Use of apolipoprotein m in the preparation of a medicament for treating metabolic dysfunction-associated fatty liver disease

Abstract

The application discloses application of apolipoprotein M in preparation of a medicine for treating metabolic dysfunction related fatty liver disease, and the apolipoprotein M is used for preparing a medicine for activating a liver PPAR alpha signal path and improving liver lipid metabolism; the apolipoprotein M is any one of mature ApoM protein expressed in liver cells, a nucleic acid molecule coding ApoM, or a liver cell specific adeno-associated virus carrier carrying an ApoM coding gene. The apolipoprotein M is a natural expression protein of human liver, has no strong toxic side effect, simultaneously regulates five pathological links of liver lipid metabolism disorder, liver damage, inflammation, liver fibrosis and sugar metabolism disorder, adopts a TBG liver cell specific promoter, only liver cells express ApoM, and systemic lipoprotein disorder is avoided, it is first confirmed that an ApoM-PPAR alpha regulation axis is a metabolic dysfunction related fatty liver disease protection core path, complete transcriptome, protein and histological evidence are provided, and a technical scheme can be repeated.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of apolipoprotein M (ApoM) in the preparation of drugs for treating fatty liver disease related to metabolic dysfunction. Background Technology

[0002] Metabolic dysfunction-associated fatty liver disease (MASLD) has a global prevalence exceeding 25%. Its pathological progression progresses from simple hepatic steatosis to metabolic-associated steatohepatitis (MASH), liver fibrosis, cirrhosis, and liver cancer, with a lack of approved specific treatments. Insulin resistance and fatty acid metabolism disorders leading to hepatic lipid accumulation are the core initiating factors in MASLD pathogenesis. Sustained metabolic stress further activates inflammatory signals, revitalizes hepatic stellate cells, and promotes extracellular matrix deposition and liver fibrosis. While the pathogenesis of MASLD has been somewhat understood, the complete molecular pathways driving disease progression remain unclear, and clinically effective therapeutic targets are severely lacking.

[0003] Hepatic lipid accumulation and inhibition of the peroxisome proliferator-activated receptor (PPARα) pathway are the core pathogenic mechanisms. PPARα is a core nuclear receptor that regulates fatty acid β-oxidation in hepatocytes and inhibits inflammatory fibrosis. Its downregulation directly promotes the progression of MASLD.

[0004] Existing PPARα agonists suffer from systemic side effects and poor targeting; there are currently no therapeutic drugs for MASLD targeting hepatocyte-derived apolipoprotein M (ApoM). Previous studies have only found that ApoM participates in the transport of high-density lipoprotein (HDL) cholesterol throughout the body, but have not revealed the regulatory function of hepatocyte-derived ApoM on the hepatic PPARα pathway and local lipid homeostasis, nor have they disclosed the technical scheme for using ApoM to prepare therapeutic drugs for MASLD. Summary of the Invention

[0005] The present invention addresses the following technical problems: (1) MASLD drugs have a single target, insufficient targeting, and lack endogenous regulatory molecules that simultaneously regulate lipid metabolism, inflammation, and fibrosis; (2) the complete pharmacological mechanism by which endogenous ApoM in hepatocytes improves fatty liver through the PPARα pathway is not disclosed, and there is a lack of liver disease drugs with ApoM as the active ingredient. The purpose of this invention is to provide an application of apolipoprotein M in the preparation of drugs for treating fatty liver disease related to metabolic dysfunction.

[0006] To achieve the above objectives, the present invention provides the following technical solution: This invention provides the application of apolipoprotein M in the preparation of a drug for treating fatty liver disease related to metabolic dysfunction, wherein the apolipoprotein M is used to prepare a drug that activates the hepatic PPARα signaling pathway and improves hepatic lipid metabolism; The apolipoprotein M is any one of the following: mature ApoM protein specifically expressed by hepatocytes, nucleic acid molecule encoding ApoM, or hepatocyte-specific adeno-associated virus vector carrying the ApoM encoding gene.

[0007] In a preferred embodiment, the hepatocyte-specific adeno-associated virus vector is an AAV8 vector, which carries the TBG hepatocyte-specific promoter to drive the expression of the ApoM-encoded gene.

[0008] A preferred embodiment, the amino acid sequence of the mature ApoM protein is: Met Phe His Gln Val Trp Ala Ala Leu Leu Ser Leu Tyr Gly Leu Leu Phe Asn Ser Met Asn Gln Cys Pro Glu His Ser Gln Leu Thr Ala Leu Gly Met Asp Asp Thr Glu Thr Pro Glu Pro His Leu Gly Leu Trp Tyr Phe Ile Ala Gly Ala Ala Ser Thr Thr Glu Glu Leu Ala Thr Phe Asp Pro Val Asp Asn Ile Val Phe Asn Met Ala Ala Gly Ser Ala Pro Arg Gln Leu Gln Leu Arg Ala Thr Ile Arg Thr Lys Ser Gly Val Cys Val Pro Arg Lys Trp Tyr Tyr Arg Leu Thr Glu Gly Lys Gly Asn Met Glu Leu Arg Thr Glu Gly Arg Pro Asp Met Lys Thr Asp Leu Phe Ser Ser Ser Cys Pro Gly Gly Ile Met Leu Lys Glu Thr Gly Gln Gly Tyr Gln Arg Phe Leu Leu Tyr Asn Arg Ser Pro His Pro Pro Glu Lys Cys Val Glu Glu Phe Gln Ser Leu Thr Ser Cys Leu Asp Phe Lys Ala Phe Leu Val Thr Pro Arg Asn Gln Glu Ala Cys Pro Leu Ser Ser Lys (MFHQVWAALL SLYGLLFNSMNQCPEHSQLT ALGMDDETPE PHLGLWYFI AGAASTTEEL ATFDPVDNIV FNMAAGSAPR QLQLRATIRTKSGVCVPRKW TYRLTEGKGN MELRTEGRPD MKTDLFSSSC PGGIMLKETG QGYQRFLLYN RSPHPPEKCVEEFQSLTSCL DFKAFLVTPR NQEACPLSSK).

[0009] In a preferred embodiment, the nucleic acid molecule encoding ApoM is a cDNA sequence encoding ApoM, and its nucleotide sequence is SEQ ID NO. 1.

[0010] In a preferred embodiment, the nucleotide sequence of the ApoM encoding gene is SEQ ID NO. 2.

[0011] In a preferred embodiment, the dosage form of the drug is any one of an injection, a lyophilized preparation, a liposome preparation, or a gene therapy preparation.

[0012] In a preferred embodiment, the drug further comprises a pharmaceutically acceptable carrier, diluent, or adjuvant.

[0013] The present invention also provides a hepatocyte-targeted gene therapy formulation, the active component of which is AAV8-TBG-ApoM viral particles, and the pharmaceutical excipient is sterile physiological saline.

[0014] The core pharmacological mechanism of the drug: After upregulation of hepatocyte apolipoprotein M (ApoM), it significantly increases the transcription and protein levels of PPARα, activates downstream fatty acid oxidation genes, and reduces the accumulation of lipotoxic lipids in hepatocytes; at the same time, it inhibits the expression of pro-inflammatory and pro-fibrotic genes, blocking the progression of steatosis to inflammation and fibrosis.

[0015] The beneficial effects of the technical solution of this invention: 1. Apolipoprotein M is a naturally expressed protein in the human liver, with no strong toxic side effects, unlike the adverse reactions of chemically synthesized PPAR agonists; 2. As a candidate therapeutic target for metabolic dysfunction-related fatty liver disease, ApoM, as a single target, simultaneously regulates five pathological processes in the liver: lipid metabolism disorder, hepatocyte damage, inflammation, liver fibrosis, and glucose metabolism disorder, which is superior to single-pathway drugs. 3. Using the TBG hepatocyte-specific promoter, ApoM is expressed only in hepatocytes, avoiding systemic lipoprotein disorders; 4. This study is the first to confirm that the ApoM-PPARα regulatory axis is a core protective pathway against fatty liver disease associated with metabolic dysfunction, providing complete transcriptomic, proteomic, and histological evidence. The technical approach is reproducible. Attached Figure Description

[0016] Figure 1This is a graph showing the screening of differentially expressed genes and the expression analysis of candidate proteins related to MASLD. Specifically, A is a volcano plot of differentially expressed genes between the NAFLD group and the healthy control group in the GSE61260 dataset; B is a volcano plot of differentially expressed genes between the high-fat diet group (HFD) and the low-fat diet group (LFD) in the GSE24031 dataset; C is a Venn plot of upregulated and downregulated differentially expressed genes in both the GSE61260 and GSE24031 datasets, with ApoM and LEPR being commonly downregulated genes; and D is a comparison of plasma ApoM and LEPR protein abundance between the mild fibrosis group and the advanced fibrosis group.

[0017] Figure 2 The images show the results of ApoM expression level detection in different MASLD models and MASLD patients. A shows the gross morphology of the livers of mice in the normal diet group (chow) and the high-fat diet group (HFD); B shows the H&E staining and Oil Red O staining of liver tissues from mice in the chow and HFD groups; C shows the relative expression level of ApoM mRNA in primary hepatocytes from mice in the chow and HFD groups; D shows the gross morphology of the livers of mice in the normal control diet group (NCD) and the methionine-choline deficient diet group (MCD); E shows the H&E staining and Oil Red O staining of liver tissues from mice in the NCD and MCD groups; F shows the relative expression level of ApoM mRNA in primary hepatocytes from mice in the NCD and MCD groups; G shows the Western blot detection and quantitative analysis results of ApoM protein in primary hepatocytes from mice in the chow and HFD groups; H shows the Western blot analysis results of ApoM protein in primary hepatocytes from mice in the NCD and MCD groups. Figure 1 shows the results of blot detection and quantitative analysis; Figure 2 shows the H&E staining and Sirius red staining of liver tissues from healthy controls and MASLD patients; Figure 3 shows the results of relative expression of ApoM mRNA in liver tissues from healthy controls and MASLD patients; Figure 4 shows the results of Western blot detection and quantitative analysis of ApoM protein in liver tissues from healthy controls and MASLD patients.

[0018] Figure 3 This image shows the results of ApoM protein expression detection in a free fatty acid (FFA)-induced hepatocyte lipid accumulation model. In the image, A represents the Western blot results of ApoM protein in AML12 cells treated with 0.5% BSA or oleic acid / palmitic acid (OA / PA), with β-actin as the internal reference protein; B represents the quantitative analysis results of the relative expression level of ApoM protein.

[0019] Figure 4Figure 1 shows the construction and validation results of hepatocyte-specific ApoM knockout mice. A is a schematic diagram of the ApoM conditional knockout allele construction and Cre recombination process; B is the ApoM genotype PCR identification result; C is the detection result of the relative expression level of ApoM mRNA in the liver, heart, kidney, lung, and spleen of ApoM-Flox mice and hepatocyte-specific ApoM knockout mice (ApoM-HKO); D is the detection result of the relative expression level of ApoM mRNA in primary hepatocytes of ApoM-Flox and ApoM-HKO mice under Chow and HFD conditions; E is the Western blot detection result of ApoM protein in primary hepatocytes of each group of mice under Chow and HFD conditions; F is the quantitative analysis result of the relative expression level of ApoM protein in Figure E; G is the detection result of the relative expression level of ApoM mRNA in primary hepatocytes of ApoM-Flox and ApoM-HKO mice under NCD and MCD conditions; H is the Western blot result of ApoM protein in liver tissue of each group of mice under NCD and MCD conditions. Figure 1 shows the results of blot detection; Figure 2 shows the quantitative analysis results of the relative expression level of ApoM protein in Figure 3H.

[0020] Figure 5This image shows the metabolic and liver phenotype analysis of hepatocyte-specific ApoM knockout mice under a high-fat diet. A represents a schematic diagram of the high-fat diet modeling and tissue sampling process for ApoM-Flox and ApoM-HKO mice; B represents the gross morphology of the livers of ApoM-Flox and ApoM-HKO mice under chow and HFD conditions; C represents the body weight of mice in each group; D represents the serum triglyceride (TG) level of mice in each group; E represents the serum total cholesterol (TC) level of mice in each group; F represents the serum low-density lipoprotein (LDL) level of mice in each group; G represents the serum high-density lipoprotein (HDL) level of mice in each group; H represents the TG content in liver tissue of mice in each group; I represents the TC content in liver tissue of mice in each group; J represents the serum alanine aminotransferase (ALT) level of mice in each group; K represents the... Figure 1 shows the results of serum aspartate aminotransferase (AST) levels in mice from each group; Figure 2 shows the results of H&E staining, Oil Red O staining, Masson staining, and Sirius Red staining in liver tissue of mice from each group; Figure 3 shows the results of relative mRNA expression levels of lipid synthesis-related genes Srebp-1c, Fasn, and Acc in liver tissue of mice from each group; Figure 4 shows the results of relative mRNA expression levels of inflammation-related genes Il-6, TNF-α, and Il-1β in liver tissue of mice from each group; Figure 5 shows the results of relative mRNA expression levels of fibrosis-related genes Col1a1, Tgfβ, and α-Sma in liver tissue of mice from each group; Figure 6 shows the results of glucose tolerance test (GTT) and area under the curve analysis in mice from each group; Figure 7 shows the results of insulin tolerance test (ITT) and area under the curve analysis in mice from each group.

[0021] Figure 6This image shows the metabolic and liver phenotype analysis of hepatocyte-specific ApoM knockout mice under MCD diet conditions. A is a schematic diagram of the MCD diet modeling and tissue sampling process for ApoM-Flox and ApoM-HKO mice; B is a gross morphological image of the livers of ApoM-Flox and ApoM-HKO mice under NCD and MCD conditions; C shows the mouse body weight results for each group; D shows the serum TG level results for each group; E shows the serum TC level results for each group; F shows the serum LDL level results for each group; G shows the serum HDL level results for each group; H shows the liver tissue TG content results for each group; I shows the liver tissue TC content results for each group; J shows the serum ALT level results for each group. The results are shown in Figure 1; K represents the serum AST level detection results of each group of mice; L represents the H&E staining, Oil Red O staining, Masson staining, and Sirius Red staining results of each group of mice's liver tissue; M represents the relative mRNA expression levels of Srebp-1c, Fasn, and Acc in each group of mice's liver tissue; N represents the relative mRNA expression levels of Il-6, TNF-α, and Il-1β in each group of mice's liver tissue; O represents the relative mRNA expression levels of Col1a1, Tgfβ, and α-Sma in each group of mice's liver tissue; P represents the GTT and area under the curve analysis results of each group of mice; Q represents the ITT and area under the curve analysis results of each group of mice.

[0022] Figure 7 Figure 1 shows the construction and validation of the AAV-mediated liver ApoM overexpression vector. A is a schematic diagram of the AAV vector for ApoM overexpression; B shows the EGFP fluorescence detection results of liver tissue from mice in the AAV-EGFP and AAV-ApoM groups under HFD conditions; C shows the relative expression levels of ApoM mRNA in primary hepatocytes of the two groups of mice under HFD conditions; D shows the Western blot detection results of ApoM protein in primary hepatocytes of the two groups of mice under HFD conditions; E shows the quantitative analysis results of the relative expression level of ApoM protein in Figure D; F shows the EGFP fluorescence detection results of liver tissue from mice in the AAV-EGFP and AAV-ApoM groups under MCD conditions; G shows the relative expression levels of ApoM mRNA in primary hepatocytes of the two groups of mice under MCD conditions; H shows the Western blot detection results of ApoM protein in primary hepatocytes of the two groups of mice under MCD conditions; and I shows the quantitative analysis results of the relative expression level of ApoM protein in Figure H.

[0023] Figure 8This image shows the metabolic and liver phenotype analysis of HFD model mice after AAV-mediated ApoM overexpression. Figure A shows the schematic diagram of AAV8-TBG-EGFP or AAV8-TBG-ApoM administration and tissue sampling analysis in HFD model mice; Figure B shows the weight of mice in both groups; Figure C shows the gross morphology of the livers of mice in both groups; Figure D shows the serum TG level of mice in both groups; Figure E shows the serum TC level of mice in both groups; Figure F shows the serum LDL level of mice in both groups; Figure G shows the serum HDL level of mice in both groups; Figure H shows the TG content in liver tissue of mice in both groups; Figure I shows the TC content in liver tissue of mice in both groups; Figure J shows the serum ALT level of mice in both groups; Figure K shows the serum... Figure 1 shows the results of AST level detection; L shows the results of H&E staining, Oil Red O staining, Masson staining, and Sirius Red staining of liver tissue in the two groups of mice; M shows the results of relative mRNA expression levels of Srebp-1c, Fasn, and Acc in liver tissue in the two groups of mice; N shows the results of relative mRNA expression levels of Il-6, TNF-α, and Il-1β in liver tissue in the two groups of mice; O shows the results of relative mRNA expression levels of Col1a1, Tgfβ, and α-Sma in liver tissue in the two groups of mice; P shows the results of GTT and area under the curve analysis in the two groups of mice; Q shows the results of ITT and area under the curve analysis in the two groups of mice.

[0024] Figure 9 This image shows the metabolic and liver phenotype analysis of MCD model mice after AAV-mediated ApoM overexpression. Figure A shows the schematic diagram of AAV8-TBG-EGFP or AAV8-TBG-ApoM administration and tissue sampling analysis in MCD model mice; Figure B shows the weight of mice in both groups; Figure C shows the gross morphology of the livers of mice in both groups; Figure D shows the serum TG level of mice in both groups; Figure E shows the serum TC level of mice in both groups; Figure F shows the serum LDL level of mice in both groups; Figure G shows the serum HDL level of mice in both groups; Figure H shows the TG content in liver tissue of mice in both groups; Figure I shows the TC content in liver tissue of mice in both groups; Figure J shows the serum ALT level of mice in both groups; Figure K shows the serum... Figure 1 shows the results of AST level detection; L shows the results of H&E staining, Oil Red O staining, Masson staining, and Sirius Red staining of liver tissue in the two groups of mice; M shows the results of relative mRNA expression levels of Srebp-1c, Fasn, and Acc in liver tissue in the two groups of mice; N shows the results of relative mRNA expression levels of Il-6, TNF-α, and Il-1β in liver tissue in the two groups of mice; O shows the results of relative mRNA expression levels of Col1a1, Tgfβ, and α-Sma in liver tissue in the two groups of mice; P shows the results of GTT and area under the curve analysis in the two groups of mice; Q shows the results of ITT and area under the curve analysis in the two groups of mice.

[0025] Figure 10 This image shows the liver single-cell transcriptome sequencing and ApoM expression characteristics analysis of hepatocyte-specific ApoM knockout mice. A represents the t-SNE clustering and annotation results of major cell types in liver single cells, including hepatocytes, hepatic stellate cells, endothelial cells, bile duct cells, and immune cells. B is a bubble chart showing the expression of characteristic marker genes for different cell types. C shows the proportion of various liver cell types in different treatment groups. D is a bubble chart showing the ApoM expression level and the proportion of expressing cells in various liver cell types in different treatment groups. E shows the KEGG pathway enrichment analysis results for upregulated and downregulated differentially expressed genes in hepatocytes, with downregulated differentially expressed genes enriched through pathways including PPAR signaling, fatty acid metabolism, and fatty acid degradation.

[0026] Figure 11Figure 1 shows the results of detecting the regulatory effects of ApoM on the PPARα signaling pathway and the expression of fatty acid metabolism-related genes in the liver. Figure 2 shows the relative mRNA expression levels of PPARα and its downstream fatty acid metabolism-related genes Acox1, Cpt1a, Fapp1, and Angpt14 in primary hepatocytes of ApoM-Flox and ApoM-HKO mice under Chow and HFD conditions. Figure 3 shows the Western blot results of PPARα and Cpt1a proteins in primary hepatocytes of mice in each group under Chow and HFD conditions. Figure 4 shows the quantitative analysis results of the relative expression levels of PPARα protein in Figure 3. Figure 5 shows the quantitative analysis results of the relative expression levels of Cpt1a protein in Figure 3. Figure 6 shows the relative mRNA expression levels of PPARα, Acox1, Cpt1a, Fapp1, and Angpt14 in primary hepatocytes of ApoM-Flox and ApoM-HKO mice under NCD and MCD conditions. Figure 7 shows the Western blot results of PPARα and Cpt1a proteins in primary hepatocytes of mice in each group under NCD and MCD conditions. Figure 1 shows the results of blot detection; Figure 2 shows the quantitative analysis results of the relative expression level of PPARα protein in Figure 3; Figure 3 shows the quantitative analysis results of the relative expression level of Cpt1a protein in Figure 3; Figure 4 shows the results of the detection of the relative expression levels of PPARα, Acox1, Cpt1a, Fapp1, and Angpt14 mRNA in primary hepatocytes of mice in the AAV-EGFP and AAV-ApoM groups under HFD conditions; Figure 5 shows the results of the detection of the relative expression levels of PPARα, Acox1, Cpt1a, Fapp1, and Angpt14 mRNA in primary hepatocytes of mice in the AAV-EGFP and AAV-ApoM groups under MCD conditions; Figure 6 shows the results of the detection of the relative expression levels of PPARα, Acox1, Cpt1a, Fapp1, and Angpt14 mRNA in primary hepatocytes of mice in the AAV-EGFP and AAV-ApoM groups under HFD conditions; Figure 7 shows the results of the detection of PPARα and Cpt1a proteins in primary hepatocytes of mice in the AAV-EGFP and AAV-ApoM groups under MCD conditions. Detailed Implementation

[0027] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0028] Unless otherwise specified, the test materials used in this invention are all conventional methods, and the raw materials are all obtainable from publicly available commercial sources unless otherwise specified.

[0029] The following description, through specific embodiments and accompanying drawings, provides further details. Example 1: Screening and expression validation of ApoM as a candidate therapeutic target for metabolic dysfunction-related fatty liver disease;

[0030] 1. Bioinformatics Screening. Differential expression analyses were performed on the NAFLD group and healthy control group in the GSE61260 dataset, and on the high-fat diet group (HFD) and low-fat diet group (LFD) in the GSE24031 dataset. The intersection of upregulated and downregulated differentially expressed genes in the two datasets was then analyzed. Results are as follows: Figure 1 As shown in AC, ApoM and LEPR are candidate genes that are downregulated in both datasets; comparing the plasma protein abundance of the mild fibrosis group and the advanced fibrosis group, the abundance of ApoM protein in the advanced fibrosis group was further reduced. Figure 1 (D) suggests that decreased ApoM expression is associated with disease progression.

[0031] 2. Expression validation in animal, patient tissue, and cell models. HFD-induced MASLD mouse models and MCD-induced MASH mouse models were established; liver tissues from healthy controls and MASLD patients were compared. Hepatic steatosis and fibrosis were evaluated using H&E, Oil Red O, and Sirius Red staining, and ApoM expression was detected using qRT-PCR and Western blot. AML12 cells treated with 0.5% BSA served as a control, while AML12 cells treated with oleic acid / palmitic acid (OA / PA) were used to establish a cell model. Results are as follows: Figure 2 and Figure 3 As shown, the mRNA or protein levels of ApoM were reduced in liver tissues of HFD and MCD mice, liver tissues of MASLD patients, and AML12 cells treated with OA / PA, indicating that low expression of ApoM is a common molecular feature of liver tissues in different MASLD experimental models and patients.

[0032] 3. qRT-PCR detection of human samples. Using GAPDH as an internal control, the relative expression level of ApoM mRNA in human liver tissue was detected by conventional qRT-PCR method. The specific nucleotide sequence is shown in Table 1. ; The above results indicate that decreased ApoM expression is associated with the occurrence and progression of MASLD, and provide a basis for further evaluation of the intervention effects of ApoM protein, nucleic acid molecules encoding ApoM, or ApoM expression vectors on MASLD. Example 2: Construction of a hepatocyte-specific ApoM knockout model and the effect of ApoM deletion on MASLD;

[0033] 1. Construction and identification of ApoM-HKO mice. ApoM conditional allele mice (ApoM-Flox) were crossed with Alb-Cre mice to obtain hepatocyte-specific ApoM knockout mice (ApoM-HKO). The construction principle is described in [link to documentation]. Figure 4 A. Mouse genomic DNA was collected and PCR typing was performed using the primers shown in Table 2; P1 / P2 were used for ApoM-Flox allele identification, and P3 / P4 / P5 were used for Alb-Cre related genotype identification. PCR banding results are shown in [Table 2]. Figure 4 B. Detection of ApoM mRNA in liver, heart, kidney, lung, and spleen tissues showed that ApoM levels were significantly reduced only in the liver tissue of ApoM-HKO mice; under HFD and MCD conditions, both ApoM mRNA and protein levels in the liver tissue of ApoM-HKO mice were significantly reduced. Figure 4 CI) proves that the model was successfully constructed and has liver specificity; .

[0034] 2. HFD Model Validation. Eight-week-old male ApoM-Flox and ApoM-HKO mice were selected and fed chow or HFD for 16 weeks, respectively. Figure 5 The procedure shown in A was used for sample collection. Body weight, serum TG, TC, LDL, HDL, ALT, AST, and liver tissue TG and TC were measured. Liver tissue was stained with H&E, Oil Red O, Masson's red, and Sirius red. The mRNA expression of Srebp-1c, Fasn, Acc, Il-6, TNF-α, Il-1β, Col1a1, Tgfβ, and α-Sma was detected, and GTT and ITT were performed. Results are as follows. Figure 5 As shown, under chow conditions, there was no significant overall difference between ApoM-HKO and ApoM-Flox; under HFD conditions, serum TG, TC and LDL, liver tissue TG and TC, ALT and AST were all increased in ApoM-HKO mice, HDL was decreased, liver lipid accumulation, inflammation and fibrosis were aggravated, lipid synthesis, pro-inflammatory and pro-fibrotic gene expression were increased, and glucose tolerance and insulin sensitivity were decreased.

[0035] 3. MCD Model Validation. Eight-week-old male ApoM-Flox and ApoM-HKO mice were selected and fed NCD or MCD for 8 weeks, respectively. Figure 6 The sampling process is shown in Figure A. The testing items are the same as those in the HFD model described above. The results are as follows: Figure 6 As shown, under MCD conditions, ApoM deficiency further increased liver tissue TG and TC levels, as well as serum ALT and AST levels, exacerbating hepatic steatosis, inflammation, and fibrosis, and upregulating lipid synthesis, pro-inflammatory, and pro-fibrotic genes. These results indicate that endogenous ApoM in hepatocytes has a protective effect against diet-induced MASLD.

[0036] 4. qRT-PCR of mouse primary hepatocytes and liver tissue. Using GAPDH as an internal control, the relative expression levels of the above genes were detected using conventional qRT-PCR methods. All primer sequences used are shown in Table 3; . Example 3: Construction of an AAV8-TBG-ApoM liver-targeting agent and its efficacy in treating MASLD;

[0037] 1. Construction of ApoM expression elements and vectors. The cDNA encoding mouse ApoM was used as the target nucleic acid, wherein the nucleotide sequence of the ApoM encoding gene is SEQ ID NO.2, and the ApoM cDNA sequence is SEQ ID NO.1. The target gene fragment was designed and synthesized based on the ApoM encoding gene sequence shown in SEQ ID NO.2 for subsequent expression vector construction.

[0038] The amino acid sequence of the ApoM protein encoded by the ApoM cDNA is: MFHQVWAALL SLYGLLFNSMNQCPEHSQLT ALGMDDETPE PHLGLWYFI AGAASTTEEL ATFDPVDNIV FNMAAGSAPR QLQLRATIRTKSGVCVPRKW TYRLTEGKGN MELRTEGRPD MKTDLFSSSC PGGIMLKETG QGYQRFLLYN RSPHPPEKCVEEFQSLTSCL DFKAFLVTPR NQEACPLSSK.

[0039] The ApoM cDNA was cloned into the TBG-MCS-P2A-EGFP vector, and its expression was controlled by the TBG hepatocyte-specific promoter. Figure 7 A shows the AAV-ApoM expression plasmid, which was packaged with AAV8 virus; the corresponding vector expressing EGFP without the ApoM target fragment served as a control. The nucleotide primers used for plasmid construction are shown in Table 4. The obtained AAV8-TBG-ApoM viral particles were prepared with sterile saline and used as a liver-targeted gene therapy agent. .

[0040] 2. Verification of ApoM overexpression in the liver. AAV8-TBG-EGFP or AAV8-TBG-ApoM was administered under HFD and MCD conditions, respectively. EGFP fluorescence in liver tissue showed that the vector could transduce hepatocytes; qRT-PCR and Western blot results showed that the levels of ApoM mRNA and protein in primary hepatocytes were significantly increased in the AAV8-TBG-ApoM group. Figure 7 (BI) indicates that the formulation can achieve ApoM overexpression in the liver.

[0041] 3. Therapeutic effect in HFD-induced MASLD model. Eight-week-old male C57BL / 6 mice were selected and fed HFD starting from week 0. At week 4, they were given AAV8-TBG-EGFP or AAV8-TBG-ApoM, respectively. HFD feeding continued until week 16, after which samples were collected for analysis. Figure 8 A). Compared with the AAV8-TBG-EGFP group, the AAV8-TBG-ApoM group showed decreased serum TG, TC, and LDL, decreased liver tissue TG and TC, and decreased ALT and AST; H&E and Oil Red O staining showed reduced hepatic steatosis and lipid accumulation, and Masson and Sirius Red staining showed reduced fibrosis; expression of Srebp-1c, Fasn, Acc, Il-6, TNF-α, Il-1β, Col1a1, Tgfβ, and α-Sma was decreased, and the area under the curves of GTT and ITT was reduced ( Figure 8 (BQ). The above results indicate that AAV8-TBG-ApoM can improve HFD-induced lipid metabolism disorders, liver damage, inflammation, fibrosis, and abnormal glucose metabolism.

[0042] 4. Therapeutic effect in MCD-induced MASH model. Eight-week-old male C57BL / 6 mice were selected and fed MCD starting from week 0. At week 2, they were given either AAV8-TBG-EGFP or AAV8-TBG-ApoM, and MCD feeding continued until week 6, after which samples were collected for analysis. Figure 9 A). Compared with the AAV8-TBG-EGFP group, the AAV8-TBG-ApoM group showed significantly decreased liver tissue TG and TC, and serum ALT and AST; reduced hepatic steatosis, lipid accumulation, and fibrosis; and decreased expression of lipid synthesis, pro-inflammatory, and pro-fibrotic genes. Figure 9 BO). There were no significant differences in body weight, serum lipids, and GTT and ITT levels between the two groups. Figure 9 (BG, PQ), indicating that ApoM overexpression in the MCD model can improve the liver pathological phenotype without significantly altering the above-mentioned systemic metabolic indicators.

[0043] This embodiment demonstrates, from three aspects—vector construction, liver expression, and intervention effects in two independent dietary models—that liver-targeted gene therapy agents with AAV8-TBG-ApoM as the active component have the potential for preventing or treating MASLD. Example 4: Validation of the mechanism by which ApoM improves hepatic lipid metabolism by activating the PPARα signaling pathway;

[0044] 1. Single-cell transcriptome analysis. Liver tissues from ApoM-Flox and ApoM-HKO mice under Chow and HFD conditions were collected for single-cell isolation, single-cell library construction, sequencing, and data analysis. t-SNE clustering identified the main cell types, including hepatocytes, hepatic stellate cells, endothelial cells, bile duct cells, and immune cells. ApoM was mainly expressed in hepatocytes, and ApoM expression in hepatocytes was significantly reduced in the ApoM-HKO group. Figure 10 KEGG enrichment analysis of differentially expressed genes in hepatocytes showed that genes downregulated by ApoM deletion were significantly enriched in the PPAR signaling pathway, fatty acid metabolism, and fatty acid degradation pathway.

[0045] 2. PPARα Pathway Validation. The mRNA expression of PPARα and its downstream fatty acid metabolism genes Acox1, Cpt1a, Fapp1, and Angpt14 was detected using the primers shown in Table 3. Western blot was used to detect PPARα and Cpt1a proteins. Results are as follows: Figure 11 As shown in AH, under HFD and MCD conditions, the overall mRNA expression of PPARα and its downstream genes in the liver tissue of ApoM-HKO mice was reduced, and the protein levels of PPARα and Cpt1a were also reduced; Figure 11 As shown in the IL, after AAV8-TBG-ApoM treatment, the overall mRNA expression of PPARα and its downstream genes in the liver tissue of HFD and MCD model mice was increased, and the protein levels of PPARα and Cpt1a were also increased.

[0046] In summary, ApoM upregulation activates the hepatic PPARα signaling pathway and fatty acid oxidation-related programs, reduces lipotoxic lipid accumulation, and inhibits inflammation and fibrosis; ApoM deficiency produces the opposite phenotype. The results of ApoM deficiency and overexpression corroborate each other, indicating that the ApoM-PPARα regulatory axis is a crucial mechanism by which the formulation of this invention improves MASLD.

[0047] This invention prepares a liver disease drug using ApoM protein, nucleic acid encoding ApoM, and hepatocyte-specific AAV8 virus as active ingredients. The target is natural and safe, and it has a synergistic effect through multiple pathways. This invention provides a novel endogenous therapeutic target and gene therapy drug for MASLD, and has important clinical translational value.

[0048] The nucleotide sequences used in the examples are shown below: SEQ ID No.1: ATGTTCCACCAAGTTTGGGCAGCTCTGCTCTCTCTCTATGGCCTTCTCTTTAACTCCATGAATCAGTGCCCTGAGCACAGTCAACTAACTGCGCTGGGAATGGACGACACAGAGACCCCAGAGCCCCACCTGGGCCTGTGGTACTTTATTGCGGGAGCAGCCTCCACCACGGAAGAGTTGGCAACTTTTGATCCGGTGGACAATATTGTCTTCAACATGGCTGCCGGCTCTGCCCCAAGGCAGCTCCAGCTTCGTGCTACCATCCGCACGAAAAGTGGGGTCTGTGTGCCCCGGAAGTGGACATACCGATTGACTGAAGGGAAAGGAAACATGGAACTCAGAACTGAAGGGCGCCCAGACATGAAAACAGACCTGTTCTCCAGCTCGTGCCCAGGAGGAATCATGCTGAAAGAGACGGGCCAGGGCTACCAGCGCTTTCTCCTCTACAATCGGTCACCACACCCTCCAGAGAAGTGTGTGGAGGAATTCCAGTCTCTGACCTCTTGCTTGGACTTCAAAGCCTTCTTAGTGACTCCCAGGAATCAAGAGGCCTGCCCGCTGTCCAGCAAGTGA; SEQ ID No.2:

[0049] The above content is only a specific implementation example of the present invention, and not all application examples of the present invention. All schemes that follow the technical concept of the present invention or make modifications based on the technical concept of the present invention are within the protection scope of the claims of the present invention.

Claims

1. The application of apolipoprotein M in the preparation of a drug for treating metabolic dysfunction-related fatty liver disease, characterized in that, The apolipoprotein M is used to prepare drugs that activate the hepatic PPARα signaling pathway and improve hepatic lipid metabolism; The apolipoprotein M is any one of the following: mature ApoM protein specifically expressed by hepatocytes, nucleic acid molecule encoding ApoM, or hepatocyte-specific adeno-associated virus vector carrying the ApoM encoding gene.

2. The use of apolipoprotein M according to claim 1 in the preparation of a drug for treating metabolic dysfunction-related fatty liver disease, characterized in that, The hepatocyte-specific adeno-associated virus vector is the AAV8 vector, which carries the TBG hepatocyte-specific promoter to drive the expression of the ApoM-encoded gene.

3. The application of apolipoprotein M according to claim 1 in the preparation of a drug for treating metabolic dysfunction-related fatty liver disease, characterized in that, The amino acid sequence of the mature ApoM protein is: MFHQVWAALL SLYGLLFNSMNQCPEHSQLT ALGMDDETPE PHLGLWYFI AGAASTTEEL ATFDPVDNIV FNMAAGSAPR QLQLRATIRTKSGVCVPRKW TYRLTEGKGN MELRTEGRPD MKTDLFSSSC PGGIMLKETG QGYQRFLLYN RSPHPPEKCVEEFQSLTSCL DFKAFLVTPR NQEACPLSSK.

4. The use of apolipoprotein M according to claim 1 in the preparation of a drug for treating metabolic dysfunction-related fatty liver disease, characterized in that, The nucleic acid molecule encoding ApoM is a cDNA sequence encoding ApoM, and its nucleotide sequence is SEQ ID NO.

1.

5. The use of apolipoprotein M according to claim 1 in the preparation of a drug for treating metabolic dysfunction-related fatty liver disease, characterized in that, The nucleotide sequence of the ApoM encoding gene is SEQ ID NO.

2.

6. The use of apolipoprotein M according to claim 1 in the preparation of a drug for treating metabolic dysfunction-related fatty liver disease, characterized in that, The dosage form of the drug is any one of injection, lyophilized preparation, liposome preparation, or gene therapy preparation.

7. The use of apolipoprotein M according to claim 1 in the preparation of a drug for treating metabolic dysfunction-related fatty liver disease, characterized in that, The drug also includes a pharmaceutically acceptable carrier, diluent, or adjuvant.

8. A hepatocyte-targeted gene therapy agent, characterized in that, The active ingredient is AAV8-TBG-ApoM virus particles, and the pharmaceutical excipient is sterile physiological saline.

Images