.6, 2.8, 1.4 Hz, 1H), 4.27 (t, J = 6.0 Hz, 2H), 4.17 (t, J = 5.9 Hz,2H), 3.90 (s, 3H), 3.37 (d, J = 7.0 Hz, 2H), 2.32 (t, J = 6.0 Hz, 2H), 1.61 (d, J = 1.4 Hz, 3H), 1.60 (d, J = 1.3 Hz, 3H). 13C NMR (126 MHz, CDCl3) δ179.64, 163.07, 162.47, 160.86, 158.84, 153.62, 132.14, 130.90, 129.65,124.48, 121.90, 121.05, 114.59, 113.99, 113.93, 108.35, 96.80, 65.59, 64.06,55.63, 29.26, 25.82, 21.77, 17.98.

[0232] b38: Pale yellow solid, yield 93%. 1 H NMR (500 MHz, CDCl3) δ 12.45 (s, 1H), 7.60 –7.53 (m, 2H), 7.28 (dd, J = 8.7, 7.3 Hz, 2H), 7.06 – 6.99 (m, 2H), 6.94 (td,J = 7.3, 1.1 Hz, 1H), 6.92 – 6.88 (m, 2H), 6.43 (s, 1H), 5.10 (tt, J = 7.0,1.4 Hz, 1H), 4.14 (t, J = 5.9 Hz, 2H), 4.04 (t, J = 6.0 Hz, 2H), 3.90 (s,3H), 3.38 (d, J = 7.1 Hz, 2H), 2.10 – 1.95 (m, 4H), 1.64 (d, J = 1.4 Hz, 3H), 1.62 (d, J = 1.4 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.63, 163.21, 162.46,160.82, 158.99, 153.64, 132.13, 130.90, 129.61, 124.49, 121.94, 120.87,114.57, 113.93, 108.36, 96.74, 68.66, 67.28, 55.63, 26.11, 26.08, 25.88,21.75, 18.00.

[0233] b39: Pale yellow solid, yield 75%. 1H NMR (500 MHz, CDCl3) δ 12.43 (s, 1H), 7.55 (d, J = 8.7 Hz, 2H), 7.04 – 6.98 (m, 2H), 6.43 (s, 1H), 5.12 – 5.06 (m, 1H),4.15 (t, J = 6.2 Hz, 2H), 3.90 (s, 3H), 3.56 (t, J = 6.1 Hz, 2H), 3.36 (s,3H), 2.13 – 2.06 (m, 2H), 1.65 (d, J = 1.4 Hz, 3H), 1.61 (d, J = 1.4 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.62, 163.25, 162.46, 160.84, 153.61, 132.05,130.90, 124.51, 121.96, 113.98, 113.93, 108.32, 104.26, 96.82, 68.99, 65.93,58.92, 55.63, 29.57, 25.88, 21.75, 17.98.

[0234] b40: Pale yellow solid, yield 53%. 1 H NMR (500 MHz, CDCl3) δ 12.43 (s, 1H), 7.60 –7.53 (m, 2H), 7.04 – 6.98 (m, 2H), 6.42 (s, 1H), 5.17 – 5.10 (m, 1H), 4.21 –4.15 (m, 2H), 3.90 (s, 3H), 3.83 – 3.78 (m, 2H), 3.73 – 3.62 (m, 1H), 3.38(d, J = 7.1 Hz, 2H), 1.64 (d, J = 1.4 Hz, 3H), 1.62 (d, J = 1.4 Hz, 3H), 1.20(d, J = 6.1 Hz, 6H). 13C NMR (126 MHz, CDCl3) δ 179.66, 163.15, 162.45,160.73, 153.63, 132.08, 130.90, 124.49, 121.87, 113.98, 113.92, 108.57,104.39, 96.90, 72.38, 68.75, 66.28, 55.63, 25.88, 22.18, 21.78, 17.98.

[0235] b41: Pale yellow solid, yield 73%. 1 H NMR (500 MHz, CDCl3) δ 12.44 (s, 1H), 7.57 (d, J = 8.8 Hz, 2H), 7.30 (ddd, J = 7.6, 6.3, 1.3 Hz, 2H), 7.24 – 7.18 (m,3H), 7.05 – 6.99 (m, 2H), 6.38 (s, 1H), 5.17 – 5.11 (m, 1H), 4.04 (t, J = 6.2Hz, 2H), 3.91 (s, 3H), 3.41 (d, J = 7.0 Hz, 2H), 2.83 (t, J = 7.5 Hz, 2H),2.16 (dq, J = 8.3, 6.3 Hz, 2H), 1.66 (d, J = 1.5 Hz, 3H), 1.64 (d, J = 1.3Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.63, 163.23, 162.47, 160.81, 153.64,141.10, 132.15, 130.90, 128.69, 128.59, 126.30, 124.50, 122.00, 113.99,113.93, 108.36, 104.27, 96.74, 67.92, 55.63, 32.20, 30.73, 25.90, 21.77,18.04.

[0236] b51: White solid, yield 71%. 1H NMR (500 MHz, CDCl3) δ 12.45 (s, 1H), 7.60 –7.53 (m, 2H), 7.41 – 7.32 (m, 4H), 7.05 – 6.98 (m, 2H), 6.46 (s, 1H), 5.14 –5.07 (m, 3H), 3.90 (s, 3H), 3.40 (d, J = 7.0 Hz, 2H), 1.64 (d, J = 1.4 Hz, 3H), 1.53 (d, J = 1.4 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.68, 162.56,162.52, 160.80, 153.71, 134.39, 134.34, 132.40, 130.91, 129.05, 128.89,128.66, 124.39, 121.72, 114.02, 113.96, 108.71, 104.61, 97.16, 70.04, 55.64, 25.88, 21.84, 17.96.

[0237] b51-1: White solid, yield 76%. 1 H NMR (500 MHz, CDCl3) δ7.58 – 7.37 (m, 2H),7.33 – 7.15 (m, 2H), 7.08 – 6.82 (m,4H), 6.39 (s, 1H), 5.10 (s,1H), 5.01 (d,J = 5.8 Hz,2H), 3.83 (d, J = 8.0 Hz, 3H), 3.34 (d, J = 7.1 Hz, 1H), 2.77 –2.45 (m, 1H), 1.37 – 1.08 (m, 6H).

[0238] b51-2: White solid, 82% yield. ¹H NMR (500 MHz, CDCl₃) δ 7.58 – 7.37 (m, 2H), 7.33–7.15 (m, 2H), 7.08–6.82 (m, 4H), 6.39 (s, 1H), 5.10 (s, 1H), 5.01 (d, J = 5.8 Hz, 2H), 3.83 (d, J = 8.0 Hz, 3H), 3.34 (d, J = 7.1 Hz, 1H), 2.77–2.45 (m, 1H), 1.37–1.08 (m, 6H).

[0239] b51-3: White solid, 75% yield. ¹H NMR (500 MHz, CDCl₃) δ 7.61 – 7.52 (m, 2H), 7.38 – 7.32 (m, 1H), 7.27 – 7.21 (m, 1H), 7.18 – 7.09 (m, 1H), 7.03 – 6.94 (m, 2H), 6.62 (d, J = 1.8 Hz, 1H), 5.30 (s, 1H), 5.22 (s, 1H), 3.91 – 3.86 (m, 2H), 2.75 – 2.69 (m, 2H), 1.43 – 1.16 (m, 6H). 13 C NMR (101 MHz, CDCl3) δ130.67, 130.25, 129.68, 129.54, 124.88, 121.58, 115.65, 115.44, 114.90,114.70, 113.69, 95.52, 77.34, 77.02, 76.70, 64.76, 55.45, 38.40, 28.27, 25.72, 22.43, 21.99, 20.78, 17.73.

[0240] Example 3: Preparation of compounds b49 and b50

[0241] The general preparation method of compounds b49 and b50: Copper acetate (0.5 eq), L-(+)-sodium ascorbate (1 eq), and 1,10-phenanthroline monohydrate (0.5 eq) were dissolved in a solvent (DMF:H2O=4:1), stirred for 5 min, compound b24 (1 eq) and azide compound (1.2 eq) were added, and the reaction was monitored by TLC. After the reaction was completed, the mixture was extracted with dichloromethane, washed with saturated brine, dried with anhydrous Na2SO4, filtered, concentrated, and centrifuged with silica gel using dichloromethane and methanol as the mobile phase.

[0242]

[0243] b49: Yellow solid, yield 54%. 1H NMR (500 MHz, CDCl3) δ 12.45 (s, 1H), 7.77 (d, J = 4.2 Hz, 1H), 7.58 – 7.53 (m, 2H), 7.01 (dd, J = 9.0, 2.3 Hz, 2H), 6.56 (s, 1H), 5.31 (s, 2H), 5.19 (s, 2H), 5.10 – 5.04 (m, 1H), 4.28 (q, J =7.1 Hz, 2H), 3.90 (s, 3H), 3.36 (d, J = 7.1 Hz, 2H), 1.61 (d, J = 1.4 Hz, 3H), 1.51 (d, J = 1.3 Hz, 3H), 1.31 (t, J = 7.1 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.67, 166.18, 162.50, 162.27, 160.80, 153.73, 132.34, 130.90,124.37, 121.68, 114.00, 113.93, 108.76, 104.73, 97.06, 62.74, 62.72, 55.64,51.10, 25.84, 21.79, 17.93, 14.19.

[0244] b50: Yellow solid, yield 57%. 1 H NMR (500 MHz, CDCl3) δ 12.45 (s, 1H), 7.75 (d,J = 6.2 Hz, 1H), 7.59 – 7.52 (m, 2H), 7.04 – 6.98 (m, 2H), 6.55 (s, 1H), 5.28(s, 2H), 5.10 – 5.03 (m, 1H), 4.52 (t, J = 4.7 Hz, 2H), 4.10 (t, J = 4.8 Hz,2H), 3.90 (s, 3H), 3.35 (d, J = 7.1 Hz, 2H), 1.63 – 1.60 (m, 3H), 1.51 (d, J= 1.4 Hz, 3H). 13C NMR (126 MHz, CDCl3) δ 179.67, 162.51, 162.30, 160.78,153.74, 143.03, 132.30, 130.92, 124.37, 124.21, 121.73, 114.01, 113.94,108.73, 104.71, 97.06, 62.79, 61.32, 55.64, 52.79, 25.86, 21.79, 17.93.

[0245] Example 4: Preparation of compounds b42-b48 and b52

[0246] A general preparation method for compounds b42-b48 and b52: Take paraformaldehyde (3 eq), formula The secondary amine (3 eq) was dissolved in an appropriate amount of methanol, heated to reflux at 63°C for 30 min, cooled to room temperature, compound b11 (1 eq) was added, and the reaction was continued to be heated to reflux at 63°C. The reaction was monitored by TLC. After the reaction was completed, the mixture was concentrated and separated with silica gel using dichloromethane and methanol as the mobile phase.

[0247]

[0248] b42: Dark yellow solid, 90% yield. 1 H NMR (500 MHz, CDCl3) δ 12.79 (s, 1H), 7.54 (d, J = 8.6 Hz, 2H), 7.04 – 6.97 (m, 2H), 5.19 – 5.13 (m, 1H), 4.07 (s, 2H), 3.90 (s, 3H), 3.37 (d, J = 7.0 Hz, 2H), 2.85 – 2.78 (m, 4H), 1.95 (p, J = 3.4Hz, 4H), 1.65 (d, J = 1.4 Hz, 3H), 1.61 (d, J = 1.3 Hz, 3H).

[0249] 13C NMR (126 MHz, CDCl3) δ 179.37, 162.33, 157.10, 153.94, 132.05,130.88, 124.67, 122.26, 113.86, 107.56, 104.87, 102.83, 55.62, 53.49, 50.80,25.87, 23.81, 21.68, 17.99.

[0250] b43: Dark yellow solid, yield 41%. 1 H NMR (500 MHz, CDCl3) δ 12.91 (s, 1H), 7.58 –7.51 (m, 2H), 7.05 – 6.97 (m, 2H), 5.15 (tdd, J = 5.6, 2.9, 1.4 Hz, 1H), 4.05(s, 2H), 3.90 (s, 3H), 3.41 (d, J = 7.0 Hz, 2H), 3.24 (s, 3H), 2.50 (s, 3H), 1.80 (t, J = 5.7 Hz, 6H), 1.64 (d, J = 1.4 Hz, 3H), 1.61 (d, J = 1.3 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.53, 167.30, 162.47, 158.25, 154.43, 132.33,130.91, 124.41, 121.89, 113.99, 113.92, 103.83, 103.39, 55.63, 53.64, 25.86, 24.30, 23.09, 21.90, 18.00.

[0251] b44: Dark yellow solid, yield 58%. 1H NMR (500 MHz, CDCl3) δ 13.04 (s, 1H), 7.54 (d, J = 8.8 Hz, 2H), 7.03 – 6.97 (m, 2H), 5.13 (tdt, J = 5.8, 2.9, 1.4 Hz, 1H), 4.15 (s, 2H), 3.90 (s, 3H), 3.43 (d, J = 7.0 Hz, 2H), 3.37 (s, 2H), 2.68 (s, 2H), 1.79 (s, 2H), 1.64 (d, J = 1.4 Hz, 4H), 1.60 (d, J = 1.4 Hz, 3H), 1.01 (s, 3H). 13 C NMR (126 MHz, CDCl3) δ 180.99, 163.87, 160.09, 133.81, 132.23, 125.51, 122.92, 115.33, 115.25, 78.70, 78.64, 78.44, 78.19, 56.93, 27.12, 23.39, 19.30.

[0252] b45: dark yellow solid, yield 92%. 1 H NMR (500 MHz, CDCl3) δ 12.77 (s, 1H), 7.59 – 7.52 (m, 2H), 7.01 (dd, J = 9.0, 2.4 Hz, 2H), 5.15 (dddd, J = 8.5, 5.6, 2.8, 1.4 Hz, 1H), 3.90 (s, 6H), 3.77 (d, J = 21.2 Hz, 4H), 3.37 (d, J = 7.0 Hz, 2H), 2.67 (s, 5H), 1.65 (d, J = 1.5 Hz, 3H), 1.62 (d, J = 1.3 Hz, 2H). 13 C NMR (126 MHz, CDCl3) δ 179.48, 167.07, 164.16, 162.41, 157.61, 153.80, 132.30, 130.89, 124.51, 121.98, 113.97, 113.90, 107.23, 103.71, 66.66, 55.62, 53.60, 52.83, 25.88, 21.59, 17.98.

[0253] b46: Dark yellow solid, yield 80%. 1 H NMR (500 MHz, CDCl3) δ 7.57 – 7.51 (m, 2H),7.04 – 6.98 (m, 2H), 5.15 (tdt, J = 5.7, 2.8, 1.4 Hz, 1H), 3.94 (s, 2H), 3.90(s, 3H), 3.38 (d, J = 7.0 Hz, 2H), 3.00 (s, 1H), 2.02 (d, J = 13.6 Hz, 2H), 1.65 (d, J = 1.5 Hz, 3H), 1.62 (d, J = 1.4 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ179.46, 164.88, 162.40, 132.24, 130.88, 124.57, 122.05, 113.97, 113.90,55.62, 52.94, 25.88, 21.67, 17.99.

[0254] b47: Dark yellow solid, yield 85%. 1 H NMR (500 MHz, CDCl3) δ 12.72 (s, 1H), 7.58 –7.51 (m, 2H), 7.03 – 6.97 (m, 2H), 5.16 (t, J = 6.8 Hz, 1H), 3.89 (s, 5H),3.54 (d, J = 6.3 Hz, 2H), 3.36 (d, J = 6.9 Hz, 2H), 3.08 (s, 2H), 2.39 – 2.14(m, 2H), 1.84 (d, J = 13.2 Hz, 2H), 1.65 (s, 3H), 1.61 (s, 3H), 1.37 (d, J =13.0 Hz, 2H). 13 C NMR (126 MHz, CDCl3) δ 179.34, 162.32, 157.26, 153.67,132.09, 130.87, 130.85, 124.65, 122.21, 113.85, 55.61, 25.87, 21.55, 17.98.

[0255] b48: Dark yellow solid, yield 80%. 1H NMR (500 MHz, CDCl3) δ 12.73 (s, 1H), 7.54 (d, J = 8.5 Hz, 2H), 7.03 – 6.97 (m, 2H), 5.16 (tt, J = 7.3, 1.7 Hz, 1H), 3.90 (s, 3H), 3.88 (s, 2H), 3.36 (d, J = 6.9 Hz, 2H), 3.13 (d, J = 11.4 Hz,2H), 2.28 – 2.15 (m, 2H), 1.85 (d, J = 12.4 Hz, 2H), 1.65 (d, J = 1.5 Hz,3H), 1.61 (d, J = 1.3 Hz, 3H), 1.51 – 1.35 (m, 3H), 1.21 (s, 6H). 13 C NMR (126MHz, CDCl3) δ 179.35, 166.88, 162.32, 157.29, 153.72, 132.08, 130.87, 124.67,122.22, 113.85, 104.18, 72.27, 55.61, 53.50, 46.89, 27.25, 25.87, 21.58,17.99.

[0256] b52: Dark yellow solid, yield 36%. 1 H NMR (500 MHz, CDCl3) δ 12.77 (s, 1H), 7.54 (d, J = 8.5 Hz, 2H), 7.03 – 6.98 (m, 2H), 5.19 – 5.13 (m, 1H), 3.90 (s, 3H), 3.89 (s, 2H), 3.38 (d, J = 7.0 Hz, 2H), 2.44 (s, 6H), 1.65 (d, J = 1.5 Hz, 3H), 1.62 (s, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.44, 162.36, 157.39, 153.91,132.15, 130.88, 124.63, 122.16, 113.95, 113.89, 107.37, 104.45, 55.62, 54.50,44.13, 44.09, 25.88, 21.64, 17.98.

[0257] Example 4: Preparation of compounds b49 and b50

[0258] Copper acetate (0.5 eq), L-(+)-sodium ascorbate (1 eq), and 1,10-phenanthroline monohydrate (0.5 eq) were dissolved in a solvent (DMF:H2O=4:1) and stirred for 5 min. Compound b24 (1 eq) and azide compound (1.2 eq) were added. The reaction was monitored by TLC. After the reaction was completed, the mixture was extracted with dichloromethane, washed with saturated brine, dried over anhydrous Na2SO4, filtered, concentrated, and separated with silica gel using dichloromethane and methanol as the mobile phase.

[0259] b49: Yellow solid, yield 54%. 1 H NMR (500 MHz, CDCl3) δ 12.45 (s, 1H), 7.77 (d,J = 4.2 Hz, 1H), 7.58 – 7.53 (m, 2H), 7.01 (dd, J = 9.0, 2.3 Hz, 2H), 6.56(s, 1H), 5.31 (s, 2H), 5.19 (s, 2H), 5.10 – 5.04 (m, 1H), 4.28 (q, J = 7.1Hz, 2H), 3.90 (s, 3H), 3.36 (d, J = 7.1 Hz, 2H), 1.61 (d, J = 1.4 Hz, 3H),1.51 (d, J = 1.3 Hz, 3H), 1.31 (t, J = 7.1 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ179.67, 166.18, 162.50, 162.27, 160.80, 153.73, 132.34, 130.90, 124.37,121.68, 114.00, 113.93, 108.76, 104.73, 97.06, 62.74, 62.72, 55.64, 51.10,25.84, 21.79, 17.93, 14.19.

[0260] b50: Yellow solid, yield 57%. 1H NMR (500 MHz, CDCl3) δ 12.45 (s, 1H), 7.75 (d,J = 6.2 Hz, 1H), 7.59 – 7.52 (m, 2H), 7.04 – 6.98 (m, 2H), 6.55 (s, 1H), 5.28(s, 2H), 5.10 – 5.03 (m, 1H), 4.52 (t, J = 4.7 Hz, 2H), 4.10 (t, J = 4.8 Hz,2H), 3.90 (s, 3H), 3.35 (d, J = 7.1 Hz, 2H), 1.63 – 1.60 (m, 3H), 1.51 (d, J= 1.4 Hz, 3H). 13 C NMR (126 MHz, CDCl3) δ 179.67, 162.51, 162.30, 160.78,153.74, 143.03, 132.30, 130.92, 124.37, 124.21, 121.73, 114.01, 113.94,108.73, 104.71, 97.06, 62.79, 61.32, 55.64, 52.79, 25.86, 21.79, 17.93.

[0261] Example 5: Experiment on the promotion of osteogenic differentiation of bone marrow mesenchymal stem cells by icariin derivatives in osteoporotic mice

[0262] 5.1 Test Sample

[0263] The compounds described in the examples.

[0264] 5.2 Laboratory Animals

[0265] Eight-week-old female C57BL / 6 mice were used. C57BL / 6 mouse bone marrow mesenchymal stem cells were purchased from Cyagen (catalog number MUBMX-01001). OriCell® C57BL / 6 mouse BMSCs (bone marrow mesenchymal stem cells) were extracted from the bone marrow of healthy male C57BL / 6 mice, passage number P6. The cell surface markers were analyzed and met the BMSC criteria (CD29, CD44, and Sca-1 were positive, >70%; CD117 and CD31 were negative).

[0266] 5.3 Experimental reagents and materials

[0267] The experimental reagents, consumables and instruments used in this application are shown in Tables 1, 2 and 3, respectively.

[0268] Table 1 Experimental Reagents and Materials

[0269]

[0270] 5.4 Experimental Consumables

[0271] Table 2 Experimental Consumables

[0272]

[0273] 5.5 Experimental Apparatus

[0274] Table 3 Experimental Instruments

[0275]

[0276] 5.6 Experimental Methods

[0277] 5.6.1 BMSCs induction methods:

[0278] (1) Osteogenesis induction: P3-P5 generation BMSCs in the logarithmic growth phase were digested, centrifuged, resuspended, and counted, and then evenly seeded into well plates at a density of 2×10⁴ cells / cm². 2 The cells were incubated in an incubator at 37°C, 5% CO2, and saturated humidity. When the cell confluence in the wells reached 70%, the culture medium was carefully aspirated from the wells, and osteogenic induction medium preheated to 37°C was added to the wells. The medium was changed every 3 days.

[0279] (2) Adipogenic induction: The cell seeding method is the same as that for osteogenic induction. When the cell confluence in the well plate reaches 100%, carefully change the medium. Replace the complete culture medium with solution A from the mouse bone marrow mesenchymal stem cell osteogenic differentiation induction kit. After induction for 3 days, change to solution B. After maintaining for 1 day, change back to solution A for induction. Alternate between solutions A and B until the next experimental step. Preparation of test sample solution: Dissolve icariin and the compounds prepared in the above examples in DMSO to prepare a 1 μM solution, and store it in the dark for later use.

[0280] 5.6.2 qRT-PCR assay for osteogenic and adipogenic genes

[0281] (1) Pre-cool all reagents for RNA extraction: chloroform, isopropanol, 75% ethanol and RNAiso Plus (RNA extraction kit, Takara) at 4°C. All pipette tips and EP tubes were autoclaved.

[0282] (2) Cells were collected from 6-well plates at days 1, 3 and 6 of osteogenic and adipogenic induction, respectively. The cells were washed twice with PBS, and then 1 mL of RNAiso Plus was added to each well. The cells were lysed on ice for 10 minutes. The RNAiso Plus was collected into 1.5 mL EP tubes in a fume hood and labeled.

[0283] (3) Add 200 μL of chloroform to each 1 mL RNAiso Plus, mix by inverting, let stand at room temperature for 4 minutes, and centrifuge at 4℃ and 12000 rpm for 15 minutes.

[0284] (4) After centrifugation, transfer 400 μL of the upper aqueous phase to a new 1.5 mL EP tube, label it, add 400 μL of isopropanol, mix by inverting, let stand at 4℃ for 10 minutes, and centrifuge at 4℃ and 12000 rpm for 15 minutes.

[0285] (5) Carefully discard the supernatant, add 1 mL of 75% ethanol to wash twice, and centrifuge at 4℃ and 12000 rpm for 5 minutes.

[0286] (6) Carefully discard the supernatant, open the lid and let it stand in the fume hood for 15 minutes to evaporate the remaining moisture, add 30 μL of DEPC water, and heat in a water bath at 55°C for 8 minutes to fully dissolve the RNA.

[0287] (7) Take 1 μL of RNA sample and drop it into an Epoch microplate. Use the same volume of DEPC water as the background and measure the RNA concentration with an enzyme-linked immunosorbent assay (ELISA) reader.

[0288] 5.6.3 Real-time quantitative PCR experiment

[0289] 5.6.3.1 Extraction of total RNA from mesenchymal stem cells using the Trizol method

[0290] (1) Take out the 6-well plate containing mesenchymal stem cells from the incubator, add 1 ml of Trizol solution to each well and repeatedly pipette 20 times to fully lyse the cells, and let it stand at room temperature for 5 minutes.

[0291] (2) Transfer the sample from the 6-well plate to a 1.5 mL nuclease-free centrifuge tube, add 200 μL of CHCl3, shake vigorously 20 times to fully separate RNA and protein, let stand at room temperature for 10 minutes, and then centrifuge at 2000 rpm for 15 minutes at 4°C.

[0292] (3) After centrifugation, aspirate 500 μL of the supernatant solution and transfer it to a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol, 10 μg of glycogen and 50 μL of 3 mol / L sodium chloride solution. Let stand at room temperature for 10 minutes. Centrifuge at 12,000 rpm for 15 minutes at 4 degrees Celsius.

[0293] (4) Aspirate the supernatant, add 1 ml of 75% ethanol to the precipitate, centrifuge at 7500 rpm for 5 minutes at 4 degrees Celsius, and repeat twice;

[0294] (5) Aspirate the supernatant, centrifuge for 10-20 seconds, aspirate the supernatant, let stand at room temperature for 2 minutes, and dissolve in 30 μL of distilled water;

[0295] (6) Measure RNA concentration using Nanodrop;

[0296] (7) Store at -80 degrees Celsius until reverse transcription PCR is performed.

[0297] 5.6.3.2 Reverse transcription PCR (20 µL system, performed according to the Takara RR036A kit)

[0298] (1) Take 8 tubes without nuclease and add 4 μL of 5× PrimeScript RT Master Mix;

[0299] (2) Add 1000 nanograms of RNA sample to each tube;

[0300] (3) Use RNase-free water to make up to 20 μL;

[0301] (4) Tighten the lid, place the instrument in the PCR instrument, and perform reverse transcription according to the procedure in Table 4 below.

[0302] Table 4 Reverse Transcription Procedure

[0303]

[0304] (5) After reverse transcription, remove the cDNA and freeze it at -20℃ for later use.

[0305] 5.6.3.3 Prepare the reaction system according to the Power Up™ SYBR Green Kit instructions, mix thoroughly, and then perform qRT PCR (real-time quantitative reverse transcription polymerase chain reaction).

[0306] Real-time quantitative PCR program:

[0307] (1) Holding Stage, Reps: 1, 95℃ 30 s;

[0308] (2) Cycling Stage, Number of Cycles: 40, 95℃ 5 s, 60℃ 34 s

[0309] (3) Melt Curve Stage.

[0310] 5.6.3.4 Primer Sequence

[0311] Mouse Runx2 Forward:GCAGCACGCTATTAAATCCAA

[0312] Mouse Runx2 Reverse:GCCAAACAGACTCATCCATTC

[0313] 5.7 Test Results

[0314] Bone marrow mesenchymal stem cells (BMSCs) were isolated using the wall selection method. Osteogenic induction was performed while stimulating with 1 µM of the drug. The medium was changed every 3 days, and the samples were collected on day 6. RNA was extracted using the trizol method, and qPCR was performed to measure the expression level of the key osteogenic transcription factor RUNX2.

[0315] Experimental conclusions: The RUNX2 gene expression levels in drug groups b27, b28, b29, b30, b31, b33, b35, b36, b41, b43, b44, b45, b46, b47, b48, and b49 were significantly higher than those in the con group (p<0.05), with b35 showing the best effect. Specific detection results are shown in Table 5 below.

[0316] Table 5

[0317] .

Claims

1. The use of a compound of Formula I or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating osteoporosis. ； in, A is either O or S; R 1 H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 ynyl, 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, or with one or more R 1-1 Substituted C1-C6 alkyl groups, with one or more R 1-2 Substituted 2-6 heteroalkyl groups, with one or more R 1-3 Substituted C2-C6 alkenyl groups, with one or more R 1-4 Substituted C2-C6 ynyl group or with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups; R 1-1 and R 1-2 Each of the following can be independently H, hydroxyl, halogen, C1-C6 alkyl, C1-C6 alkoxy, or -NR. 6 R 6 , 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups, with one or more R 1-1-2 The 6-10 aryl group is replaced or is replaced by one or more R groups. 1-1-3 Substituted 5-10 heteroaryl groups; R 1-1-1 R 1-1-2 and R 1-1-3 Each of these can be independently hydroxyl, cyano, halogen, C1-C6 alkyl, C1-C6 alkoxy, or NR. 6 R 6 , or by one or more R 1-1-4 Substituted C1-C6 alkyl groups; R 1-1-4 Independently hydroxyl, halogen, C1-C6 alkoxy, -NR 6 R 6 , phenyl or ; R 1-3 and R 1-4 Each is independently a C1-C6 alkyl or ; R 1a R 1b and R 1c Each is independently a C1-C6 alkyl group; R 1-5 Independently, it is a C1-C6 alkyl, C1-C6 alkoxy, or 3-10 membered cycloalkyl or ; R 7 It can be independently hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, 3-10 membered cycloalkyl or -O- (3-10 membered cycloalkyl); R 3 It is independently a halogen, hydroxyl, C1-C6 alkyl, or C1-C6 alkoxy group; n is 1, 2, or 3; R 4 For H or by one or more R 4-1 Substituted C1-C6 alkyl groups; R 4-1 Independently for -NR 6 R 6 3-10 membered heterocyclic alkyl groups, or those containing one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups; R 4-2 Independently halogen, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, -NR 6 R 6 or by one or more R 4-3 Substituted C1-C6 alkyl groups; R 4-3 It can be independently a halogen, hydroxyl, or C1-C6 alkoxy group; R 6 Each is independently H or C1-C6 alkyl; R 4 and R 1 Not both H; The heteroatoms of the heteroalkyl group are selected from O, S or N, and the number of heteroatoms is 1, 2 or 3; The heteroatoms of the heterocyclic alkyl group are selected from O, S or N, and the number of heteroatoms is 1, 2 or 3. The heteroatom of the heteroaryl group is selected from O, S or N, and the number of heteroatoms is 1, 2 or 3.

2. The application according to claim 1, characterized in that, It satisfies one or more of the following conditions: (1) Each C1-C6 alkyl group is independently methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl or sec-butyl, for example methyl; (2) Each C2-C6 alkenyl group is independently vinyl, propenyl, allyl, butenyl, or pentenyl, for example , ; (3) Each C2-C6 ynyl group is independently ethynyl, propynyl, propynyl, butynyl, or penynyl, for example; (4) Each 3-10 membered cycloalkyl group is independently a 3-7 membered cycloalkyl group, such as cyclopropyl, cyclobutyl, cyclopentyl or cyclohexyl; (4) Each 3-10 membered heterocyclic alkyl group is independently a 3-6 membered heterocyclic alkyl group; (5) Each heteroatom of a 3-10 membered heterocyclic alkyl group may be N or O independently, and the number of heteroatoms may be 1 or 2 independently; (6) Each 3-10 membered heterocyclic alkyl group may be independently monocyclic or polycyclic, wherein the polycyclic group may be a bridged ring, fused ring, or spirocyclic ring; the polycyclic group may be bicyclic or tricyclic; preferably, each 3-10 membered heterocyclic alkyl group is independently a 3-6 membered monocyclic heterocyclic alkyl group; preferably piperazine, morpholino, piperidinyl, tetrahydropyrrole, or ethylene oxide, for example , , , , , or ; (7) Each 2-6 alkyl group has an O or N heteroatom, and the number of heteroatoms can be 1 or 2 independently; (8) Each 2-6 member heteroalkyl group is , , , , or ;where side a is connected to A; (9) Each C1-C6 alkoxy group may independently be methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, isobutoxy, or sec-butoxy; for example, methoxy; (10) Each 6-10 aryl group may independently be phenyl or naphthyl; preferably phenyl; (11) Each halogen is fluorine, chlorine, bromine or iodine; (12) Each 5-10 membered heteroaryl group may independently be N or O; the number of heteroatoms may independently be 1, 2 or 3; (13) Each 5-10 aryl group can be a monocyclic or bicyclic ring, preferably a monocyclic ring; (14) Each 5-10-membered heteroaryl group is independently a 5-6-membered heteroaryl group; preferably pyridyl, pyrimidinyl, furanyl or 1,2,3-triazole, for example , , or ; (15) Independently for TMS, TES, IPDMS, DEIPS, TBS, or TIPS; (16) Each C1-C6 alkylene group is independently methylene, ethylene, n-propylene, isopropylene, n-butylene, tert-butylene, isobutylene, or sec-butylene, for example, methylene; and (17) The compound represented by Formula I is the only active ingredient of the drug.

3. The application according to claim 1, characterized in that, It satisfies one or more of the following conditions: (1) R 1 H, C1-C6 alkyl, C2-C6 alkenyl, C2-C6 ynyl, 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, or with one or more R 1-1 Substituted C1-C6 alkyl groups, with one or more R 1-2 Substituted 2-6 heteroalkyl groups, with one or more R 1-3 Substituted C2-C6 alkenyl groups, with one or more R 1-4 Substituted C2-C6 ynyl group, or with one or more R groups 1-5 Substituted 3-10 membered heterocyclic alkyl groups; preferably H, C1-C6 alkyl groups, or substituted with one or more R groups. 1-1 Substituted C1-C6 alkyl groups or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups; preferably H, or substituted with one or more R groups. 1-1 Substituted C1-C6 alkyl groups, or those containing one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups; Preferably, when R 1 When it is a C1-C6 alkyl group, the C1-C6 alkyl group is a C4-C6 alkyl group, such as n-butyl; (2) R 1-1 Independently hydroxyl, C1-C6 alkoxy, -NR 6 R 6 , 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups, with one or more R 1 -1-2 The 6-10 aryl group is replaced or is replaced by one or more R groups. 1-1-3 Substituted 5-10 aryl groups; preferably -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups or substituted with one or more R 1-1-2 The substituted 6-10 aryl group; preferably -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups, or those with one or more R groups 1-1-2 Substituted 6-10 aryl groups; (3) R 1-2 Independently H, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, -NR 6 R 6 6-10 aryl groups, or those containing one or more R groups 1-1-2 Substituted 6-10 aryl groups; (4) R 1-1-1 Independently C1-C6 alkyl or Preferred ; (5) R 1-1-2 Independently hydroxyl, cyano, halogen, C1-C6 alkyl, C1-C6 alkoxy, NR 6 R 6 or by one or more R 1 -1-4 Substituted C1-C6 alkyl groups; preferably C1-C6 alkyl groups; (6) R 1-1-3 It is independently a C1-C6 alkyl group, or is composed of one or more R groups. 1-1-4 Substituted C1-C6 alkyl groups; (7) R 1-5 Independently C1-C6 alkyl or Preferred ; (8) R 7 Independently, it is a C1-C6 alkoxy or a 3-10 membered cycloalkyl group; (9) R 3 Independently halogen, C1-C6 alkyl, C1-C6 alkoxy, , , , 3-10 membered cycloalkyl or 3-10 membered heterocycloalkyl; preferably halogen, C1-C6 alkyl or C1-C6 alkoxy; even more preferably C1-C6 alkoxy; (10) R 4 For one or more R 4-1 Substituted methyl groups; (11) R 4-1 Independently for -NR 6 R 6 3-10 membered heterocyclic alkyl groups, or those containing one or more R groups 4-2 The substituted 3-10 membered heterocyclic alkyl group; the heteroatom of the heterocyclic alkyl group is selected from N, O or S, and contains at least one nitrogen atom; preferably a 3-10 membered heterocyclic alkyl group, or substituted with one or more R atoms. 4-2 Substituted 3-10 membered heterocyclic alkyl groups; the heteroatom of the heterocyclic alkyl group is selected from N, O or S, and contains at least one nitrogen atom; (12) R 4-2 It is independently hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, or is contained in one or more R groups. 4-3 Substituted C1-C6 alkyl; preferably hydroxyl, C1-C6 alkyl, or substituted with one or more R 4-3 Substituted C1-C6 alkyl; preferably C1-C6 alkyl or substituted with one or more R 4-3 Substituted C1-C6 alkyl groups; (13) R 4-3 Independently, it is a hydroxyl group; (14) R 6 Each is independently a C1-C6 alkyl group; and (15) n is 1.

4. The application according to claim 1, characterized in that, R 3 The replacement position is the opposite position.

5. The application according to claim 1, characterized in that, It satisfies any of the following schemes: Option 1, A is O; R 1 H, C1-C6 alkyl, and formed by one or more R 1-1 Substituted C1-C6 alkyl groups or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups; R 1-1 Independently for -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups or substituted with one or more R 1-1-2 Substituted 6-10 aryl groups; R 1-5 Independently ; R 6 Each is independently a C1-C6 alkyl group; R 1-1-1 Independently ; R 1-1-2 Independently, it is a C1-C6 alkyl group; R 7 Independently, it is a C1-C6 alkoxy or a 3-10 membered cycloalkyl group; R 3 Independently C1-C6 alkoxy group; n is 1; R 4 For H or by one or more R 4-1 Substituted C1-C6 alkyl groups; R 4-1 Independently a 3-10 membered heterocyclic alkyl group, or consisting of one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups; R 4-2 It is independently hydroxyl, C1-C6 alkyl, or contains one or more R 4-3 Substituted C1-C6 alkyl groups; R 4-3 Independently, it is a hydroxyl group; R 1 and R 4 Not both H; R 3 The replacement position is the opposite position; Option 2, A is O; R 1 For H, by one or more R 1-1 Substituted C1-C6 alkyl groups or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups; R 1-1 Independently for -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups or substituted with one or more R 1-1-2 Substituted 6-10 aryl groups; R 1-5 Independently ; R 6 Each is independently a C1-C6 alkyl group; R 1-1-1 Independently ; R 1-1-2 Independently, it is a C1-C6 alkyl group; R 7 Independently, it is a C1-C6 alkoxy or a 3-10 membered cycloalkyl group; R 3 Independently C1-C6 alkoxy group; n is 1; R 4 For H or by one or more R 4-1 Substituted C1-C6 alkyl groups; R 4-1 Independently a 3-10 membered heterocyclic alkyl group, or consisting of one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups; R 4-2 It is independently hydroxyl, C1-C6 alkyl, or contains one or more R 4-3 Substituted C1-C6 alkyl groups; R 4-3 Independently, it is a hydroxyl group; R 1 and R 4 Not both H; R 3 The replacement position is the opposite position; Option 3, A is O; R 1 For H, by one or more R 1-1 Substituted C1-C6 alkyl groups or those with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups; R 1-1 Independently for -NR 6 R 6 , 3-10 membered heterocyclic alkyl, 6-10 membered aryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups or substituted with one or more R 1-1-2 Substituted 6-10 aryl groups; R 1-5 Independently ; R 6 Each is independently a C1-C6 alkyl group; R 1-1-1 Independently ; R 1-1-2 Independently, it is a C1-C6 alkyl group; R 7 Independently, it is a C1-C6 alkoxy or a 3-10 membered cycloalkyl group; R 3 Independently C1-C6 alkoxy group; n is 1; R 4 For H or by one or more R 4-1 Substituted C1-C6 alkyl groups; R 4-1 Independently a 3-10 membered heterocyclic alkyl group, or consisting of one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups; R 4-2 It is independently hydroxyl, C1-C6 alkyl, or contains one or more R 4-3 Substituted C1-C6 alkyl groups; R 4-3 Independently, it is a hydroxyl group; R 1 and R 4 Not both H; R 3 The replacement position is the opposite position; Option 4: The compound represented by Formula I is the compound represented by Formula Ie or If; or ; Among them, R 1 It is a C1-C6 alkyl, C2-C6 alkenyl, C2-C6 ynyl, 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, or formed by one or more R groups. 1-1 Substituted C1-C6 alkyl groups, with one or more R 1-2 Substituted 2-6 heteroalkyl groups, with one or more R 1-3 Substituted C2-C6 alkenyl groups, with one or more R 1-4 Substituted C2-C6 ynyl group or with one or more R 1-5 Substituted 3-10 membered heterocyclic alkyl groups; R 1-1 Independently hydroxyl, C1-C6 alkoxy, -NR 6 R 6 , 3-10 membered cycloalkyl, 3-10 membered heterocycloalkyl, 6-10 membered aryl, 5-10 membered heteroaryl, with one or more R 1-1-1 Substituted 3-10 membered heterocyclic alkyl groups, with one or more R 1-1-2 The 6-10 aryl group is replaced or is replaced by one or more R groups. 1-1-3 Substituted 5-10 heteroaryl groups; R 1-2 Independently H, hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, -NR 6 R 6 6-10 aryl groups or those containing one or more R groups 1-1-2 Substituted 6-10 aryl groups; R 1-1-1 Independently C1-C6 alkyl or ; R 1-1-2 Independently hydroxyl, cyano, halogen, C1-C6 alkyl, C1-C6 alkoxy, NR 6 R 6 Or by one or more R 1-1-4 Substituted C1-C6 alkyl groups; R 1-1-3 Independently C1-C6 alkyl or composed of one or more R 1-1-4 Substituted C1-C6 alkyl groups; R 1-1-4 Independently hydroxyl, C1-C6 alkoxy, -NR 6 R 6 , phenyl or ; R 1-3 and R 1-4 Each is independently a C1-C6 alkyl or ; R 1a R 1b and R 1c Each is independently a C1-C6 alkyl group; R 1-5 Independently C1-C6 alkyl or ; R 7 It is independently a hydroxyl group, a C1-C6 alkyl group, a C1-C6 alkoxy group, or a 3-10 membered cycloalkyl group; R 4 For one or more R 4-1 Substituted methyl groups; R 4-1 Independently for -NR 6 R 6 3-10 membered heterocyclic alkyl groups or those containing one or more R groups 4-2 Substituted 3-10 membered heterocyclic alkyl groups; R 4-2 It is independently hydroxyl, C1-C6 alkyl, C1-C6 alkoxy, or is oxidized by one or more R 4-3 Substituted C1-C6 alkyl groups; R 4-3 Independently, it is a hydroxyl group; R 6 Each is independently H or C1-C6 alkyl; Option 5: The compound represented by Formula I is the compound represented by Formula Ig or Ih; or ; Among them, R 1 It is a C4-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl or composed of one or more R groups. 1-1 Substituted C1-C6 alkyl groups; R 1-1 Independently 6-10 aryl groups substituted with one or more halogens or substituted with one or more R 1-1-3 Substituted 5-10 heteroaryl groups; R 7 It is a 3-10 membered cycloalkyl group; R 1-1-3 Independently, it is a C1-C6 alkyl group substituted with one or more hydroxyl groups; R 4 For one or more R 4-1 Substituted methyl groups; R 4-1 Independently for -NR 6 R 6 ; R 6 Each is independently H or C1-C6 alkyl.

6. The application according to claim 1, characterized in that, It satisfies one or more of the following conditions: (1) R 1 Methyl, ethyl, n-propyl, isopropyl, n-butyl, , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , or ; (2) R 4 for , , , , , , or ; (3) R 4-1 for , , , , or ;and (4) R 3 It is a methoxy group.

7. The application according to any one of claims 1-6, characterized in that, The compound represented by Formula I is a compound represented by Formula Ia or Ib; or ; Preferably, the compound represented by Formula I is a compound represented by Formula Ic or Id; or .

8. The application according to claim 1, characterized in that, The compound represented by Formula I or a pharmaceutically acceptable salt thereof is selected from any of the following compounds: 。 9. Use of a pharmaceutical composition in the preparation of a medicament for the prevention or treatment of osteoporosis; said pharmaceutical composition comprising a compound of Formula I as described in any one of claims 1-8 or a pharmaceutically acceptable salt thereof, and at least one pharmaceutical excipient.

10. The use of a compound of Formula I as described in any one of claims 1-8 or a pharmaceutical composition as described in claim 9 in the preparation of a medicament for promoting osteogenic differentiation of bone marrow mesenchymal stem cells.

Images