A small molecule compound for treating lupus nephritis and application thereof

Abstract

The application belongs to the technical field of medicine, and discloses a small-molecule compound for treating lupus nephritis and application thereof. The application first proposes application of YX-2-107 or a pharmaceutically acceptable salt thereof in preparation of a drug for preventing and / or treating autoimmune diseases. The application screens and verifies, around pathogenic effect of a METTL3-IRF4 axis in lupus nephritis and a targeted treatment strategy thereof, that YX-2-107 or the pharmaceutically acceptable salt thereof can regulate the METTL3-IRF4 axis, play a B cell function inhibiting role, can significantly reduce a serum anti-dsDNA antibody level, improve a kidney function index, reduce kidney tissue pathological damage and formation of an immune complex, and realize treatment of autoimmune diseases (such as lupus nephritis).

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical technology, specifically relating to a small molecule compound for treating lupus nephritis and its application. Background Technology

[0002] Systemic lupus erythematosus (SLE) is a chronic autoimmune disease affecting multiple systems. Its main pathological mechanism involves the production of large amounts of antibodies against self-antigens, forming immune complexes that lead to chronic inflammation and damage in multiple organs, including the kidneys, skin, and joints. Although the exact cause of SLE is not fully understood, it is generally believed that its pathogenesis is related to the interaction of multiple mechanisms, including genetic background, epigenetic changes, environmental factors, and hormone levels. Lupus nephritis (LN) is one of the most common and serious complications of SLE, affecting approximately 25%-60% of lupus patients. LN is a key factor influencing the prognosis of SLE, typically appearing within 5 years of diagnosis, with approximately 5%-20% of patients progressing to end-stage renal disease within 10 years, severely impacting patient prognosis and quality of life. Current treatment for LN primarily relies on a combination of glucocorticoids and immunosuppressants, but challenges remain, including drug side effects, significant individual variability in response, and treatment relapse or refractory status in some patients. Furthermore, certain clinical medications, such as hydralazine and procainamide, can also induce lupus-like syndrome, further complicating disease management and treatment. Therefore, elucidating its pathogenesis at the molecular level and identifying new specific therapeutic targets are of great significance for developing safer and more effective treatment strategies.

[0003] 1. The core role and related regulatory mechanisms of pathogenic B cell activation and differentiation in lupus nephritis B lymphocytes and their terminally differentiated plasma cells play a central driving role in the disease progression of SLE and LN. Abnormal activation of autoreactive B cells can lead to differentiation into plasma cells, maintaining high levels of pathogenic autoantibodies (including anti-dsDNA and antinuclear antibodies). These antibodies form immune complexes that deposit on the glomerular basement membrane and other sites, activating the complement system and recruiting inflammatory cells, leading to glomerular endothelial cell damage and inflammatory cell infiltration (Dai X, Fan Y, Zhao X. Systemic lupus erythematosus: updated insights on the pathogenesis, diagnosis, prevention and therapeutics. Signal Transduct Target Ther. 2025;10(1):102.;Tariq F, Charavanmuttu Y, Labiba K, Wincup C. Aberrant B cell responses as drivers of autoantibody generation and epitope diversification in SLE pathogenesis. Front Immunol. 2025;16:1731285.;Liu Z, Dai H, Cui X, Liu Y, Dong Z. Importance of B cells (Review). Int J Mol Med. 2026;57(1).). Simultaneously, B cells, as antigen-presenting cells, can capture and present their own antigens, presenting them to CD4 cells in the form of a major histocompatibility complex (MHC) class II molecular complex. +T cells provide essential signals for the activation and clonal expansion of autoreactive T cells, thereby amplifying and maintaining abnormal immune responses (Nie Y, Zhao L, Zhang X. B Cell Aberrance in Lupus: the Ringleader and the Solution. ClinRev Allergy Immunol. 2022;62(2):301-323.;Shiozawa S. Pathogenesis of Autoimmunity / Systemic Lupus Erythematosus (SLE). Cells. 2025;14(14).). Recent studies have revealed that in the renal region of LN patients, a three-tiered lymphoid structure formed by the aggregation of B cells, T cells, and follicular dendritic cells is often observed. These ectopic lymphoid tissues provide a microenvironment for the clonal expansion of autoreactive B cells, antibody class switching, and affinity maturation, continuously promoting immune-inflammatory damage within the kidney (Jamaly S, Rakaee M, Abdi R, Tsokos GC, Fenton KA. Interplay of immune and kidney resident cells in the formation of tertiary lymphoid structures in lupus nephritis. Autoimmun Rev.2021;20(12):102980.Wang M, Rajkumar S, Lai Y, Liu X, He J, Ishikawa T, et al.Tertiary lymphoid structures as local perpetuators of organ-specific immuneinjury: implication for lupus nephritis. Front Immunol. 2023;14:1204777.). This indicates that abnormal activation and dysfunction of B cells and plasma cells are the common pathological basis for systemic immune dysregulation in SLE and kidney damage in LN.

[0004] The process of B cells developing, activating, and differentiating into antibody-secreting cells is regulated by a sophisticated intracellular network. The intrinsic mechanisms driving abnormal B cell activation and differentiation are complex, involving signal integration and gene expression regulation at multiple levels, including abnormal transduction of B cell receptors and co-stimulatory signals (such as CD40 / CD40L), continuous stimulation by cytokine signaling environments such as type I interferon and BAFF / APRIL, and B cell metabolic reprogramming (Dai X, Fan Y, Zhao X. Systemic lupus erythematosus: updated insights on the pathogenesis, diagnosis, prevention and therapeutics. Signal Transduct Target Ther. 2025;10(1):102.;Hoi A, IgelT, Mok CC, Arnaud L. Systemic lupus erythematosus. Lancet. 2024;403(10441):2326-2338.). Epigenetic regulation has been proven in recent years to be an important mechanism involved in the fate and functional state of B cells. Without altering the DNA sequence, it affects the identity and functional plasticity of immune cells by regulating chromatin structure accessibility and gene expression (Wu H, Deng Y, Feng Y, Long D, Ma K, Wang X, et al. Epigenetic regulation in B-cell maturation and its dysregulation in autoimmunity. Cell Mol Immunol. 2018;15(7):676-684.;Chen J, Wang X. Epigenetic regulation of B cell response in autoimmune diseases. Curr OpinImmunol. 2025;95:102582.).In B cells of SLE patients, there is a remodeling of various epigenetic patterns, including RNA methylation, DNA methylation, histone modification, and non-coding RNA. This is closely related to abnormal phenotypes such as disease activity and excessive production of inflammatory factors (Shiozawa S. Pathogenesis of Autoimmunity / Systemic Lupus Erythematosus (SLE). Cells. 2025;14(14).; Bacalao MA, Satterthwaite AB. Recent Advances in Lupus B Cell Biology: PI3K, IFNgamma, and Chromatin. FrontImmunol. 2020;11:615673.). Therefore, in-depth analysis of the epigenetic mechanisms regulating abnormal B cell function and intervention at important disease-related modification targets are expected to provide a theoretical basis for developing more precise new treatment strategies.

[0005] 2 m 6 A-methylation-mediated epigenetic regulation of B cells and its role in autoimmune pathogenesis Abnormal activation of B cells and plasma cells is a core component of LN pathogenesis, a process precisely regulated by a multi-layered network. Epigenetic mechanisms, as key hubs connecting extracellular signals and intracellular gene expression programs, play a crucial role in determining immune cell fate and functional plasticity (Chen J, Wang X. Epigenetic regulation of B cell response in autoimmune diseases. Curr Opin Immunol. 2025;95:102582.; Cao K, Du X, Tu M, Wei Y, Wan L, Ju J. Epigenetic mechanisms of B cells: Recent advances in targeted therapies for SLE. Lupus. 2025;34(9):879-887.). N6-methyladenosine (m 6m6A is one of the most common methylation modifications on eukaryotic mRNA, and its dynamic and reversible modification process constitutes an important aspect of posttranscriptional gene regulation (Zhao BS, Roundtree IA, He C. Post-transcriptional gene regulation by mRNAmodifications. Nat Rev Mol Cell Biol. 2017;18(1):31-42.). Recent studies have confirmed that m6A is involved in the fate determination and functional regulation of immune cells, providing a new perspective for understanding the abnormal activation of B cells in autoimmune diseases (Wang S, Li H, Lian Z, Deng S. The Role of m(6)A Modifications in B-Cell Development and B-Cell-Related Diseases. Int J Mol Sci. 2023;24(5).).

[0006] During the development and differentiation of B lymphocytes, m 6 A-modification plays a crucial regulatory role. Studies have shown that conditional knockout of the methyltransferase METTL14 in B cells leads to m 6 Decreased A modification levels impair the proliferation of bone marrow pro-B cells and the conversion of large pre-B cells to small pre-B cells, resulting in severe arrest of B cell development (Zheng Z, Zhang L, Cui XL, Yu X, Hsu PJ, Lyu R, et al. Control of Early B Cell Development by the RNA N(6)-Methyladenosine Methylation. Cell Rep. 2020;31(13):107819.). 6 A can regulate pro-B cell proliferation by affecting the mRNA stability of Cyclin D3, a downstream cell cycle-related gene in the interleukin-7 (IL-7) signaling pathway, through the reading protein YTHDF2; in addition, m 6The absence of A also leads to the dysregulation of expression of key components and corresponding transcription factors in the pre-B cell receptor (pre-BCR) signaling pathway, thereby hindering the differentiation of pre-B cells. Germinal centers are important structures formed by B cells after antigen stimulation. B cells undergo clonal expansion, high-frequency mutation of antibody genes, and affinity selection in these centers, eventually differentiating into memory B cells or long-lived plasma cells (Shehata L, Thouvenel CD, Hondowicz BD, Pew LA, Pritchard GH, Rawlings DJ, et al. Interleukin-4 downregulates transcription factor BCL6 to promote memory B cell selection in germinal centers. Immunity. 2024;57(4):843-858 e845.;Weniger MA, Seifert M, Kuppers R. B Cell Differentiation and the Origin and Pathogenesis of Human B Cell Lymphomas. Methods Mol Biol. 2025;2865:1-30.). These studies confirm that m6A modification is a key regulatory mechanism for normal B cell development and differentiation, adaptive response, and antibody diversity generation.

[0007] However, in autoimmune diseases, m 6Disruptions in the homeostasis of M(6)A modification can contribute to B cell dysfunction, leading to excessive activation, abnormal proliferation, and the production of pathogenic antibodies in B cells (Xu L, Shen T, Li Y, Wu X. The Role of M(6)A Modification in Autoimmunity: Emerging Mechanisms and TherapeuticImplications. Clin Rev Allergy Immunol. 2025;68(1):29.). Studies have found that the transcriptional levels of various m6A modification-related proteins are dysregulated in peripheral blood mononuclear cells (PBMCs) of SLE patients, and these dysregulations are associated with clinical features such as double-stranded deoxyribonucleic acid (dsDNA), skin rashes, and ulcers (Luo Q, Fu B, Zhang L, Guo Y, Huang Z, Li J. Decreased Peripheral Blood ALKBH5 Correlates with Markers of Autoimmune Response in Systemic Lupus Erythematosus. Dis Markers. 2020;2020:8193895.). Abnormal m6A modification levels are associated with these clinical features. 6A-modification can target gene transcripts related to B cell overactivation and autoantibody production, thereby participating in the pathogenesis of autoimmune diseases. Wang et al. reported that the progressive tailing and m6A modification of IgG1 heavy chain transcripts (Ighg1) mRNA are crucial for maintaining IgG1 antibody homeostasis in antibody-secreting cells (ASCs); the m6A reading protein YTHDF1 can specifically recognize and stabilize Ighg1 mRNA, thereby maintaining the continuous and efficient production of antibodies. This study also confirmed the existence of a specific subset of YTHDF1 highly expressed in ASCs of SLE patients, and that this subset was significantly reduced after receiving immunosuppressive therapy. In a lupus mouse model, blocking the interaction between YTHDF1 and m6A effectively alleviated disease symptoms and reduced the production of autoantibodies (Wang Y, Zhang S, Kang N, Dong L, Ni H, Liu S, et al. Progressive polyadenylation and m6A modification of Ighg1 mRNA maintain IgG1 antibody homeostasis in antibody-secreting cells. Immunity. 2024;57(11):2547-2564.e2512.). Yang et al.'s study found that the expression of METTL3 and the overall m6A modification level in B cells of SLE patients were significantly increased and positively correlated with disease activity. METTL3 binds to and stabilizes paired box gene 5 (PAX5) mRNA through m6A modification, thereby upregulating PAX5 protein expression. PAX5, as a core transcription factor for B cells, can directly bind to the METTL3 promoter region and drive its transcription. This mutually reinforcing regulatory loop works together to maintain the homeostasis and function of B cells during activation, enhance their reactivity, and ultimately promote the proliferation and sustained activation of self-reactive B cells (Yang Y, Zhang Y, Xie S, Liu K, Liu M, Li Y, et al. Reciprocal METTL3-PAX5 regulationin maintaining B-cell identity and promoting B-cell hyperreactivity in SLE.Mol Med. 2025;31(1):236.).In other autoimmune diseases such as primary Sjogren's syndrome, METTL3 enhances RRM2 mRNA stability and upregulates its expression, thereby promoting B cell activation, differentiation into ASCs, and autoantibody production by regulating cell cycle-related pathways (Yang Y, Liu K, Zhang H, Li Y, Guo M. M6A modification of RRM2 drives B cell hyperactivity in primary Sjogren's syndrome. Life Sci. 2025;379:123884.). This evidence collectively suggests that m... 6 Dysregulation of A-cell modification is a key post-transcriptional regulatory mechanism mediating B-cell dysfunction in various autoimmune diseases.

[0008] To explore m in depth 6 The mechanism of action of A modification in SLE kidney injury: The inventors previously performed RNA methylation immunoprecipitation sequencing (MeRIP-seq) on PBMCs of SLE patients and found that m 6 The A-modification spectrum was significantly altered, with interferon regulatory factor 4 (IRF4) at m 6A key immunomodulatory gene that is simultaneously upregulated in terms of modification and expression. Analysis of clinical data revealed a positive correlation between IRF4 levels and the proportion of peripheral B cells in SLE patients, with SLE patients exhibiting high IRF4 expression being more prone to kidney damage. In MRL / lpr mice, IRF4 expression was increased in various B cell subsets in the spleen, with the most significant increase observed in plasma cells. Overexpression of METTL3 promoted IRF4 expression, mediating plasma cell infiltration, immune complex deposition, and kidney damage; conversely, interference with IRF4 expression alleviated the aforementioned pathological changes caused by METTL3 overexpression. This work reveals the pathogenic pathway of abnormal plasma cell infiltration and lupus kidney immune injury mediated by the METTL3-IRF4 axis. Targeting this pathway is expected to be a new treatment strategy for SLE (Liu Y, Wang X, Huang M, Luo A, Liu S, Cai M, et al. METTL3 facilitates skidney injury through promoting IRF4-mediated plasma cell infiltration via anm6A-dependent manner in systemic lupus erythematosus. BMC Med. 2024;22(1):511.).

[0009] In summary, m 6 RNA methylation, as a key epigenetic transcriptional regulatory mechanism, regulates the development, differentiation, and functional maintenance of B cells under physiological conditions. 6 Abnormal expression of A-related enzymes and reading proteins can lead to m-related expression of downstream target genes. 6 Altered A-modification profiles lead to B-cell overactivation and pathogenic differentiation, thereby participating in the pathological processes of various autoimmune diseases such as SLE. Our previous work revealed the molecular mechanism by which the METTL3-IRF4 axis mediates target organ damage in the kidneys of lupus erythematosus by regulating plasma cell infiltration, providing new experimental evidence for understanding the relationship between B-cell hyperactivity and renal immunopathological damage in autoimmune diseases. Therefore, targeting METTL3 and its mediated m 6 A-dependent pathogenic pathways hold promise for providing a novel, transformative strategy for the intervention of SLE and LN by regulating B cell function and their terminal differentiation process.

[0010] 3. The role of IRF4 in immune homeostasis and systemic lupus erythematosus IRF4, an important member of the interferon regulatory factor family, plays a central role in the development and maintenance of the immune system. Its protein structure includes a conserved N-terminal DNA-binding domain that recognizes tryptophan-rich consensual sequences. Under physiological conditions, IRF4 expression exhibits high cell specificity, primarily expressed in lymphocytes and bone marrow-derived cells, particularly in T cells, B cells, plasmacytoid dendritic cells, classical dendritic cells, and macrophages. IRF4 can bind to various molecular chaperones such as PU.1, SPI-B, or BATF to form heterodimers, precisely regulating downstream gene expression and thereby guiding immune cell differentiation, metabolic remodeling, and effector functions.

[0011] B cell development and functional maturation exhibit a concentration-dependent relationship with IRF4. In the early stages of the immune response, even low levels of IRF4 can drive germinal center B cell formation, promoting antibody affinity maturation by regulating activation and inducing AID expression, mediating antibody class switching and recombination, and somatic high-frequency mutations (Sciammas R, Shaffer AL, Schatz JH, Zhao H, Staudt LM, Singh H. Graded expression of interferon regulatory factor-4 coordinates isotype switching with plasma cell differentiation. Immunity. 2006;25(2):225-236.;Willis SN, Nutt SL. New players in the gene regulatory network controlling late B cell differentiation. Curr OpinImmunol. 2019;58:68-74.). During this stage, IRF4 primarily forms heterodimers with transcription factors PU.1 or BATF, activating germinal center B cell-related gene programs. As the immune response progresses, the continuous stimulation of BCR and CD40 signaling, along with the synergistic effects of cytokines such as IL-21, leads to a significant increase in IRF4 expression levels. High levels of IRF4 can inhibit transcription factors such as Bcl6 and Pax5, which maintain B cell identity, while directly activating the expression of the Prdm1 gene (encoding the Blimp-1 protein) and Xbp1, thereby inducing terminal differentiation of B cells into plasma cells. This regulatory mechanism ensures that germinal center B cells first complete clonal expansion and antibody affinity selection, followed by directed differentiation into antibody-secreting cells, thus maintaining the homeostatic balance of the immune response while achieving an orderly transition between antibody affinity maturation and plasma cell generation.

[0012] In systemic lupus erythematosus (SLE), abnormal B cell differentiation, persistent production of pathogenic autoantibodies, and deposition of immune complexes are crucial factors leading to tissue damage. IRF4, a core transcription factor regulating B cell germinal center responses and plasma cell differentiation, can cause immune homeostasis imbalance through abnormal expression and function, thus participating in the pathogenesis of SLE or lupus nucleus (LN) (Xiao ZX, Liang R, Olsen N, Zheng SG. Roles of IRF4 in various immune cells in systemiclupus erythematosus. Int Immunopharmacol. 2024;133:112077.). Lech et al. found that IRF4-deficient lupus mice had lower serum IgG levels, lacked antinuclear antibodies and anti-dsDNA autoantibodies, and had proteinuria; glomerular deposition of immune complexes and complement activation were almost absent. Further analysis showed that IRF4 deficiency inhibits B cell terminal differentiation into plasma cells, significantly reducing the number of plasma cells and thus blocking the production of pathogenic autoantibodies. This study indicates that IRF4 participates in the progression of lupus nephritis by regulating plasma cell differentiation (Lech M, Weidenbusch M, Kulkarni OP, Ryu M, Darisipudi MN, Susanti HE, et al. IRF4 deficiency aborts lupus nephritis despite enhancing systemic cytokine production. JAm Soc Nephrol. 2011;22(8):1443-1452.). He et al. also found that IRF4 expression in kidney and peripheral blood T and B cells was significantly increased in SLE patients and MRL / lpr lupus mouse models. Furthermore, the level of IRF4 expression in the kidneys of lupus mice was positively correlated with disease indicators such as proteinuria, anti-dsDNA antibody levels, and plasma cell ratio. The use of IRF4 inhibitors or knockdown of IRF4 expression by adeno-associated virus significantly improved proteinuria, kidney pathological damage, and autoantibody production in MRL / lpr mice, with efficacy comparable to glucocorticoids and artemisinin derivative SM934 treatment.In vitro experiments further confirmed that IRF4 can regulate the differentiation of B cells into plasma cells and the production of pathogenic antibodies (He S, Ding H, Chen L, Shen Y, Liu Y, Zhu F, et al. Repression of interferon regulatory factor-4 (IRF4) hyperactivation restricts murine lupus. Signal Transduct Target Ther. 2023;8(1):188.). These studies suggest that IRF4 may be a core driver of pathogenic activation in B cells, but the specific molecular mechanisms by which it upregulates expression in SLE still need further elucidation.

[0013] Previous research in this invention focused on the mechanism of action and upstream regulation of IRF4 in SLE kidney injury (Zhao GN, Jiang DS, Li H. Interferon regulatory factors: at the crossroads of immunity, metabolism, and disease. Biochim Biophys Acta. 2015;1852(2):365-378.). We first verified the abnormally high expression of IRF4 in clinical samples and found that its expression level was significantly positively correlated with the proportion of B lymphocytes in the peripheral blood of patients, suggesting that IRF4 is closely related to the abnormal activation of B cells in SLE. In order to further analyze its role in specific cell subsets, we performed a subset analysis of spleen B lymphocytes from MRL / lpr lupus mice. Flow cytometry results showed that, compared with control mice, the mean fluorescence intensity of IRF4 in various B cell subsets in the spleen of MRL / lpr mice was significantly increased, with the most significant increase in plasma cells. At the same time, we also confirmed that IRF4 was significantly increased in renal plasma cells of lupus mice. Interfering with IRF4 expression in MRL / lpr mice effectively reduced the infiltration of renal plasma cells, accompanied by a decrease in urinary protein and serum creatinine, a decline in serum autoantibody levels, and improvement in renal pathological damage. To further explore the mechanism of IRF4 upregulation in SLE, we combined MeRIP-seq sequencing data to find that the m6A modification level of IRF4 mRNA in PBMCs of SLE patients was significantly increased. We further discovered that overexpression of METTL3 induced IRF4 upregulation, accompanied by more pronounced plasma cell renal infiltration, immune complex deposition, and renal pathological damage. Furthermore, interfering with IRF4 expression mitigated the disease-exacerbating effect of METTL3 overexpression. Our previous research elucidated that the METTL3-IRF4 axis drives LN renal damage by promoting plasma cell infiltration. This study reveals the epigenetic mechanism regulating abnormal IRF4 expression during the pathogenesis of lupus nephritis and suggests that small molecule drug intervention targeting the METTL3-IRF4 signaling axis may regulate IRF4 expression at the epigenetic level, potentially providing a new strategy for the treatment of LN.

[0014] 4. Current Status and Future Strategies of Small Molecule Inhibitors Targeting METTL3 Research on small molecule inhibitors targeting METTL3 is at the forefront of epitranscriptomics therapy. Preliminary validation of METTL3 inhibitors in cancer treatment confirms their feasibility as drug targets and provides a foundation for extending their application to the treatment of autoimmune diseases. METTL3 is m 6The core catalytic subunit of the A-methyltransferase complex provides an important basis for the development of small molecule inhibitors. METTL3 typically forms a stable heterodimeric complex with METTL14, which is considered to be responsible for the catalytic activity of METTL3. 6 The smallest core unit for A-methylation function. METTL3 is responsible for binding the co-substrate S-adenosylmethionine (SAM), while METTL14 lacks an active pocket and therefore has no catalytic ability. However, it serves as a structural scaffold in the binding of substrate RNA, playing a crucial role in maintaining complex stability and catalytic activity. The core region where METTL3 exerts its catalytic activity is located in its C-terminal methyltransferase domain, specifically residues 358-580. The SAM binding pocket formed within this domain is a key site for catalyzing methyltransfer reactions and is also an important target for current small molecule inhibitor design. Around this catalytic cavity, several key loop structures involved in enzyme activity regulation are distributed. Two gate loops adjacent to the SAM binding site primarily participate in the recognition of the substrate adenosine, while the interface loop mainly mediates the interaction between METTL3 and METTL14, playing a vital role in maintaining heterodimer conformational stability and overall catalytic activity.

[0015] In recent years, research on small molecule inhibitors targeting METTL3 has made some progress. Reported intervention strategies mainly include competitive inhibitors of the SAM binding pocket, allosteric modulators, natural product-derived inhibitors, and PROTAC degraders. Among these, the most representative is the highly selective METTL3 inhibitor STM2457, which has shown good anti-tumor activity in an acute myeloid leukemia model. Its derivative, STC-15, has entered clinical trials, and its safety and tolerability have been preliminarily verified in patients with advanced solid tumors. In addition, various natural products such as quercetin, berberine, and flavonoids have also been reported to have METTL3 inhibitory activity, and some allosteric modulators can exert regulatory effects by binding to the non-catalytic sites of the METTL3-METTL14 complex. However, currently reported METTL3 inhibitors are mainly focused on cancer treatment; their application in autoimmune diseases has not been fully explored, and there is still considerable room for optimization in the activity, selectivity, and in vivo efficacy of existing inhibitors. Therefore, developing novel METTL3 inhibitors and expanding their therapeutic applications in B-cell-mediated autoimmune diseases has significant scientific and clinical translational value.

[0016] 5. Deficiencies and Challenges in Solving Existing Technologies Research on small molecule inhibitors targeting METTL3 is at the forefront of epitranscriptomics therapy. Preliminary validation of METTL3 inhibitors in cancer treatment confirms their feasibility as drug targets and lays the foundation for extending their application to the treatment of autoimmune diseases. Despite significant progress in METTL3 inhibitor research, existing strategies still have certain limitations. Most reported small molecule inhibitors primarily act on the SAM binding pocket, meaning their mechanism dictates that these compounds mainly exert their effects by broadly inhibiting METTL3 catalytic activity, making it difficult to distinguish the m-type of different downstream target genes. 6A. Modification. Since METTL3 is widely involved in various biological processes such as hematopoietic regulation, cell cycle regulation, and immune homeostasis maintenance, systematic inhibition of its catalytic activity may interfere with normal physiological functions and bring potential safety risks. Previous studies have shown that although STM2457 has shown good therapeutic effects and acceptable safety in tumor models, inhibition of METTL3 catalytic activity may still affect the normal hematopoietic differentiation process. The study by Soriano et al. found that STM2457 treatment of mice can lead to a decrease in erythroid progenitor cells and an increase in neutrophil progenitor cells, accompanied by a decrease in erythrocyte and hemoglobin levels, suggesting that persistent inhibition of METTL3 catalytic activity may interfere with the normal differentiation of specific lineages (Sturgess K, Yankova E, Vijayabaskar MS, Isobe T, Rak J, Kucinski I, et al. Pharmacological inhibition of METTL3 impacts specific haematopoietic lineages. Leukemia. 2023;37(10):2133-2137.). Furthermore, METTL3 also plays multiple roles in the immune system, serving as a crucial component in the development and functional maintenance of hematopoietic stem cells, innate immune cells, and adaptive immune cells (Zhang D, Xu T, Gao X, Qu Y, Su X. Methyltransferase-like 3-mediated RNA N(6)-methyladenosine contributes to immune dysregulation: diagnostic biomarker and therapeutic target. FrontImmunol. 2025;16:1523503.). Systemic inhibition of METTL3 activity may interfere with the normal development and function of various immune cells, increasing the risk of infection or immune homeostasis imbalance. Therefore, for immune-related diseases such as SLE, minimizing the impact on the broad physiological functions of METTL3 while inhibiting pathogenic pathways is a pressing issue in current METTL3-targeted therapy research. Summary of the Invention

[0017] Building upon existing technologies and previous work, this invention aims to screen small molecule inhibitors that can specifically block the binding of METTL3 to IRF4 mRNA, specifically by designing inhibitors targeting the binding region of METTL3 and IRF4 mRNA. Unlike existing competitive inhibitors of SAM, the intervention strategy proposed in this invention achieves precise regulation of downstream pathogenic pathways by interfering with the binding of METTL3 to the specific target gene IRF4, rather than by comprehensively inhibiting the methyltransferase activity of METTL3. This strategy is expected to more precisely regulate IRF4-mediated pathogenic B cell differentiation and autoantibody secretion, thereby alleviating renal immune damage and potentially reducing the impact on other physiological functions of METTL3. Given the important role of IRF4 in B cell function regulation and the pathogenic significance of the METTL3-IRF4 axis in lupus models, this invention is expected to provide new candidate molecules and theoretical basis for the precision treatment of SLE and LN.

[0018] The first aspect of the present invention aims to provide the use of YX-2-107 or a pharmaceutically acceptable salt thereof in the preparation of medicaments for the prevention and / or treatment of autoimmune diseases.

[0019] A second aspect of the present invention is to provide the use of YX-2-107 or a pharmaceutically acceptable salt thereof in the preparation of products.

[0020] To achieve the above objectives, the technical solution adopted by the present invention is as follows: A first aspect of the invention provides the use of YX-2-107 or a pharmaceutically acceptable salt thereof in the preparation of medicaments for the prevention and / or treatment of autoimmune diseases.

[0021] In some embodiments of the present invention, the autoimmune disease includes systemic lupus erythematosus.

[0022] In some embodiments of the present invention, the autoimmune disease includes lupus nephritis.

[0023] In some embodiments of the present invention, the YX-2-107 or a pharmaceutically acceptable salt thereof achieves prevention and / or treatment of autoimmune diseases by inhibiting the binding of METTL3 and IRF4.

[0024] In some embodiments of the present invention, YX-2-107 or a pharmaceutically acceptable salt thereof downregulates IRF4 mRNA. 6 A modification levels, as well as IRF4 transcription and protein levels, enable the prevention and / or treatment of autoimmune diseases.

[0025] In some embodiments of the present invention, YX-2-107 or a pharmaceutically acceptable salt thereof achieves prevention and / or treatment of autoimmune diseases by inhibiting abnormal B cell activation, terminal differentiation of plasma cells, and secretion of pathogenic autoantibodies.

[0026] In some embodiments of the present invention, the treatment of autoimmune diseases includes reducing the patient's serum anti-dsDNA antibody levels, improving renal function indicators, and alleviating renal pathological damage and immune complex deposition.

[0027] In some embodiments of the present invention, the treatment of autoimmune diseases includes inhibiting plasma cell differentiation and renal infiltration, thereby improving the disease progression of autoimmune diseases.

[0028] In some embodiments of the present invention, the pharmaceutically acceptable salt includes at least one of a metal salt, an ammonium salt, a salt formed with an inorganic acid, a salt formed with an organic base, a salt formed with an organic acid, a salt formed with a basic amino acid, or a salt formed with an acidic amino acid.

[0029] In some embodiments of the present invention, the metal salt includes at least one of alkali metal salts, alkaline earth metal salts, aluminum salts, and zinc salts.

[0030] In some embodiments of the present invention, the alkali metal salt includes at least one of potassium salt, sodium salt, and lithium salt.

[0031] In some embodiments of the present invention, the alkaline earth metal salt includes calcium salt and / or magnesium salt.

[0032] In some embodiments of the present invention, the salt formed with the inorganic acid includes salts formed with at least one of the following inorganic acids: hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, or phosphoric acid.

[0033] In some embodiments of the present invention, the salt formed with the organic acid includes at least one of the following organic acids: formic acid, acetic acid, lactic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, or p-toluenesulfonic acid.

[0034] In some embodiments of the present invention, the salt formed with the acidic amino acid includes a salt formed with at least one of the following acidic amino acids: aspartic acid or glutamic acid.

[0035] In some embodiments of the present invention, the salt formed with an organic base includes at least one of the following organic bases: triethylamine, ethanolamine, meglumine, or dicyclohexylamine.

[0036] In some embodiments of the present invention, the salt formed with the basic amino acid includes a salt formed with at least one of the following basic amino acids: lysine, arginine, or histidine.

[0037] In some embodiments of the present invention, the medicament further includes pharmaceutically acceptable excipients.

[0038] In some embodiments of the present invention, the pharmaceutically acceptable excipients include at least one of fillers, binders, disintegrants, lubricants, flavoring agents, colorants, flavor masking agents, pH adjusters, buffers, preservatives, stabilizers, antioxidants, wetting agents, humidity regulators, surfactants, suspending agents, and absorption enhancers.

[0039] In some embodiments of the present invention, for ease of administration, YX-2-107 or a pharmaceutically acceptable salt thereof may be processed with one or more pharmaceutically acceptable excipients into a specific dosage form. These excipients may be diluents (e.g., starch, pregelatinized starch, dextrin, sucrose, lactose, mannitol, and microcrystalline cellulose), absorbents (e.g., calcium sulfate, dicalcium phosphate, light magnesium oxide, and calcium carbonate), wetting agents (e.g., water and ethanol), binders (e.g., hydroxypropyl methylcellulose, povidone, starch paste, and syrup), disintegrants (e.g., dry starch, sodium hydroxymethyl starch, low-substituted hydroxypropyl cellulose, effervescent disintegrants, and crospovidone), and lubricants (magnesium stearate, talc, hydrogenated vegetable oil, polyethylene glycol, and micronized powders). The following are examples of agents: silica gel, colorants (such as titanium dioxide, sunset yellow, methylene blue, and pharmaceutical iron oxide), coating materials (such as acrylic resin, hydroxypropyl methylcellulose, and povidone), solvents (such as water for injection, ethanol, propylene glycol, and glycerin), acid-base regulators (such as hydrochloric acid, lactic acid, sodium hydroxide, tartaric acid, and sodium tartrate), antioxidants (such as sodium sulfite, sodium metabisulfite, and sodium thiosulfate), antibacterial agents (such as phenol, benzyl alcohol, and thimerosal), and isotonic regulators (such as sodium chloride and glucose).

[0040] In some embodiments of the present invention, the drug is administered to an animal; more preferably, the animal is a mammal; even more preferably, the animal is selected from humans, cats, cattle, sheep, pigs, dogs, chickens, ducks, geese, rabbits, and mice; and even more preferably, the animal is a human, including minors, adults, and the elderly.

[0041] In some embodiments of the present invention, the dosage form of the drug includes a gastrointestinal dosage form or a non-gastrointestinal dosage form.

[0042] In some embodiments of the present invention, the gastrointestinal dosage form includes at least one of powder, tablet, granule, capsule, sustained-release, solution, dry suspension, effervescent tablet, emulsion, suspension, syrup, drops, and chewable tablet.

[0043] In some embodiments of the present invention, the gastrointestinal dosage forms include, but are not limited to, enteric-coated tablets, coated tablets, film-coated tablets, sugar-coated tablets, dispersible tablets, sucking tablets, chewable tablets, effervescent tablets, scratch tablets, sustained-release and controlled-release dosage forms, sustained-release tablets, sustained-release coated tablets, controlled-release tablets, orally disintegrating tablets, lozenges, and oral patches.

[0044] In some embodiments of the present invention, the non-gastrointestinal drug delivery dosage form includes at least one of injection dosage form, respiratory dosage form, skin dosage form, mucosal dosage form, and cavity dosage form.

[0045] In some embodiments of the present invention, the injectable dosage forms include, but are not limited to, injection solutions, solutions for injection, injection solutions for intravenous infusion, suspensions for injection, sterile powders for injection, intravenous injections, water injections, emulsions for injection, powder injections, injections, sterile powder injections, lyophilized powder injections, etc.

[0046] In some embodiments of the invention, the effective dose of YX-2-107 or a pharmaceutically acceptable salt thereof is 1-40 mg / kg of subject, such as any value of 1, 5, 10, 15, 20, 25, 30, 35 or 40 mg / kg or a range between any two.

[0047] A second aspect of the invention provides the use of YX-2-107 or a pharmaceutically acceptable salt thereof in the preparation of a product having at least one of the following functions: (1) Targeted binding to METTL3; (2) Inhibit IRF4 expression; (3) Inhibits B cell activation; (4) Inhibit plasmablast differentiation and antibody secretion.

[0048] In some embodiments of the present invention, the pharmaceutically acceptable salt includes at least one of a metal salt, an ammonium salt, a salt formed with an inorganic acid, a salt formed with an organic base, a salt formed with an organic acid, a salt formed with a basic amino acid, or a salt formed with an acidic amino acid.

[0049] In some embodiments of the present invention, the metal salt includes at least one of alkali metal salts, alkaline earth metal salts, aluminum salts, and zinc salts.

[0050] In some embodiments of the present invention, the alkali metal salt includes at least one of potassium salt, sodium salt, and lithium salt.

[0051] In some embodiments of the present invention, the alkaline earth metal salt includes calcium salt and / or magnesium salt.

[0052] In some embodiments of the present invention, the salt formed with the inorganic acid includes salts formed with at least one of the following inorganic acids: hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, or phosphoric acid.

[0053] In some embodiments of the present invention, the salt formed with the organic acid includes at least one of the following organic acids: formic acid, acetic acid, lactic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, or p-toluenesulfonic acid.

[0054] In some embodiments of the present invention, the salt formed with the acidic amino acid includes a salt formed with at least one of the following acidic amino acids: aspartic acid or glutamic acid.

[0055] In some embodiments of the present invention, the salt formed with an organic base includes at least one of the following organic bases: triethylamine, ethanolamine, meglumine, or dicyclohexylamine.

[0056] In some embodiments of the present invention, the salt formed with the basic amino acid includes a salt formed with at least one of the following basic amino acids: lysine, arginine, or histidine.

[0057] In some embodiments of the present invention, the product further includes pharmaceutically acceptable excipients.

[0058] In some embodiments of the present invention, the product includes reagents, reagent kits, and drugs.

[0059] In some embodiments of the present invention, the effective concentration of YX-2-107 or a pharmaceutically acceptable salt thereof is 5-20 μM; further, it is 5-15 μM, such as any value or range formed by any combination of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 μM.

[0060] The beneficial effects of this invention are: This invention is the first to propose the application of YX-2-107 or a pharmaceutically acceptable salt thereof in the preparation of drugs for the prevention and / or treatment of autoimmune diseases. This invention focuses on the pathogenic role of the METTL3-IRF4 axis in lupus nephritis and its targeted therapeutic strategies. Screening and validation have shown that YX-2-107 or a pharmaceutically acceptable salt thereof can regulate the METTL3-IRF4 axis, exerting a B-cell function inhibitory effect (such as effectively inhibiting B-cell activation, the expression of early activation markers CD69 and co-stimulatory molecule CD86, plasmablast differentiation, and total IgG secretion, while downregulating IRF4 expression). It can significantly reduce serum anti-dsDNA antibody levels, improve renal function indicators, alleviate renal tissue pathological damage, and reduce the formation of immune complexes, thus achieving the treatment of autoimmune diseases (such as lupus nephritis). Attached Figure Description

[0061] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 The structural predictions for the binding mode of METTL3 and IRF4 mRNA target regions are as follows: (A) is the optimal predicted complex model of RNA1 fragment and METTL3 protein; (B) is the optimal predicted complex model of RNA2 fragment and METTL3 protein; (C) is a detailed diagram of the METTL3 and IRF4 mRNA binding interface, with the blue area representing the amino acid residues that constitute the binding pocket. This interface was identified as the target region for subsequent virtual screening; (D) is a detailed diagram of the METTL3 and SAM binding interface, with the blue area representing the amino acid residues of the SAM binding pocket.

[0062] Figure 2 This paper presents a virtual screening process and preliminary analysis for small molecules targeting the METTL3-IRF4 mRNA interface. (A) shows the overall technical roadmap for virtual screening; (B) shows the validation analysis of the preliminary docking results. A scatter plot illustrates the distribution of docking scores (Glide SP score) and molecular weights for 1516 docking conformations; (C) is a protein-ligand interaction fingerprint analysis. A heatmap shows the frequency of interactions between each amino acid residue in the METTL3 protein binding pocket and the small molecule in the screening results; darker colors indicate that the residue interacts in more high-molecular-weight complexes.

[0063] Figure 3 To verify the inhibitory effect of candidate small molecules on IRF4 protein expression, Ramos cells were treated with the aforementioned 13 candidate small molecules that can downregulate IRF4 mRNA, and the expression level of IRF4 protein in each group of cells was detected by Western blotting.

[0064] Figure 4To determine the affinity of candidate small molecules for binding with METTL3 protein, purified GFP-METTL3 fusion protein was mixed with small molecules of different concentration gradients, and the fluorescence changes caused by binding were measured by MST. The binding curve fitting shown in the figure illustrates the determination results of the equilibrium dissociation constant (Kd) of small molecule YX-2-107 (molecule number 42) binding with METTL3 protein.

[0065] Figure 5 Molecular docking analysis of the binding mode of YX-2-107 and METTL3 protein. The diagram shows the binding mode of YX-2-107 and METTL3 protein (number 42). The blue area shows the binding interface between METTL3 and IRF4 mRNA.

[0066] Figure 6 To investigate the inhibition of METTL3 and IRF4 mRNA binding by YX-2-107, RIP-qPCR experiments were performed on Ramos cells after treatment with YX-2-107. In the figures, (A) shows Western blotting to verify the efficiency of RNA immunoprecipitation; (B) shows agarose gel electrophoresis image displaying the RIP products; and (C) shows the quantitative comparison of the relative enrichment levels of IRF4 mRNA in the immunoprecipitate products of each group using RIP-qPCR. P <0.05.

[0067] Figure 7 To investigate the effect of YX-2-107 on B cell viability and to screen drug concentrations, mouse spleen cells were treated with different concentrations (0, 1, 5, 10, 20, and 40 μM) of YX-2-107. Cell viability in the YX-2-107-treated groups was detected by CCK-8 assay; ns: not significant.

[0068] Figure 8 To investigate the downregulation of IRF4 expression in activated B cells by YX-2-107, B cells were treated with YX-2-107 (10 μM) or DMSO in the presence of activating stimuli (anti-IgMFab, anti-CD40, IL-21, R848). Flow cytometry was used to detect the MFI and IRF4 levels of the transcription factor IRF4 within the cells. + Cell proportions. (See figure.) P <0.001.

[0069] Figure 9To investigate the inhibitory effect of YX-2-107 on the expression of B cell activation markers CD69 and CD86, B cells were treated with YX-2-107 (10 μM) or DMSO in the presence of activation stimulating factors. (A) shows the mean fluorescence intensity (MFI) of the early activation marker CD69 and CD86 as detected by flow cytometry. + Cell proportion; (B) Flow cytometry detection of MFI and CD86 co-stimulatory molecule CD86 + Cell proportions. (See figure.) P <0.001.

[0070] Figure 10 To investigate the inhibitory effect of YX-2-107 on antibody secretion, B cells were treated with YX-2-107 (10 μM) or DMSO in the presence of activating stimulating factors (anti-IgM Fab, anti-CD40, IL-21, R848), and the cell culture supernatant was collected. The concentration of total IgG in the supernatant was quantitatively detected by ELISA. P <0.05.

[0071] Figure 11 This study outlines the treatment protocol and safety assessment of YX-2-107 in the MRL / lpr lupus model. (A) is a flowchart of the animal experiment; (B) shows the weight change curves of mice in the control and treatment groups, with weekly monitoring and recording of mouse weight.

[0072] Figure 12 YX-2-107 can improve autoantibodies and renal function in MRL / lpr mice; (A) shows the serum anti-dsDNA IgG antibody level detected by ELISA; (B)-(D) show the serum creatinine (B), urinary albumin (C), and urinary albumin / creatinine ratio (D) levels detected by biochemical analysis, respectively. In the figure, P <0.05, P <0.01.

[0073] Figure 13 YX-2-107 improves kidney tissue pathological damage in MRL / lpr mice. The results include HE, PAS and MASSON staining to show the pathological sections of mouse kidney tissue; scale bar is 50 μm.

[0074] Figure 14 YX-2-107 reduces CD138 in the kidneys of MRL / lpr mice+ IRF4 + Plasma cells. Immunofluorescence staining was used to detect the co-expression of plasma cell markers CD138 and IRF4; scale bar: 50 μm. Detailed Implementation

[0075] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0076] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0077] Existing interventions targeting METTL3 mostly target the SAM binding pocket of METTL3 as the core target, comprehensively inhibiting the overall METTL3 m-binding capacity through competitive inhibition, allosteric regulation, or protein degradation. 6 A-methyltransferase activity is used to comprehensively block the modification of downstream target genes by METTL3. While such approaches can inhibit the pathogenic function of METTL3, they may also disrupt its core roles in physiological processes such as hematopoietic regulation, normal immune cell development, and cell cycle homeostasis. The core inventive point of this invention lies in proposing to target the specific binding interface between METTL3 and IRF4 mRNA as a target, and screening for methods that specifically block the binding of METTL3 to IRF4 mRNA. 6 Modification A enables precise targeted intervention on the METTL3-IRF4 pathogenic axis, fundamentally addressing the safety deficiencies of existing pan-METTL3 inhibitors while retaining highly effective inhibition of the core pathological processes of SLE / LN.

[0078] Overall technical solution of the invention: This invention is based on the previously validated core pathogenic role of the METTL3-IRF4 axis in LN pathogenesis, focusing on the interaction between the METTL3 protein and IRF4 mRNA. 6 Using the region that specifically binds to the A-modification site as the target, and through virtual screening and multiple rounds of in vitro and in vivo experiments, specific small molecule inhibitors that meet the following core functional characteristics were obtained: It can directly bind to the specific binding interface between METTL3 and IRF4 mRNA and inhibit their binding. It can significantly downregulate IRF4 transcription and protein levels; By downregulating IRF4 expression, it can significantly inhibit abnormal B cell activation and pathogenic autoantibody secretion, and significantly improve kidney pathological damage in SLE / LN model animals in vivo.

[0079] The core of this screening method is designed around the specific blocking of METTL3-IRF4 binding, as follows: Target structure identification and virtual screening: MeRIP-seq, MeRIP-qPCR, single-base extension and ligation-dependent qPCR amplification (SELECT) experiments were used to identify the METTL3-mediated m-terminal structure on IRF4 mRNA. 6 A-modified specific sites were identified; RNA immunoprecipitation (RIP) experiments confirmed a direct binding relationship between the METTL3 protein and IRF4 mRNA. Based on the identified target structure, AlphaFold3 was used for molecular docking to construct a METTL3-IRF4 mRNA complex model. The binding interface constitutes a potential binding pocket for small molecule intervention, and the interaction interface between METTL3 and IRF4 mRNA differs from the classic SAM binding region. The inventors optimized the METTL3 protein structure and selected the binding interface, used small molecules from TargetMol's active molecule library T001 for conformational generation, used a prepared inhibitor library as the ligand file, and performed molecular docking screening using Schrödinger software. To obtain structurally diverse and highly affinity potential small molecule inhibitors, a multi-stage screening strategy was employed: ① The optimal docking conformation within the same compound was retained; ② Screening was performed using a binding free energy (MMGBSA_dG_Bind) < -50 kcal / mol as a threshold; ③ Cluster analysis was conducted based on compound structural similarity (Tanimoto similarity coefficient 70%), and the best representative from each cluster was selected to ensure chemical spatial diversity; Protein-ligand interaction fingerprint (PLIF) analysis, structural diversity analysis, and pharmacokinetic property prediction were performed on the final candidate molecules. Finally, based on the MMGBSA_dG_Bind binding free energy ranking, the top 50 small molecules were selected as candidate inhibitors for subsequent experimental validation.

[0080] Combining inhibitory activity screening: First, active molecules capable of effectively downregulating IRF4 expression were screened at the cellular level; the direct binding ability of small molecules to METTL3 protein was verified using micro-thermophoresis; and the effects of these molecules on key mRNA markers on IRF4 were analyzed using SELECT assay. 6The intervention effect of the A modification site was investigated; finally, the influence of small molecules on the changes in the binding of METTL3 and IRF4 mRNA was confirmed at the mechanism level through RIP, and it was confirmed at the mechanism level whether it plays a role by interfering with the formation of the METTL3-IRF4 mRNA complex.

[0081] Cellular Function Validation: In primary mouse B cells, the inhibitory effects of candidate compounds on IRF4 expression, B cell activation, plasma cell differentiation, and autoantibody secretion were validated, and compounds with no significant cytotoxicity and excellent functional activity were screened. Specifically, primary mouse B cells were isolated and cultured, and the effects of the small molecule YX-2-107 (CAS No. 2417408-46-7) on various B cell functions were systematically evaluated. First, the safe concentration of the drug without cytotoxicity was determined. Based on this, the effects of the two small molecules on the proliferation capacity of B cells under activation signal stimulation, early and late activation states, differentiation into plasmablasts, and the total IgG secretion level in the culture supernatant were examined. Simultaneously, this invention further confirmed the downregulation of IRF4 protein expression by the two small molecules in primary B cells, further validating the relationship between their mechanism and functional regulation.

[0082] In vivo efficacy and safety validation: Ten-week-old female MRL / lpr mice were randomly divided into a control group and a YX-2-107 treatment group. The small molecule or control solvent was administered via intraperitoneal injection, with continuous administration until 20 weeks of age. Mouse body weight was monitored weekly during the experiment to assess the systemic toxicity of the small molecule and its impact on the general condition of the animals. Mice were sacrificed at the experimental endpoint, and peripheral blood, spleen, bone marrow, and kidney tissues were collected for subsequent serial marker detection. The inventors measured plasma anti-dsDNA antibody levels to clarify the inhibitory effect of the small molecule on systemic autoimmune responses. Its effect on renal function was assessed by detecting serum creatinine, urinary albumin, and the urinary albumin / creatinine ratio. The degree of glomerulonephritis and tubulointerstitial damage was observed using hematoxylin-eosin (HE) staining, periodic acid-Schiff (PAS) staining, and Masson staining. In addition, the inventors verified whether the small molecule could effectively downregulate IRF4 expression and reduce plasma cell infiltration by detecting the proportion of CD138 and IRF4 double-positive cells in kidney tissue.

[0083] Small molecule drugs screened: From 50 candidate small molecules, 13 molecules that could significantly downregulate IRF4 mRNA were screened, of which 9 reduced IRF4 protein expression. Microthermophoresis experiments verified that 5 of these molecules had high affinity binding to METTL3. RIP-qPCR confirmed that both significantly inhibited the binding of METTL3 to IRF4 mRNA. In addition, YX-2-107 can also effectively inhibit B cell activation and antibody secretion by downregulating IRF4 expression. There was no significant difference in body weight gain between the YX-2-107 treatment group and the control group. YX-2-107 significantly reduced anti-dsDNA antibody levels, improved serum creatinine, urinary albumin, and the urinary albumin / creatinine ratio, and alleviated renal tissue pathological damage. Renal immunofluorescence showed CD138. + IRF4 + The number of double-positive plasma cells was significantly reduced.

[0084] The small molecule YX-2-107 screened in this invention has been reported in previous studies. YX-2-107 is a proteolytic targeting chimera designed to selectively degrade CDK6 protein. By simultaneously binding to CDK6 and E3 ubiquitin ligases, it induces CDK6 ubiquitination and degradation by the proteasome, demonstrating antitumor activity in Ph chromosome-positive acute lymphoblastic leukemia studies. The role of CDK6 in the development of lupus nephritis and the regulation of IRF4 expression has not been reported. Therefore, the known target of YX-2-107 (CDK6) is not directly related to the novel function observed in this study. This discovery reveals that YX-2-107 can bind to METTL3 and interfere with its interaction with IRF4 mRNA, revealing a novel biological function beyond its known target. This finding expands our understanding of the pharmacological effects of such small molecules and provides insights for developing new indications based on existing small molecules. From a mechanistic perspective, the characteristics exhibited by the small molecule YX-2-107 are consistent with expectations for interfacial disruptors. MST confirmed its high affinity for METTL3, which is the basis for its subsequent biological effects. Molecular docking results showed that the binding amino acid sites were mostly key residues for METTL3-RNA interaction. After binding, the molecule may directly hinder the effective contact between the METTL3 complex and IRF4 mRNA through steric hindrance or inducing local conformational changes, a mechanism supported by evidence from RIP-qPCR experiments. Because METTL3 binds to specific mRNA sites... 6IRF4 modification depends on its specific binding to its substrate. Weakened binding leads to selective inhibition of specific m6A modification sites on IRF4 mRNA, while potentially having less impact on modifications of other METTL3 transcripts. Functional experiments showed that YX-2-107 significantly reduced IRF4 protein expression in B cells, decreased the expression of early activation markers CD69 and co-stimulatory molecule CD86, and downregulated total IgG levels in cell culture supernatants. The in vivo efficacy and mechanism of action of YX-2-107 were also evaluated in an MRL / lpr lupus mouse model. YX-2-107 treatment reduced serum anti-dsDNA antibody levels, improved renal function indicators, and alleviated renal pathological damage and immune complex deposition. CD138 was observed in renal immunofluorescence. + IRF4 + The number of double-positive plasma cells was reduced. These results indicate that YX-2-107 can improve the disease progression of lupus nephritis by targeting the METTL3-IRF4 axis, inhibiting plasma cell differentiation and renal infiltration.

[0085] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0086] Example 1: Determination of the METTL3-IRF4 mRNA binding interface and virtual screening, and in vitro binding activity of candidate small molecules. The METTL3-IRF4 mRNA binding interface was predicted using AlphaFold3, and virtual screening was performed using Schrödinger software. Candidate small molecules were obtained through structural clustering and binding free energy ranking. Fifty candidate small molecules were then validated using multi-dimensional experiments. First, Western blotting was used to screen for small molecules that could downregulate IRF4 expression; then, microthermophoresis (MST) was used to detect the binding affinity between the small molecules and METTL3 protein; finally, RIP-qPCR was used to verify the interference ability of the small molecules on the binding of METTL3 and IRF4 mRNA.

[0087] The specific experimental materials, reagents, and methods are as follows: 1.1 Experimental Methods 1.1.1 Western blot (WB) (1) Preparation of protein samples: Collect the treated cells and wash them with buffer. Add lysis buffer (Jiangsu Kangwei Century Biotechnology Co., Ltd., Cat: CW2333S) containing 100× protease inhibitor (Jiangsu Kangwei Century Biotechnology Co., Ltd., Cat: CW2200S), and lyse on ice for 30 minutes. Vortex the sample briefly every 5 minutes, and mix intermittently during the process. Centrifuge after lysis and collect the supernatant. Determine the protein concentration using a conventional protein quantification method (such as the BCA method). Mix an equal volume of protein with the loading buffer, heat to denature the protein, and cool before use.

[0088] (2) SDS-PAGE gel electrophoresis: Prepare separating and stacking gels of appropriate concentrations according to the molecular weight of the target protein. Mount the gels in the electrophoresis tank and add electrophoresis buffer. Add the protein sample and molecular weight label respectively, and perform constant voltage or constant current electrophoresis until the dye reaches the bottom of the gel.

[0089] (3) Transfer: Cut a suitable transfer membrane (such as PVDF or nitrocellulose membrane), activate it, and assemble it with the gel and filter paper in sequence, ensuring no air bubbles. Perform electrotransfer in transfer buffer at low temperature.

[0090] (4) Blocking and antibody incubation: After transfer, the membrane was blocked in blocking buffer at room temperature. Then, it was incubated with primary antibodies (anti-METTL3, IRF4, and internal control antibodies, purchased from Proteintech, Cat: 67733-1-Ig; CST, Cat: 15106; Proteintech, Cat: 81640-5-RR) at a suitable temperature (4℃ overnight or room temperature) for a certain period. After washing, it was incubated with HRP-labeled secondary antibodies (Wuhan Aibote Biotechnology Co., Ltd., Cat: AS014; Cat: AS003). It was washed again.

[0091] (5) Development and image analysis: The chemiluminescent substrate was uniformly coated on the membrane, and the signal was captured using an imaging system. Semi-quantitative analysis was performed using image analysis software, and the relative expression level of the target protein was calculated based on the internal control.

[0092] 1.1.2 RNA immunoprecipitation quantitative PCR (RIP-qPCR) This experiment uses Magna RIP. TM The RNA-binding protein immunoprecipitation kit (purchased from Millipore, Germany, Cat: 17-700) was used according to the instructions. The general steps are as follows: (1) Preparation of cell lysates: Prepare RIP lysis buffer (containing protease and RNase inhibitor). Collect cells, wash with pre-chilled PBS, centrifuge, resuspend in complete RIP lysis buffer, and incubate on ice for lysis. Centrifuge, collect the supernatant, aliquot and freeze.

[0093] (2) Preparation of antibody-magnetic bead complex: Protein A / G magnetic beads were washed with RIP washing solution. The washed magnetic beads were incubated with anti-METTL3 antibody or isotype control IgG at room temperature to allow the antibody to couple to the magnetic beads. Unbound antibody was removed by washing.

[0094] (3) RNA-protein immunoprecipitation: The antibody-magnetic bead complex was resuspended in RIP immunoprecipitation buffer, cell lysate was added, and the input sample was collected. The mixture was incubated overnight at 4°C by rotation.

[0095] (4) Washing, RNA elution and purification: After incubation, magnetic separation is performed, the supernatant is discarded, and the magnetic beads are washed multiple times with RIP washing buffer. Proteinase K digestion buffer is added, and the mixture is incubated at a suitable temperature to digest the protein. After magnetic separation, the supernatant is transferred, and the RNA is purified using RNA extraction reagents (such as TRIzol or centrifugation column method).

[0096] (5) Quantitative PCR analysis: The purified RNA from the IP and Input groups was reverse transcribed into cDNA. Using cDNA as a template, qPCR was performed using gene-specific primers (IRF4 sequence (5'-3') forward primer: GCCAGCAGGTTCACAACTA (SEQ ID NO:1), reverse primer: TGTCACCTGGCAACCATTTTC (SEQ ID NO:2)) and the SYBR Green method. The enrichment fold was calculated, and the binding of METTL3 to IRF4 mRNA was assessed.

[0097] 1.1.3 Construction of METTL3-IRF4 mRNA complex model and virtual screening (1) Complex structure modeling: The METTL3 protein sequence was obtained from a public database. Based on previous work... 6 A modification analysis results determined the m in IRF4 mRNA. 6 The target fragments were upregulated by modification A. Complex models of METTL3 with each RNA fragment were constructed using structural prediction software (such as deep learning-based tools), generating multiple candidate conformations. The optimal complex was selected based on the binding mode score to determine the binding pocket.

[0098] (2) Target protein structure pretreatment: The binding interface structure was optimized using the protein preparation module in the molecular docking software, including hydrogenation, bond ordering, protonation state adjustment, and energy minimization using an appropriate force field.

[0099] (3) Preparation of small molecule compound libraries: Select commercial or self-built small molecule libraries (containing known active ingredients and natural products, etc.). Use the ligand preparation module to generate the three-dimensional conformation, protonated state and tautomer of small molecules, and generate multiple conformations for each small molecule.

[0100] (4) Molecular docking and virtual screening: Docking was performed using the METTL3 binding pocket as the acceptor (rigid) and small molecules as flexible ligands. After docking, the binding conformation was optimized by energy, and the conformation with the best score was retained. The affinity was evaluated using a binding free energy calculation method (such as MM-GBSA), and the docking scores and free energies were combined to rank the molecules.

[0101] (5) Evaluation of screening results: Interaction fingerprint analysis, structural clustering and pharmacokinetic property prediction of candidate molecules.

[0102] 1.1.4 Cell Culture Ramos cells were routinely suspended in a medium containing serum and antibiotics at 37°C in a CO2 incubator. Cells were seeded into culture plates, and the small molecule to be screened (final concentration within a certain range, such as low micromolar level) or solvent control was added. After incubation for an appropriate time (such as 48 hours), cells were collected.

[0103] 1.1.5 Microscale thermophoresis (MST) (1) Preparation of fusion protein: ① Transfect HEK-293T cells with a plasmid carrying the METTL3-EGFP fusion gene (purchased from Beijing Maijin Biotechnology Co., Ltd.). 48-72 hours after transfection, discard the culture medium and gently wash the cells once with pre-chilled PBS. Digest the cells with trypsin and collect them. Centrifuge at 800 × g for 10 minutes and discard the supernatant. Resuspend the cell pellet in PBS and wash once more. ② Prepare proteins using a nucleus-cytoplasm-cell membrane preparation kit (Beijing Pulilai Gene Technology Co., Ltd., Cat: P1201). All subsequent steps were performed on ice or at 4°C. A simplified procedure is as follows: per 1×10 7Add 500 μL of pre-chilled CER I reagent per 100 μL of cytoplasmic cell pellet to resuspend the cell pellet, and add protease inhibitors. Vortex thoroughly to mix, then incubate on ice for 2 minutes. Transfer the cell suspension to a pre-chilled glass homogenizer and homogenize repeatedly in an ice-water bath. ③ Centrifuge the homogenized lysate at 4°C, 800 × g for 5 minutes. The pellet is a crude extract of cell nuclei, while the supernatant contains cell membranes and cytoplasm. ④ Transfer the supernatant to a new tube and record the volume. Add one-tenth the volume of pre-chilled MER reagent to the supernatant, mix gently, and incubate on ice for 5 minutes. ⑤ Centrifuge at 4°C, 14000 × g for 30 minutes. After centrifugation, the supernatant contains soluble cytoplasmic protein components, and the pellet contains cell membrane components.

[0104] (2) MST sample preparation ① The preserved METTL3-EGFP protein sample was serially diluted using MST detection buffer (PBS pH 7.4, containing 0.05% Tween-20 and 1% DMSO). Scanning was performed using the blue fluorescence channel of a NanoTemper Monolith NT.115 instrument, selecting protein concentrations with fluorescence signal intensities within the ideal range (typically 200-2000) for the formal binding experiment. ② The small molecule inhibitor to be tested was prepared into a 200 μM starting solution using MST detection buffer, followed by a series of 16 consecutive serial dilutions to prepare ligand solution gradients of different concentrations.

[0105] (3) Combining experiments with data collection ① The determined METTL3-EGFP protein solution was mixed with equal volumes of small molecule solutions of varying concentrations, and incubated at room temperature for a short time. ② Detection was performed using a NanoTemper Monolith NT.115 microthermophoresis instrument and its accompanying MO.Control software. The blue fluorescence channel was selected, and the incubated protein-small molecule mixture was aspirated and loaded using a dedicated capillary tube. ③ The capillary tube was placed in the sample tray, and the detection program was started. The instrument automatically recorded the thermophoretic fluorescence change curves of each sample at different ligand concentrations. The experimental data were analyzed using the instrument's accompanying MO.Affinity Analysis software. The fluorescence change value (ΔFnorm) was fitted to the logarithm of the ligand concentration, and the equilibrium dissociation constant Kd was calculated using a binding model to quantitatively assess the binding affinity between the small molecules and the METTL3 protein.

[0106] 1.1.6 RIP-qPCR To verify whether small molecules interfere with the binding of METTL3 to IRF4 mRNA, the specific steps are the same as in 1.1.2.

[0107] 1.2 Experimental Results 1.2.1 Prediction of binding patterns between METTL3 and key modification regions of IRF4 mRNA To elucidate the key m molecules on METTL3 and IRF4 mRNA at the structural level 6 To investigate the binding mechanism of the modified region and guide the rational screening of subsequent inhibitors, this embodiment uses the AlphaFold3 tool for molecular docking. This embodiment divides the target region into two fragments (RNA1 and RNA2), which are then molecularly docked with the METTL3 protein, generating five prediction models for each system. The optimal binding mode is selected based on the model scores. By comparing the model scores (ranking_score) with the binding interface, this embodiment selects the optimal binding mode between the RNA1-METTL3 model (model1, ranking_score: 0.21) and the RNA2-METTL3 complex model (model0, ranking_score: 0.32). Figure 1 (A and B). The two RNA segments formed a clear binding interface with the METTL3 protein, which was a network structure. Figure 1 (C). These residues constitute a potential binding pocket for small molecule intervention. Further analysis compared the relationship between the classic SAM binding pocket of the METTL3 protein and the RNA binding interface predicted in this invention. The results showed that the interaction interface between METTL3 and IRF4 mRNA differs from the classic SAM binding region (C). Figure 1 (D). This structural feature suggests that small molecules targeting this RNA-binding interface may exert a regulatory role by interfering with the recognition process between METTL3 and substrate RNA, rather than directly competing for SAM binding sites. In summary, this invention reveals the binding mode of the METTL3 protein to a specific region of IRF4 mRNA. The identified binding interface and key amino acid residues lay a crucial structural biology foundation for subsequent virtual screening targeting this interaction interface to discover specific inhibitors.

[0108] 1.2.2 Screening of small molecule inhibitors targeting the METTL3-IRF4 mRNA interaction interface To identify inhibitors targeting the METTL3-IRF4 mRNA interaction interface, this embodiment employed structure-based virtual screening. Figure 2(A) First, the protein structure of METTL3 was optimized in this embodiment. Small molecules from the TargetMol active molecule library T001 were used for conformation generation. A prepared inhibitor library was used as the ligand file, and molecular docking screening was performed using Schrödinger software. To obtain structurally diverse and highly affinityable potential small molecule inhibitors, a multi-level screening strategy was adopted: ① The best docking conformation within the same compound was retained, resulting in 1516 conformations from the database; ② Using a binding free energy MMGBSA_dG_Bind < -50 kcal / mol as a threshold, 439 high-affinity molecules were screened; ③ Cluster analysis was performed based on compound structural similarity (Tanimoto similarity coefficient 70%), and the best representatives were selected from each of the 89 cluster categories to ensure chemical spatial diversity; Protein-ligand interaction fingerprint (PLIF) analysis, structural diversity analysis, and pharmacokinetic property prediction were performed on the final candidate molecules to provide a theoretical basis for subsequent experimental studies. The linear correlation coefficient between docking score and molecular weight was calculated, and the results showed a correlation coefficient of only 0.34 (…). Figure 2 (B) indicates that the scoring function does not simply favor large molecular weight compounds, validating the reliability and rationality of the scoring function and screening method. PLIF analysis further reveals that numerous amino acids interact with the screened small molecules ( Figure 2 (C). Finally, based on the MMGBSA_dG_Bind binding free energy ranking, the top 50 small molecules were selected as candidate inhibitors for subsequent experimental validation.

[0109] 1.2.3 Inhibitory effect of candidate molecules on IRF4 protein levels To verify the actual inhibitory effect of candidate molecules obtained from virtual screening on IRF4 expression, this embodiment treated Ramos cell lines with small molecule inhibitors and detected their effects on IRF4 protein levels by Western blotting. The results showed that nine small molecule inhibitors significantly reduced IRF4 protein expression, namely small molecules 42, 31, 25, 23, 41, 10, 36, 43, and 16. Figure 3 This indicates that these small molecules can indeed effectively inhibit the expression of IRF4 protein in cells.

[0110] 1.2.4 Identification of high-affinity binding of YX-2-107 to METTL3 To verify the binding affinity of small molecules to METTL3 protein, micro-thermophoresis (MST) was performed in this embodiment. By constructing and purifying the GFP-METTL3 fusion protein, the inventors quantitatively determined the binding affinity of each small molecule to METTL3. The results showed that the equilibrium dissociation constant (Kd) obtained from the quantitative affinity determination of small molecule YX-2-107 (molecule number 42) was 5.63 ± 0.18 μM, with a Kd value less than 10 μM, indicating a strong binding affinity between small molecule YX-2-107 and METTL3, and the potential to long-term block the binding of METTL3 to IRF4 mRNA. Figure 4 This experiment suggests that small molecule YX-2-107 (molecule number 42) can bind to the METTL3 protein and has a high binding affinity.

[0111] 1.2.5 Analysis of the interaction mode of the YX-2-107 and METTL3-IRF4 mRNA binding interface To compare the binding modes of the small molecules screened in this embodiment with those of classic METTL3 inhibitors, the inventors, based on reported structural information, labeled and compared the binding sites of SAM (PDB 5IL1), the representative METTL3 inhibitor STM2457 (PDB 702I), and the screened small molecule YX-2-107 with METTL3. SAM, as a methyl donor, binds to the SAM catalytic pocket of METTL3. STM2457, as a classic competitive inhibitor of SAM, has a binding region that highly overlaps with the SAM pocket. YX-2-107 has a relatively long molecular structure; its binding region partially overlaps with the SAM pocket, but mainly occupies the RNA-binding interface region of METTL3. Figure 5 Binding site analysis revealed that YX-2-107 binds to residues such as Gly407, Arg505, Ser511, and Lys513. These results indicate that YX-2-107, screened in this embodiment, primarily targets the METTL3 RNA-binding interface, and its mode of action differs from that of classic SAM competitive inhibitors. Based on this analysis, YX-2-107 was ultimately selected for further in vitro and in vivo functional validation.

[0112] 1.2.6 Validation of the competitive inhibition of METTL3 and IRF4 mRNA binding by YX-2-107 To verify at the mechanistic level whether YX-2-107 exerts its effect by interfering with the binding of METTL3 protein to its substrate IRF4 mRNA, an RNA immunoprecipitation experiment was performed in this embodiment. Western blotting results confirmed that the METTL3 antibody used in the experiment could effectively precipitate the target protein; clear METTL3 bands were detected in both the Input group and the METTL3-IP group, while none were detected in the control IgG-IP group, indicating that the immunoprecipitation process was efficient. Figure 6 (A). Agarose gel electrophoresis showed that there were specifically enriched IRF4 mRNA bands in the METTL3-IP group, confirming the binding between the two. Figure 6 (B). RIP-qPCR quantitative analysis results indicated that, compared with the control group, YX-2-107 treatment significantly reduced the level of IRF4 mRNA enriched by METTL3 protein (B). Figure 6 (C). This result indicates that YX-2-107 can effectively inhibit the binding of METTL3 to IRF4 mRNA.

[0113] Based on the above data, this embodiment confirms that YX-2-107 can competitively interfere with the binding of METTL3 to IRF4 mRNA by occupying the METTL3 RNA-binding interface, thereby inhibiting subsequent mRNA binding. 6 A-methylation modification and IRF4 protein expression.

[0114] Example 2: Regulatory effect of small molecule inhibitors targeting the METTL3-IRF4 axis on B cell function B cells were obtained from the spleen of C57BL / 6 mice using magnetic bead sorting, and the safe drug concentration was determined by cell viability assay (CCK-8). B cell proliferation capacity was detected by carboxyfluorescein diacetate succinimide (CFSE) labeling, and the expression of B cell activation markers CD69 and CD86 and the proportion of plasmablasts were detected by flow cytometry. The total IgG level in the cell culture supernatant was detected by enzyme-linked immunosorbent assay (ELISA), and changes in IRF4 expression were also detected.

[0115] The specific experimental materials, reagents, and methods are as follows: 2.1 Experimental Methods 2.1.1 Isolation and Culture of Primary B Cells (1) Preparation of single-cell suspension from mouse spleen Female C57BL / 6 mice were anesthetized and aseptically dissected. The spleen was quickly removed and placed in pre-chilled phosphate-buffered saline (PBS). The spleen was transferred to a cell filter and gently ablated using a sterile syringe plunger while continuously rinsing with pre-chilled PBS to allow cells to pass through the filter. The cell suspension was collected, centrifuged, and the supernatant was discarded. An appropriate amount of erythrocyte lysis buffer was added to the cell pellet, and the mixture was incubated at room temperature or on ice for a specified time to remove erythrocytes. An equal volume of complete culture medium was then added to terminate the lysis reaction. The mixture was centrifuged again, the supernatant was discarded, and the cell pellet was resuspended in PBS. The total cell count and viability were determined using a cell counter or hemocytometer.

[0116] (2) CD19 + Magnetic sorting of B cells CD19 was separated using immunomagnetic bead sorting. + B cells (RWD Life Science, Cat: K1305-20) were processed according to the kit instructions, roughly as follows: A suitable amount of spleen single-cell suspension was taken and washed with pre-chilled sorting buffer (containing PBS, a certain concentration of BSA, and EDTA). After centrifugation, the supernatant was discarded, and the cells were resuspended in sorting buffer. Biotin-labeled anti-mouse CD19 antibody was added, and the mixture was thoroughly mixed and incubated at low temperature (e.g., 2-8℃) for a certain period. After incubation, the cells were washed with sorting buffer, centrifuged, and the supernatant was discarded. The cells were resuspended in sorting buffer, streptavidin-labeled magnetic beads were added, and the mixture was thoroughly mixed and incubated at low temperature. After washing again, the cell suspension was passed through a sorting column placed in a magnetic field to collect unbound cells (if positive sorting occurs, the bound fraction is collected). The sorting column was removed from the magnetic field, and the cells were washed with sorting buffer to obtain CD19. + B cells. A small number of sorted cells were taken for flow cytometry to determine the purity of the sorted cells (high purity is usually required), and the remaining cells were used for subsequent experiments.

[0117] (3) In vitro B cell culture and activation The sorted CD19 + B cells (or CFSE-labeled B cells) were seeded in multi-well culture plates at an appropriate cell density per well (e.g., 1 × 10⁻⁶). 5 Up to 2×10 5(Number of cells). Cells were cultured in RPMI-1640 complete medium containing 10% fetal bovine serum and 1% penicillin-streptomycin. B cell activation stimulants, including but not limited to: anti-IgM antibody (Fab fragment) (5 μg / mL), anti-CD40 antibody (5 μg / mL), IL-21 cytokine (=50 ng / mL), and TLR agonists (e.g., R848, 1 μg / mL), were added to the culture system. Simultaneously, small molecule inhibitors (final concentration in the low micromolar range, e.g., 10 μM) were added to the experimental group, and an equal volume of solvent control (e.g., DMSO) was added to the control group. The culture plates were gently shaken to ensure uniform drug dispersion. The culture plates were incubated at 37°C in a 5% CO2 incubator for a specified time (e.g., 72-96 hours). After culture, the cell suspension was collected, and the cell pellet and culture supernatant were separated by centrifugation. The cell pellet was used for flow cytometry, RNA extraction, or protein extraction; the culture supernatant was used for ELISA detection.

[0118] 2.1.2 Cell viability assay (Cell counting kit-8, CCK-8) B cells were seeded into 96-well plates, and small molecule inhibitors of varying concentrations were added. A solvent control group and a blank control group were also included. After incubating the plates in an incubator for an appropriate time, CCK-8 reagent was added to each well, and incubation continued in the dark. The absorbance at 450 nm was measured using a microplate reader, and cell viability at each concentration was calculated to determine the safe concentration range for subsequent experiments.

[0119] 2.1.3 Flow cytometry After culture, cells were collected and washed with pre-cooled buffer. Live cell dyes were added, and the cells were incubated at room temperature in the dark. After washing, Fc receptor blocking antibodies were added to block non-specific binding. A premixed mixture of surface marker fluorescent antibodies, including anti-CD69, anti-CD86, anti-B220, and anti-CD138, was then added, mixed, and incubated at room temperature in the dark. After washing, cells were fixed and permeabilized, and fluorescently labeled anti-IRF4 antibody was added, followed by further incubation in the dark. After washing, cells were resuspended, and data were collected using flow cytometry. The expression positivity rate and mean fluorescence intensity of activation markers CD69 and CD86 in B cells were analyzed, along with the proportion of plasmablasts and the expression level of IRF4.

[0120] 2.1.4 Enzyme-linked immunosorbent assay (ELISA) (1) Dilute the Purified Goat anti-mouse IgG antibody (Biolegend, Cat: 405301) with PBS at a ratio of 1:2000; add 60 μL of the diluted antibody to each well of a 96-well plate, seal the plate with plastic wrap, and incubate overnight at 4°C. (2) Bring the ELISA plate to room temperature and discard the coating solution; add 200 μL of PBST to each well, let stand for 1 minute, then discard the solution. Repeat the washing process 3 times, patting dry on absorbent paper after each wash. (3) Prepare the blocking solution by dissolving 0.5% Gelatin and 0.5% BSA in PBST. Place a beaker in a weighing apparatus, zero the scale, add the required amount of gelatin and an appropriate amount of PBST, and microwave for 1 minute; weigh an equal amount of BSA, add the above liquid, stir well, and place the dissolved blocking solution on ice to cool. (4) Add 100 μL of blocking solution to each well, seal with plastic wrap, incubate at room temperature for 1 hour, and discard the blocking solution. (5) Add 200 μL of PBST to each well, let stand for 1 minute and then discard. Repeat the washing 3 times, patting dry on absorbent paper after each wash. (6) Add 50 μL of cell culture supernatant to each well, and add an equal volume of PBS to the blank control well. (7) Seal with plastic wrap and incubate at room temperature for 2 hours; after incubation, wash 3 times with PBST. (8) Dilute HRP goat anti-mouse IgG antibody (Biolegend, Cat: 405306) with PBS at a ratio of 1:2000, and add 60 μL of the diluted secondary antibody to each well. (9) Seal with plastic wrap and incubate at room temperature in the dark for 1 hour. During incubation, the well can be shaken at low speed on a shaker; after incubation, wash 3 times with PBST. (10) Mix equal volumes of TMB chromogenic solution A and solution B according to the instructions, and use immediately. Add 100 μL of TMB mixture to each well and incubate at 37°C in the dark. The incubation time needs to be optimized according to the color development (usually 10-30 minutes). The incubation can be stopped when the positive control well turns obviously blue and the blank well is colorless. (11) Add 50 μL of stop solution to each well to stop the color development reaction. The solution color changes from blue to yellow. (12) Use an ELISA reader to measure the absorbance OD of each well at a wavelength of 450 nm. 450 The values ​​were compared to the total IgG levels among the groups.

[0121] 2.2 Experimental Results 2.2.1 Determination of the safe concentration range of YX-2-107 To investigate the effect of YX-2-107 on B cell function and to eliminate the interference of its cytotoxicity on subsequent functional experiments, this example first screened the drug concentration. Spleen single-cell suspensions were prepared from C57BL / 6 mice and treated with different concentrations (1, 5, 10, 20, 40 μM) of YX-2-107. Cell viability was assessed using the CCK-8 assay to evaluate drug safety. The results showed that at concentrations of 5, 10, and 20 μM, the cell viability of the YX-2-107 treatment groups was not significantly different from that of the control group. Figure 7 This indicates that the drug did not exhibit significant cytotoxicity within this concentration range. To ensure the reliability of subsequent functional experiments and to select a suitable effective concentration, the inventors chose 10 μM as the drug treatment concentration for subsequent experiments.

[0122] 2.2.2 Inhibitory effect of YX-2-107 on IRF4 expression in B cells IRF4, a key transcription factor regulating B cell differentiation into plasma cells, is closely related to B cell activation and differentiation. Based on previous molecular-level confirmation that YX-2-107 can interfere with the binding of METTL3 to IRF4 mRNA, this study further investigated the effect of YX-2-107 on IRF4 protein expression in primary B cells. Flow cytometry results showed that in activated B cells, YX-2-107 treatment significantly downregulated IRF4 expression, as evidenced by a significantly lower mean fluorescence intensity (MFI) of IRF4 protein compared to the control group. Figure 8 This result is consistent with the findings observed in the Ramos cell line. The decrease in IRF4 expression level provides experimental evidence for further investigation into the regulatory role of YX-2-107 on B cell function.

[0123] 2.2.3 Inhibitory effect of YX-2-107 on B cell activation In assessing B cell activation status, this embodiment detected the expression of the early activation marker CD69 and the co-stimulatory molecule CD86. CD69 is a typical early activation inducing molecule on the cell surface, and its expression is rapidly upregulated within hours after B cells receive antigen stimulation, making it a sensitive indicator of initial B cell activation. CD86 is a key co-stimulatory molecule, mainly expressed persistently in the later stages of activation. By binding to the CD28 molecule on the surface of T cells, it provides the second signal necessary for T cell activation, and its expression level directly reflects the antigen-presenting function and immune activation potential of B cells. Therefore, the combined detection of CD69 and CD86 expression can comprehensively assess the dynamic process of B cells from early activation to functional maturation. Flow cytometry results showed that after treatment with YX-2-107, the average fluorescence intensity of CD69 and CD86 decreased ( Figure 9(A and B). The above results indicate that YX-2-107 can significantly inhibit the activation of B cells.

[0124] 2.2.4 Inhibitory effect of YX-2-107 on antibody secretion function The core effector function of plasma cells is the synthesis and secretion of large amounts of antibodies. Therefore, detecting the level of immunoglobulin G (IgG) in culture supernatant is an important indicator for assessing the antibody secretion capacity of B cells after terminal differentiation. This experiment used ELISA to detect the total IgG level in the culture supernatant to determine whether YX-2-107, while inhibiting cell differentiation, also weakened the final antibody secretion capacity. The results showed that, compared with the control group, the total IgG level in the culture supernatant of the YX-2-107 treatment group was significantly reduced (…). Figure 10 This result confirms at the functional level that YX-2-107 can significantly inhibit the ability of plasma cells to secrete antibodies.

[0125] Example 3: Therapeutic effect of small molecule inhibitors targeting the METTL3-IRF4 axis in mice with lupus nephritis Ten-week-old female MRL / lpr mice were randomly assigned to groups and injected intraperitoneally with YX-2-107 until 20 weeks of age. Mouse body weight was monitored weekly. Plasma anti-dsDNA antibody levels were detected by ELISA. Serum creatinine and urinary albumin / creatinine ratios were measured using biochemical reagent kits. Kidney pathological damage was assessed by hematoxylin-eosin (HE) staining, periodic acid-Schiff (PAS) staining, and Masson's staining. B cells and T cell subsets in bone marrow, spleen, and kidneys were analyzed by flow cytometry. Kidney CD138 was detected by immunofluorescence staining. + IRF4 + Double-positive plasma cell infiltration. To further elucidate the drug's mechanism of action, transcriptome sequencing analysis was performed on the kidney tissues of mice in both the drug-treated and control groups.

[0126] The specific experimental materials, reagents, and methods are as follows: 3.1 Experimental Methods 3.1.1 Animal experiments Female MRL / lpr lupus nephritis model mice, aged 8-10 weeks, were selected and acclimatized for one week in an SPF-grade animal facility. The mice were randomly divided into two groups: (1) a solvent control group and (2) a YX-2-107 treatment group. All drugs or solvents were dissolved / suspended in a sterile aqueous solution containing 0.5% sodium carboxymethyl cellulose (CMC-Na), while the solvent control group received a 0.5% CMC-Na solution of DMSO at the same concentration. From 10 weeks of age, the mice were administered the drug daily via intraperitoneal injection at a dose of 10 mg / kg, with an injection volume of 200 μL per mouse. The intervention continued for 10 weeks, during which the mice's weight was measured and recorded weekly to monitor drug safety and general condition.

[0127] After drug administration, mice were anesthetized with isoflurane, and blood was collected via the abdominal aorta into anticoagulant tubes. Plasma was separated by centrifugation, aliquoted, and cryopreserved for later use. Spleen was harvested to prepare a single-cell suspension, and erythrocytes were lysed and washed. Both kidneys were harvested; one kidney was fixed in paraformaldehyde, and the other was embedded in OCT embedding agent and then frozen. The femur was dissected, the bone marrow cavity was flushed with pre-cooled buffer, and a bone marrow cell suspension was collected, followed by erythrocyte lysis and washing. Urine was collected from mice in metabolic cages, centrifuged, and the supernatant was cryopreserved.

[0128] 3.1.2 ELISA The level of anti-dsDNA antibodies in plasma was detected using ELISA. The procedure was consistent with the experimental methods described in the relevant sections above.

[0129] 3.1.3 Biochemical indicator detection Serum creatinine concentration was measured using a biochemical analyzer or corresponding biochemical reagent kit. Urinary albumin and creatinine concentrations were measured using a detection kit, and the ratio of urinary albumin to creatinine was calculated to assess the degree of renal function impairment. The experiment is as follows: (1) Serum creatinine detection Serum creatinine concentration was determined using the sarcosine oxidase method. The instrument used was a Mindray BS-420 fully automated biochemical analyzer, and the accompanying reagent was a creatinine assay kit (Mindray Bio-Medical Electronics).

[0130] Start the instrument and check the status of each module, ensuring sufficient supply of cleaning solution, waste liquid container, and pure water. Remove the creatinine assay kit from the refrigerated environment, allow it to equilibrate to room temperature for 15 minutes, then gently invert to mix and place it in the designated reagent slot on the instrument. Perform daytime calibration using the accompanying standards to ensure the stability of the detection system. Then run the quality control samples; sample testing can only proceed after the measured values ​​are within control. Place the serum sample to be tested on the sample tray and enter the sample information. Select the detection item "CREA" on the operating interface. The instrument automatically aspirates the serum sample and reagents into the reaction vessel and incubates the reaction at 37°C. After the reaction is complete, read the absorbance change using the photoelectric colorimetric system; the system automatically calculates and outputs the serum creatinine concentration value.

[0131] (2) Detection of urine albumin and urine creatinine Urine samples were collected and centrifuged at 3000 rpm for 10 minutes at 4°C. The supernatant was used for assays. Urine albumin concentration was determined using the bromocresol green method. The instrument used was a Mindray CL-2000i fully automated biochemical analyzer, and the accompanying reagent was an albumin assay kit (Mindray Bio-Medical Electronics). Urine samples were loaded into a sample tray, the corresponding ALB assay was selected, and the instrument automatically aspirated the sample and bromocresol green reagent. After mixing, the mixture was incubated at 37°C, and the absorbance was measured at a specified wavelength. The system automatically calculated and output the urine albumin concentration.

[0132] Urinary creatinine concentration was determined using an enzymatic method. The instrument used was a Mindray CL-2000i fully automated biochemical analyzer, and the accompanying reagent was a creatinine assay kit (Iprocon). Urine samples were loaded into the sample tray, and the corresponding test, CREA (urine), was selected. The instrument automatically aspirated the sample and enzyme reagent, mixed them, and incubated the reaction at 37°C. The system automatically calculated and output the urinary creatinine concentration. The urinary albumin / creatinine ratio was calculated based on the measured urinary albumin and creatinine concentrations.

[0133] 3.1.4 Kidney pathological staining Fixed kidney tissue was dehydrated with graded ethanol, cleared with xylene, and embedded in paraffin. Sections were then stained with hematoxylin-eosin, periodic acid-Schiff, and Masson's stain. Glomerular and tubulointerstitial lesions were observed under a light microscope. Multiple glomeruli from each mouse were randomly selected for blinded scoring. Assessment indicators included the degree of glomerular cell proliferation, the degree of sclerosis and fibrosis, and the degree of inflammatory cell infiltration. Average values ​​were used for intergroup comparisons.

[0134] 3.1.5 Immunofluorescence staining (1) Preparation of frozen sections ① Fresh mouse kidney tissue was placed in pre-chilled 4% paraformaldehyde and fixed at 4°C for 12-24 hours. ② After fixation, the tissue was washed with 1× PBS and then sequentially transferred to 10%, 20%, and 30% sucrose solutions, undergoing a gradient dehydration process at 4°C until the tissue settled. Each dehydration stage lasted approximately 6-12 hours. ③ After dehydration, the surface liquid was blotted off with filter paper, and the tissue was placed in an embedding holder. OCT embedding medium was added to completely cover the tissue. The embedding holder was then rapidly frozen over liquid nitrogen vapor until the OCT completely solidified into a milky white block. ④ The embedded block was fixed onto the sample head of a cryostat, the section thickness was adjusted to 6 μm, and sections were prepared at -20°C. The sections were then attached to anti-detachment slides and stored at -80°C for later use.

[0135] (2) Immunofluorescence staining ① Remove frozen sections, warm to 37°C for 15 minutes, and wash with 1× PBS for 15 minutes. ② Circle the tissue area with an immunohistochemical pen, add 0.2% Triton X-100, and permeabilize at room temperature for 20 minutes. ③ Wash three times with PBS, 5 minutes each time. Add 3% BSA blocking solution and incubate at room temperature for 1 hour. ④ Remove the blocking solution, add anti-CD138 (Novus Biologicals, Cat: MAB2966-SP) and anti-IRF4 (CST, Cat: 15106) primary antibody working solutions, and incubate overnight at 4°C. ⑤ Wash three times with PBS, 5 minutes each time. Add the corresponding species' fluorescent secondary antibody and incubate at room temperature in the dark for 1 hour. ⑥ After washing three times with PBS, add anti-fluorescence quenching mounting medium containing DAPI and incubate at room temperature in the dark for 25 minutes. ⑦ Absorb excess liquid with absorbent paper, gently cover with a coverslip, avoiding air bubbles. The edges of the coverslips were sealed with clear nail polish. The slides were observed and images were acquired under an inverted fluorescence microscope. Multiple fields of view were randomly selected from each mouse to count the number of plasma cells that were double-positive for CD138 and IRF4.

[0136] 3.1.6 Statistical Analysis All experimental data in this invention were obtained from at least three independent repeated experiments. Statistical analysis and graphical plotting of the data were performed using GraphPad Prism 9.0 and IBM SPSS Statistics 26.0 software, respectively. Quantitative data are expressed as mean ± standard deviation (σ). x ± s) represents the mean. The Shapiro-Wilk test was used to assess whether the data conformed to a normal distribution. For comparisons between two normally distributed groups with homogeneous variances, an independent samples t-test was used; if the variances were unequal, Welch's t-test was used. For non-normally distributed data, the Mann-Whitney U test was used for comparison. All statistical analyses are expressed in terms of mean ± s. P A value <0.05 is considered statistically significant.

[0137] 3.2 Experimental Results 3.2.1 YX-2-107 had no significant effect on the body weight of MRL / lpr mice. To evaluate the therapeutic efficacy and safety of YX-2-107 in a lupus model, this study selected 10-week-old female MRL / lpr mice, randomly divided into groups, and administered either the drug or a control solution via intraperitoneal injection. Mouse body weight was monitored weekly during the intervention period. Results showed no significant difference in body weight gain between the drug-treated group and the control group until the experimental endpoint of 20 weeks. Figure 11 This indicates that the dosing regimen did not cause significant systemic toxicity or adverse effects on the general condition of the animals during the observation period. Mice were sacrificed at 20 weeks of age, and their peripheral blood, spleen, and kidney tissues were collected for subsequent series of index tests.

[0138] 3.2.2 Effects of YX-2-107 on improving lupus disease activity and kidney damage To evaluate the effects of YX-2-107 on lupus disease activity and target organ damage in MRL / lpr mice, this study measured key biochemical indicators in serum and urine. Compared with the control group, the plasma anti-dsDNA IgG level in the X-2-107 treatment group was significantly reduced ( Figure 12 The presence of creatinine (A) suggests that the systemic autoimmune response was suppressed. Simultaneously, key indicators of renal function, including serum creatinine, urinary albumin (ALB), and the urinary albumin / creatinine ratio (UACR), all showed significant decreases in the treatment group. Figure 12 (Disease-related BD). These results indicate that YX-2-107 can not only reduce the level of autoantibodies in model mice, but also effectively alleviate lupus-related kidney damage, demonstrating in vivo therapeutic effects.

[0139] 3.2.3 The alleviating effect of YX-2-107 on pathological damage in lupus nephritis To evaluate the ameliorative effect of YX-2-107 on lupus nephritis from a histopathological perspective, this study analyzed mouse kidney tissue using HE, PAS, and MASSON staining. The results showed that, compared with the control group, the YX-2-107 administration group exhibited reduced inflammatory cell infiltration in the glomeruli, decreased glomerular mesangial cell proliferation, reduced matrix thickening, decreased glomerular sclerosis and interstitial fibrosis area, and significantly reduced renal pathological damage. Figure 13 This suggests that YX-2-107 can effectively reduce the inflammatory response, cell proliferation, and fibrosis process in the kidneys of MRL / lpr mice, and its protective effect against lupus kidney injury is confirmed from a histomorphological perspective.

[0140] 3.2.4 Inhibitory effect of YX-2-107 on renal plasma cell infiltration To verify the regulatory effect of the drug on plasma cell function in target organs, this embodiment detected CD138 in the kidney by immunofluorescence staining. + IRF4 + The proportion of double-positive cells. Results showed that, compared to the control group, the number of CD138 cells in the kidneys of mice treated with YX-2-107 was significantly higher. + IRF4 + The proportion of double-positive cells was significantly reduced. Figure 14 The above results further confirm that the drug can effectively downregulate IRF4 expression in renal plasma cells and reduce plasma cell infiltration by targeting the binding region of METTL3 protein and IRF4 mRNA, thereby exerting a therapeutic effect.

[0141] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. The use of YX-2-107 or a pharmaceutically acceptable salt thereof in the preparation of medicaments for the prevention and / or treatment of autoimmune diseases.

2. The application according to claim 1, characterized in that, The autoimmune diseases mentioned include systemic lupus erythematosus; Preferably, the autoimmune disease includes lupus nephritis.

3. The application according to claim 2, characterized in that, The YX-2-107 or its pharmaceutically acceptable salt achieves prevention and / or treatment of autoimmune diseases by inhibiting the binding of METTL3 and IRF4.

4. The use of YX-2-107 or a pharmaceutically acceptable salt thereof in the preparation of the product, characterized in that, The product has at least one of the following functions: (1) Targeted binding to METTL3; (2) Inhibit IRF4 expression; (3) Inhibits B cell activation; (4) Inhibit plasmablast differentiation and antibody secretion.

5. The application according to any one of claims 1-4, characterized in that, The pharmaceutically acceptable salts include at least one of the following: metal salts, ammonium salts, salts formed with inorganic acids, salts formed with organic bases, salts formed with organic acids, salts formed with basic amino acids, or salts formed with acidic amino acids.

6. The application according to claim 5, characterized in that, The metal salt includes at least one of alkali metal salts, alkaline earth metal salts, aluminum salts, and zinc salts; Preferably, the alkali metal salt includes at least one selected from potassium salt, sodium salt, and lithium salt; Preferably, the alkaline earth metal salt includes calcium salt and / or magnesium salt.

7. The application according to claim 5, characterized in that, The salts formed with inorganic acids include salts formed with at least one of the following inorganic acids: hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, or phosphoric acid; And / or, the salt formed with the organic acid includes salts formed with at least one of the following organic acids: formic acid, acetic acid, lactic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, or p-toluenesulfonic acid; And / or, the salt formed with the acidic amino acid includes a salt formed with at least one of the following acidic amino acids: aspartic acid or glutamic acid.

8. The application according to claim 5, characterized in that, The salt formed with an organic base includes salts formed with at least one of the following organic bases: triethylamine, ethanolamine, meglumine, or dicyclohexylamine; And / or, the salt formed with the basic amino acid includes a salt formed with at least one of the following basic amino acids: lysine, arginine, or histidine.

9. The application according to any one of claims 6-8, characterized in that, The drug or product also includes pharmaceutically acceptable excipients.

10. The application according to claim 9, characterized in that, The pharmaceutically acceptable excipients include at least one of the following: fillers, binders, disintegrants, lubricants, flavoring agents, colorants, flavor masking agents, pH adjusters, buffers, preservatives, stabilizers, antioxidants, wetting agents, humidity regulators, surfactants, suspending agents, and absorption enhancers.

Images