Application of Ficolin B and its gene therapy drugs in the preparation of drugs for the diagnosis and treatment of sepsis.

Abstract

The application provides an application of Ficolin B and a gene therapy drug thereof in the preparation of a drug for the diagnosis and treatment of sepsis. The application firstly proposes Ficolin B as a recognition protein of LPS, and develops a new application of Ficolin B in the treatment of LPS-induced sepsis, a computer-aided drug screening method and a construction method of an animal model of sepsis disease, thereby providing a new technical idea for drug target discovery and disease intervention, and having a good industrial transformation and clinical practical prospect.

Description

Technical Field

[0001] This invention belongs to the field of medicine, specifically relating to the application of Ficolin B and its gene therapy drugs in the preparation of drugs for the diagnosis and treatment of sepsis. Background Technology

[0002] Sepsis is defined as a dysregulated host response to infection that ultimately leads to life-threatening organ dysfunction. Despite significant advancements in prevention, early identification, and treatment, sepsis remains a leading cause of death and morbidity worldwide.

[0003] Therefore, developing new targets for treating sepsis and screening new drugs have become urgent problems to be solved. Summary of the Invention

[0004] In view of this, in order to overcome the shortcomings of the prior art, the present invention is proposed.

[0005] The first aspect of the present invention provides the use of Ficolin B or its homologues or any one of the above as an accelerator in the preparation of a drug for treating sepsis.

[0006] In this invention, Ficolin B (Fcn B) is an important member of the fibrin family and a pattern recognition molecule that can recognize a variety of ligands, playing an important role in immune response, cell cycle and lung tissue homeostasis.

[0007] In some embodiments, the Ficolin B is mouse-derived, while in other embodiments, the Ficolin B homologs include, but are not limited to, homologs found in humans or non-human mammals.

[0008] In some implementations, the Ficolin B homolog is selected from its human homolog Ficolin-1.

[0009] In some implementations, the sepsis is LPS (lipopolysaccharide) induced sepsis.

[0010] In some implementations, the sepsis is sepsis induced by live bacteria.

[0011] In some implementations, the live bacteria include, but are not limited to, Gram-negative bacilli and anaerobic bacteria.

[0012] In some embodiments, the promoter includes, but is not limited to, substances that promote the expression of Ficolin B or its homologs, substances that improve the stability of Ficolin B or its homolog expression products, and substances that enhance the transcriptional activity of Ficolin B or its homologs.

[0013] In some embodiments, the promoter is selected from substances that promote the expression of Ficolin B or its homologs.

[0014] In some implementations, the substance that promotes the expression of Ficolin B or its homologs includes, but is not limited to, a recombinant vector carrying a gene encoding Ficolin B or its homologs.

[0015] In some implementations, the recombinant vector includes, but is not limited to, plasmid vectors and viral vectors.

[0016] In some implementations, the recombinant vector is selected from viral vectors.

[0017] In some embodiments, the substance that promotes Ficolin B expression is a recombinant adeno-associated virus carrying a gene encoding Ficolin B.

[0018] In some implementations, the recombinant adeno-associated virus includes an AAV capsid.

[0019] In some embodiments, the serotype of the recombinant adeno-associated virus (AAV) capsid is AAV9.

[0020] In some implementations, the recombinant adeno-associated virus also includes ITR.

[0021] In some implementations, the recombinant adeno-associated virus also includes a promoter.

[0022] In some implementations, the promoter is selected from CMV.

[0023] In some implementations, the recombinant adeno-associated virus also includes WPRE.

[0024] In some implementations, the recombinant adeno-associated virus also includes SV40_polyA.

[0025] In some embodiments, the recombinant adeno-associated virus is pAAV-ITR-CMV- Fcnb (mouse,NM_010190)-WPRE-SV40_polyA-ITR.

[0026] In some implementations, the drug is a drug that inhibits pyroptosis.

[0027] In some embodiments, the drug is a drug that inhibits Caspase11-mediated pyroptosis.

[0028] A second aspect of the present invention provides a pharmaceutical composition comprising a therapeutically effective amount of Ficolin B or a homologue thereof or an accelerator of either of the above, and a pharmaceutically acceptable carrier and / or excipient thereof.

[0029] In this invention, the therapeutically effective amount refers to the amount of medicine used that can effectively prevent / treat / improve disease symptoms.

[0030] The pharmaceutical compositions described herein can be administered to subjects using any pharmaceutical dosage form known in the art. Non-limiting examples include non-gastrointestinal dosage forms and gastrointestinal dosage forms.

[0031] In some preferred embodiments, the pharmaceutical composition is selected from non-gastrointestinal dosage forms.

[0032] Furthermore, the non-gastrointestinal dosage forms include, but are not limited to, injectable dosage forms.

[0033] In some embodiments, the pharmaceutically acceptable carrier and / or excipients include, but are not limited to, buffer solutions, diluents, excipients, adjuvants, penetration enhancers, preservatives, and chemical stabilizers.

[0034] A third aspect of the present invention provides the use of a reagent for detecting Ficolin B in the preparation of products for diagnosing sepsis.

[0035] In some embodiments, Ficolin B is mouse-derived, and in other embodiments, Ficolin B also includes its homologs, including but not limited to homologs in humans or other mammals.

[0036] Furthermore, when Ficolin B is derived from mice, the version number of the Ficolin B gene is GRCm39.

[0037] In some implementations, the Ficolin B homolog is selected from its human homolog Ficolin-1.

[0038] Furthermore, the version number corresponding to the Ficolin-1 gene is GRCh38.p14.

[0039] In some implementations, the reagents for detecting Ficolin B include, but are not limited to, reagents for detecting the Ficolin B gene and reagents for detecting the Ficolin B protein.

[0040] In some embodiments, the reagent for detecting Ficolin B protein is a Ficolin B protein binder. The protein binder includes, but is not limited to, antibodies.

[0041] In some implementations, the reagents for detecting the Ficolin B gene include, but are not limited to, primers and probes targeting the Ficolin B gene.

[0042] A fourth aspect of the present invention provides a computer-aided drug screening method based on Ficolin B and LPS, characterized in that the method comprises: Obtain Ficolin B protein data and LPS data; The sequence information and spatial structure of Ficolin B protein and the spatial structure of LPS were selected to determine their binding sites as the binding sites for targeted drugs. Candidate drugs targeting the binding site are obtained by using computer-aided drug screening methods.

[0043] In some implementations, the computer-aided drug screening method comprises the following steps: Obtain the binding site of Ficolin B protein to LPS; Based on information about the binding site and spatial structure of Ficolin B protein to LPS, compounds with similar sequences and structures are screened from molecular databases. The selected compounds are molecularly docked with Ficolin B protein to calculate the binding energy score of the target compounds, and the candidate drugs are obtained by sorting them according to the scores.

[0044] In some embodiments, the compounds include, but are not limited to, protein analogs, antibodies, DNA, and RNA.

[0045] In some implementations, the computer-aided drug screening method comprises the following steps: Obtain the binding site of Ficolin B protein to LPS and the spatial structure of the complex after binding; Based on the binding site of Ficolin B protein to LPS and the spatial structure of the complex after binding, we screened for structurally complementary compounds in molecular databases. The selected compounds were subjected to molecular docking with the complex formed by the binding of Ficolin B protein and LPS. The binding energy score of the target compounds was calculated, and the candidate drugs were obtained by sorting them according to the score.

[0046] In some embodiments, the compounds include, but are not limited to, protein analogs, antibodies, DNA, and RNA.

[0047] The fifth aspect of this invention provides a method for constructing a mouse model of sepsis, the method comprising knocking out mice... Fcnb Genes, induced using LPS.

[0048] In some implementations, the LPS induction is an intraperitoneal injection of LPS.

[0049] In some implementations, the knockout mice Fcnb Genes are generated using CRISPR Cas9 technology.

[0050] In some embodiments, the CRISPR Cas9 is knocked out using sgRNA with nucleotide sequences as shown in SEQ ID NO. 1-2. Fcnb Gene.

[0051] The sixth aspect of the present invention provides any of the following methods: (1) A method for screening drug candidates for the treatment of sepsis, the method comprising: a) Apply the reagent to be screened to septic mice prepared by the construction method described in the fifth aspect of the present invention; b) To test the therapeutic effect of the reagents to be screened on sepsis; (2) A method for evaluating the therapeutic effect of a drug for treating sepsis, the method comprising: a) Administering the drug to septic mice prepared by the construction method described in the fifth aspect of the present invention; b) To test the therapeutic effect of the drug on the sepsis; (3) A method for evaluating the toxicological effects of a drug for treating sepsis, the method comprising: a) Administering the drug to septic mice prepared by the construction method described in the fifth aspect of the present invention; b) To detect the toxicological effects of the drug on the mice; (4) A method for studying the pathogenesis of sepsis, wherein the method is to use sepsis mice prepared by the construction method described in the fifth aspect of the present invention to study the pathogenesis of sepsis.

[0052] The seventh aspect of the present invention provides any of the following applications: (1) The application of the sepsis mouse model prepared by the construction method described in the fifth aspect of the present invention in screening drug candidates for the treatment of sepsis; (2) The application of the sepsis mouse model prepared by the construction method described in the fifth aspect of the present invention in evaluating the therapeutic effect of drugs for treating sepsis; (3) The application of the sepsis mouse model prepared by the construction method described in the fifth aspect of the present invention in evaluating the toxicological effects of drugs for treating sepsis; (4) The application of the sepsis mouse model prepared by the construction method described in the fifth aspect of the present invention in the study of the pathogenesis of sepsis.

[0053] The advantages and beneficial effects of this invention are as follows: This invention provides the application of Ficolin B and its gene therapy drugs in the preparation of drugs for the diagnosis and treatment of sepsis. This invention is the first to propose using Ficolin B as a recognition protein for LPS, and based on this, to develop new applications for the treatment of LPS-induced sepsis, computer-aided drug screening methods, and methods for constructing animal models of sepsis. This provides new technical ideas for drug target discovery and disease intervention, and has good prospects for industrial transformation and clinical application. Attached Figure Description

[0054] Figure 1 The COIP immunoprecipitate obtained after lysing mouse bone marrow-derived neutrophils, incubating the lysate with biotinylated LPS and streptomycin-avidin magnetic beads, and performing LC-MS analysis revealed the presence of Fcn B. The streptomycin-avidin magnetic beads can bind to biotinylated LPS; the identification of Fcn B confirms that Fcn B can bind to LPS. Figure 2 The results of the experiment were obtained by lysing HEK293T cells overexpressing Fcn B, incubating the lysate with biotinylated LPS and streptomycin-avidin magnetic beads, and performing LC-MS on the resulting COIP immunoprecipitate to identify Fcn B. Figure 3 This is a diagram showing the co-localization of Fcn B with LPS in OMV-stimulated neutrophils; Figure 4 This is a diagram showing the co-localization of FcnB and LPS in HEK293T cells overexpressing FcnB. Figure 5 The results are as follows: mouse bone marrow-derived neutrophils are lysed, and the lysate is incubated with biotinylated LPS and streptomycin-avidin magnetic beads. Then, the unbound portions are washed away, the magnetic beads are boiled off, and Western blotting is performed. The results are detected with the primary antibody Fcn B. If there is a band, it proves that Fcn binds to LPS. Figure 6 This is a graph showing the experimental results of purified mouse Fcn B protein binding to LPS; Figure 7 This is a graph showing the experimental results of human Fcn1 protein binding to LPS; Figure 8 This is a diagram showing the results of the SPR experiment confirming the direct interaction between Fcn 1 and LPS; Figure 9 This is a diagram showing the results of a cell death experiment; Figure 10 This is a graph showing the experimental results of the cutting levels of Caspase 11 and GSDMD; Figure 11This is a graph showing the experimental results of Fcn B competing with Caspase11 for LPS binding; Figure 12 This is a graph showing the experimental results of Fcn B inhibiting the formation of Caspase11 aggregates in the presence of LPS; Figure 13 yes Fcnb Figure showing experimental results of KO significantly reducing the survival rate of mice with LPS-induced sepsis; Figure 14 yes Fcnb Figure showing the experimental results of inflammatory cell infiltration after KO; Figure 15 It is AAV9- Fcnb plasmid map; Figure 16 It is AAV9- Fcnb Figure showing experimental results for treating LPS-induced sepsis; Figure 17 The values ​​show the content and expression levels of Fcn1 in peripheral blood serum of patients with different SOFA scores and healthy individuals. The red box indicates deceased patients. Figure 18 It refers to the content and expression level of Fcn1 in total blood cells of patients with different SOFA scores and healthy individuals. Detailed Implementation

[0055] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.

[0056] Example 1: Ficolin B (Fcn B) combined with LPS To identify the cytoplasmic protein that binds to LPS, mouse bone marrow-derived neutrophils were lysed (lysate: Beyotime P0013J). Biotin-labeled LPS (Invivogen, tlrl-omv-1) was then incubated with streptavidin-coated magnetic beads (MCE, HY-K0208). The COIP immunoprecipitate was analyzed by liquid chromatography-mass spectrometry (LC-MS), and Fcn B was detected. Figure 1 To further verify this result, we analyzed the overexpression... Fcn b Immunoprecipitate of biotin-labeled LPS in HEK293T cell lysate was analyzed by LC-MS, and Fcn B was also detected. Figure 2 ).

[0057] We then used confocal microscopy to investigate its intracellular binding with LPS. The results showed that Fcn B (antibody abcam, ab70814) co-localized with LPS (antibody ab35654) in OMV (Invivogen, tlrl-omv-1)-stimulated neutrophils. Figure 3 Furthermore, in HEK293T cells overexpressing Fcn B, co-localization of Fcn B and LPS was also observed after transfection with biotin-labeled LPS using DOTAP (Selleck, S6908). Figure 4 To determine whether Fcn B directly interacts with LPS, we first lysed mouse bone marrow-derived neutrophils, incubated Biotin-LPS with lysis buffer and streptomycin-avidin magnetic beads, and the COIP experiment confirmed the interaction between the two. Figure 5 Subsequently, the GST-tagged Fcn B protein was purified. A pull-down assay was performed using the purified GST-tagged Fcn B and its human homologue Fcn 1 (R&D Corporation, 4209-FC-050) with biotinylated LPS. The results showed that biotinylated LPS could precipitate recombinant purified mouse Fcn B and human Fcn 1 in the pull-down assay, further demonstrating that Fcn B / 1 can directly bind to LPS. Figure 6 7). Further analysis using SPR experiments (anchoring the purified Fcn1 protein on a chip, with biotinylated LPS as the mobile phase) also confirmed the direct interaction between Fcn1 and LPS. Figure 8 ).

[0058] Example 2: Intracellular Fcn B binds to intracellular LPS to inhibit Caspase 11 activation. Given that intracellular Caspase 11 can be activated by recognizing intracellular LPS, thereby activating GSDMD to induce pyroptosis and promote IL-1β secretion, we investigated whether Fcn B is involved in the activation of non-classical inflammasomes. We induced Fcn B with Pam3csk4 (Invivogen, tlrl-pms) followed by OMV stimulation, activating Fcn B from wild-type and... FcnbNon-classical inflammasomes were observed in primary BMDM cells from knockout mice. Results showed that intracytoplasmic LPS delivery induced cell death, and Fcn B deficiency resulted in a significantly higher proportion of cell death compared to wild-type cells. This increased cell death could be reversed by the GSDMD inhibitors dithiocarbamate (DSF, Selleck, S1680) (which blocks GSDMD pore formation) and 2-BP (a palmitoylation inhibitor, MCE, HY-111770). Figure 9 This demonstrates that Fcn B can inhibit GSDMD-mediated pyroptosis.

[0059] To further determine whether Fcn B directly inhibits Caspase 11-mediated pyroptosis, we evaluated the levels of active lysed fragments of Caspase 11 (antibody abcam, ab180673) and GSDMD (antibody CST, 39754) in cell lysates. With prolonged OMV-induced intracellular LPS stimulation time, the levels of active lysed fragments in wild-type and... Fcnb In primary bone marrow macrophages (BMDM) from KO mice, both Caspase11 and GSDMD are cleaved; however, in Fcnb In KO BMDM, the catalytically active Caspase-11 p26 and the pore-forming GSDMD-NT fragments are generated in greater quantities and appear earlier. Figure 10 ).

[0060] We also transfected HEK293T cells with a HA-tagged Caspase11 plasmid and a Flag-tagged Fcn B plasmid using Lipo3000 (Invitrogen, L3000015). After cell lysis, the cells were incubated with biotinylated LPS and streptomycin-avidin magnetic beads. COIP experiments showed that the more Fcn B cells there were, the less Caspase11 cells there were, demonstrating that the two cells competitively bind to LPS. Figure 11 Furthermore, non-denaturing gel assays revealed that, in the presence of LPS, Fcn B inhibited the formation of Caspase 11 aggregates. Figure 12 ).

[0061] Example 3 Fcnb Treatment of LPS intraperitoneal injection-induced disease Given that Fcn B is primarily expressed intracellularly and competes with LPS for binding, we further investigated... Fcnb In vivo effects in a mouse model of LPS-induced acute septic shock.

[0062] First, CRISPR Cas9 technology was used to build... FcnbThe KO mice were specifically used, and the sgRNA sequences used are shown in SEQ ID NO.1 and SEQ ID NO.2: SEQ ID NO.1: GGGATATTACTCCTAAGCACAGG SEQ ID NO. 2: TGTGAGAGAGCACACGTTGAAGG.

[0063] Build Fcnb After successful knockout of mice, they were administered 10 mg / kg LPS (Sigma-Aldrich, L2630) via intraperitoneal injection. Compared to wild-type mice, Fcnb KO significantly reduced mouse survival rate ( Figure 13 Furthermore, lung H&E staining results showed increased inflammatory cell infiltration after KO ( ), Figure 14 Using AAV9- Fcnb (pAAV-ITR-CMV-) Fcnb (mouse,NM_010190)-WPRE-SV40_polyA-ITR, plasmid map can be found here. Figure 15 Treatment of KO mice: AAV9- Fcnb The viral stock solution titer was 4.367e+13vg / mL. Before use, 2.3 μL of the viral stock solution was diluted with physiological saline to 100 μL. The entire 100 μL solution was then injected intravenously into KO mice for treatment. Treatment increased the survival rate of KO mice. Figure 16 The control vector is pAAV-ITR-CMV-MCS-P2A-EGFP-WPRE-SV40_polyA-ITR.

[0064] Example 4: Detection of Fcn1 content in human samples The levels and expression of Fcn1 in peripheral blood serum of patients with different SOFA scores of sepsis and healthy individuals were detected using an Fcn1 detection kit (abcam, ab213777). The levels and expression of Fcn1 in whole blood leukocytes of patients with different SOFA scores of sepsis and healthy individuals were detected using qRT-pCR. The results are as follows: Figure 17 and Figure 18 As shown.

[0065] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. The use of Ficolin B or its homologues or any one of the above as an accelerator in the preparation of drugs for treating sepsis; Preferably, the sepsis is LPS-induced sepsis; Preferably, the Ficolin B homolog includes the human homolog Ficolin-1.

2. The application according to claim 1, characterized in that, The promoter is selected from substances that promote the expression of Ficolin B or its homologs; Preferably, the substance that promotes the expression of Ficolin B or its homologs includes a recombinant vector carrying the gene of Ficolin B or its homologs; Preferably, the recombinant vector is pAAV-ITR-CMV- Fcnb (mouse,NM_010190)-WPRE-SV40_polyA-ITR.

3. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a therapeutically effective amount of Ficolin B or its homologue or an accelerator of either of the above, and a pharmaceutically acceptable carrier and / or excipient thereof. Preferably, the dosage form of the pharmaceutical composition is selected from injectable formulations.

4. Application of reagents for detecting Ficolin B in the preparation of products for diagnosing sepsis; Preferably, the reagent for detecting Ficolin B is selected from Ficolin B protein binders.

5. A computer-aided drug screening method based on Ficolin B and LPS, characterized in that, The method includes: Obtain Ficolin B protein data and LPS data; The sequence information and spatial structure of Ficolin B protein and the spatial structure of LPS were selected to determine their binding sites as the binding sites for targeted drugs. Candidate drugs targeting the binding site are obtained by using computer-aided drug screening methods.

6. The computer-aided drug screening method according to claim 5, characterized in that, The process of the computer-aided drug screening method is as follows: Obtain the binding site of Ficolin B protein to LPS; Based on information about the binding site and spatial structure of Ficolin B protein to LPS, compounds with similar sequences and structures are screened from molecular databases. The selected compounds were subjected to molecular docking with Ficolin B protein to calculate the binding energy score of the target compounds, and the candidate drugs were obtained by sorting them according to the score. Preferably, the compound includes protein analogs, antibodies, DNA, and RNA.

7. The computer-aided drug screening method according to claim 5, characterized in that, The process of the computer-aided drug screening method is as follows: Obtain the binding site of Ficolin B protein to LPS and the spatial structure of the complex after binding; Based on the binding site of Ficolin B protein to LPS and the spatial structure of the complex after binding, we screened for structurally complementary compounds in molecular databases. The selected compounds were subjected to molecular docking with the complex formed by the binding of Ficolin B protein and LPS. The binding energy score of the target compounds was calculated, and the candidate drugs were obtained by sorting them according to the score. Preferably, the compound includes protein analogs, antibodies, DNA, and RNA.

8. A method for constructing a mouse model of sepsis, characterized in that, The construction method includes knockout mice. Fcnb Genes, induced using LPS; Preferably, the LPS induction is performed by intraperitoneal injection of LPS; Preferably, the knockout mouse Fcnb Genes are generated using CRISPR Cas9 technology; Preferably, the CRISPR Cas9 is knocked out using sgRNA with nucleotide sequences as shown in SEQ ID NO. 1-2. Fcnb Gene.

9. Any one of the following methods: (1) A method for screening drug candidates for the treatment of sepsis, characterized in that, The method includes: a) Apply the reagent to be screened to septic mice prepared by the construction method of claim 8; b) To test the therapeutic effect of the reagents to be screened on sepsis; (2) A method for evaluating the therapeutic effect of a drug for treating sepsis, characterized in that the method comprises: a) Administering the drug to septic mice prepared by the construction method of claim 8; b) To test the therapeutic effect of the drug on the sepsis; (3) A method for evaluating the toxicological effects of a drug for treating sepsis, characterized in that the method comprises: a) Administering the drug to septic mice prepared by the construction method of claim 8; b) To detect the toxicological effects of the drug on the mice; (4) A method for studying the pathogenesis of sepsis, characterized in that the method uses sepsis mice prepared by the construction method described in claim 8 to study the pathogenesis of sepsis.

10. Any of the following applications: (1) The application of the sepsis mouse model prepared by the construction method of claim 8 in screening drug candidates for the treatment of sepsis; (2) The application of the sepsis mouse model prepared by the construction method of claim 8 in evaluating the therapeutic effect of drugs for treating sepsis; (3) The application of the sepsis mouse model prepared by the construction method of claim 8 in evaluating the toxicological effects of drugs for treating sepsis; (4) The application of the sepsis mouse model prepared by the construction method described in claim 8 in the study of the pathogenesis of sepsis.

Images