A nano diagnosis and treatment system based on ZIF-8 and hybrid chain reaction and application thereof

Abstract

The application belongs to the technical field of biological medicine, and provides a nano diagnosis and treatment system based on ZIF-8 and hybridization chain reaction and application thereof. The nano diagnosis and treatment system comprises ZIF-8 with surface adsorption of hairpin H1, H2 and HA; the nucleotide sequences of H1 and H2 are shown in SEQ ID NO:1 and SEQ ID NO:2; and ZIF-8 internally encapsulates glucose oxidase and hemin. The nano diagnosis and treatment material of the application has low background signal and high signal-to-noise ratio when used as a detection sensor; has high detection sensitivity, and a detection limit as low as 0.193 pM; is simple to operate, does not require complex instruments and professional operators, and is suitable for instant detection and clinical diagnosis application; the system can block exogenous glucose uptake, catalyze endogenous glucose consumption, realize starvation therapy, catalyze the generation of a large amount of ROS, and realize chemical kinetics therapy.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a pharmaceutical composition that allows for the visualization of both starvation therapy and chemokinetics in tumors with high miR-21 expression. Background Technology

[0002] MicroRNAs (miRNAs) are a class of non-coding single-stranded RNAs encoded by endogenous genes, playing important roles in gene expression and various biological processes. Among them, miRNA-21 is significantly upregulated in various tumor cells and is an important tumor biomarker. Current methods for detecting miRNAs, such as qRT-PCR, require complex instruments and specialized operation, limiting their application in point-of-care diagnosis. Meanwhile, single-modality tumor treatments (such as chemotherapy and radiotherapy) suffer from significant toxic side effects and high relapse rates. Emerging starvation therapy and chemokinetic therapy (CDT) each have their limitations: starvation therapy is easily evaded by tumor metabolic reprogramming; CDT relies on endogenous H2O2, which is insufficient in most solid tumors. Therefore, constructing an intelligent nanoplatform integrating diagnosis and treatment to achieve synergistic multi-mechanism therapy has significant research value.

[0003] Currently, chemokinetic therapy (CDT) mainly relies on Fenton or Fenton-like reactions mediated by iron-based, copper-based, and other nanomaterials to convert hydrogen peroxide (H2O2) in the tumor microenvironment into highly toxic hydroxyl radicals (·OH). Common CDT reagents include Fe3O4 nanoparticles, amorphous iron, and copper-based MOFs. However, existing CDT methods have the following shortcomings: (1) The endogenous H2O2 content in tumors is limited (usually only 50-100 μM), which is insufficient to continuously generate toxic ·OH; (2) The optimal pH for the Fenton reaction is 3-4, while the pH of the tumor microenvironment is about 6.5-6.8, resulting in low reaction efficiency; (3) High concentrations of glutathione (GSH) in tumor cells can scavenge ·OH, weakening the efficacy of CDT; (4) Single CDT lacks tumor-specific recognition ability and is prone to off-target toxicity. Therefore, it is urgent to develop a novel CDT strategy that can self-supply H2O2, enhance tumor oxidative stress, and achieve precise response. Summary of the Invention

[0004] To address the problems in the prior art, this invention provides a nanotherapeutic system based on ZIF-8 and hybridization chain reaction, which can visualize the simultaneous starvation therapy and chemokinetic treatment of miR-21-overexpressing tumors.

[0005] To achieve the above objectives, the present invention adopts the following technical solution.

[0006] A nanotherapeutic material based on ZIF-8 and hybridization chain reaction, comprising ZIF-8 with surface adsorption of H1, H2 and hyaluronic acid (HA); Both H1 and H2 are hairpin structures; the nucleotide sequences of H1 and H2 are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively, and the 11th nucleotide of H1 is modified with a quenching group; the 56th nucleotide of H1 is modified with a fluorescent group. The ZIF-8 internally encapsulates glucose oxidase (GOx) and hemin chloride (Hemin).

[0007] The fluorescent groups and quenching groups in the above-mentioned nano-therapeutic materials can be selected in different combinations according to the detection needs, such as the fluorescent group FAM and the quenching group BHQ1, TAMRA and the quenching group BHQ3, Cy3 and the quenching group BHQ2, etc.

[0008] The present invention also provides a method for preparing the above-mentioned nanotherapeutic materials, comprising the following steps: (1) Add Zn(NO3)2·6H2O solution to 2-methylimidazole solution, and add glucose oxidase (GOx) and heme (Hemin) at the same time. After the reaction, separate the product, wash and dry it to obtain ZIF-8 nanoparticles co-encapsulated with GOx and Hemin, which are referred to as HG@ZIF-8. (2) The hairpin structure H1 and H2 are mixed with the HG@ZIF-8 prepared in step (1) and hyaluronic acid (HA) in a buffer solution, stirred and incubated at room temperature, and the product is separated and collected for purification to obtain HG@ZIF-8 nanoparticles adsorbed with H1, H2 and HA, i.e. nanotherapeutic materials, abbreviated as AD@HG@ZIF-8.

[0009] In step (1), the molar ratio of Zn(NO3)2·6H2O and 2-methylimidazole is 1:4-20; preferably 1:10-20.

[0010] The molar ratio of Zn(NO3)2·6H2O to heme chloride is 3-7:1.

[0011] The ratio of glucose oxidase to Zn(NO3)2·6H2O is 100-200:1 U / μmol.

[0012] In step (2), the H1 or H2 of the hairpin structure is obtained by thermal denaturation of the corresponding oligonucleotide of H1 or H2 followed by ice annealing.

[0013] In step (2), the molar ratio of H1 to H2 is 1:1; the ratio of H1, HG@ZIF-8 and hyaluronic acid is (1-5) mol:(0.5-1) g:(2-4) mg / mL.

[0014] The present invention relates to the application of the aforementioned nanotherapeutic materials in the preparation of reagents or drugs. Based on this application, the present invention also provides a reagent or drug prepared from the aforementioned nanotherapeutic materials. The drug is preferably an antitumor drug. The tumor is a miR-21 highly expressed tumor, such as triple-negative breast cancer, non-small cell lung cancer, cholangiocarcinoma, pancreatic cancer, rectal cancer, thyroid cancer, nasopharyngeal carcinoma, laryngeal cancer, oral cancer, and glioma. The reagent is used to detect the miR-21 content in cells and tissues.

[0015] Specifically, a method for detecting miR-21 content using the above-mentioned reagents includes the following steps: (1) The sample to be tested is mixed with the nano-therapeutic material and incubated at 37°C, and then the fluorescence intensity is detected; (2) Calculate the concentration of miRNA-21 in the sample to be tested based on the linear relationship between fluorescence intensity and miRNA-21 concentration.

[0016] The mechanism of the present invention is as follows Figure 1 As shown, AD@HG@ZIF-8 contains the following two hairpin oligonucleotides: H1 (SEQ ID NO: 1): 5'-ATCAGACTGAT / BHQ1 / GTTGGGTTACGAACCGCCCTCA GGGAGGGCGGGGTTGGG GCAACAT / FAM / CAGTCTGATAAGCTACTACCGAG-3'; H2 (SEQ ID NO: 2): 5'-GGGCGGTTCGTAACCAACATCAGTCTGATAGCGAGGCT CCGAGCCGGTCGAAATGAGGTGCA CGGCTCGGTAGTAGCTTATCAGACTGATGTTGG-3'; Under structurally intact conditions, AD@HG@ZIF-8's modifications and the fluorescent and quenching groups on its hairpin sequence quench fluorescence through photoinduced electron transfer or fluorescence resonance energy transfer mechanisms. Tumor cells highly express hyaluronic acid receptors such as CD44 on their surface. AD@HG@ZIF-8 cells, through their surface hyaluronic acid (HA), enter tumor cells more extensively under the mediation of CD44. In the more acidic environment of tumor cell lysosomes, the following reactions occur: ZIF-8 disintegrates under acidic conditions, thereby releasing GOx, Hemin, and Zn. 2+ and hair clip H1, hairpin H2; On the one hand, the toehold region of H1 (the bolded part) binds to the intracellularly highly expressed miR-21, opening the hairpin structure and restoring fluorescence; at the same time, H2 hybridizes with the opened H1 to replace miR-21, completing a hybridization chain reaction (HCR). The above process is repeated, amplifying the signal. At this time, the tumor area can be imaged by detecting changes in fluorescence intensity. On the other hand, the H2 chain in the HCR product contains the GLUT-1 DNAzyme sequence (underlined portion), and the H1 chain contains the G-quadruplex sequence (underlined portion); under double-stranded conditions, the GLUT-1 DNAzyme forms an active conformation in Zn. 2+ With the aid of cleavage, glucose transporter-1 (GLUT-1) mRNA is cleaved, glucose transporter expression is downregulated, and glucose uptake is inhibited; the G-quadruplex binds to Hemin to form G4 / Hemin DNAzyme, which uses H2O2 to catalyze the generation of a large amount of ROS, thus achieving chemokinetic therapy. In the absence of glucose, the production of reducing power (NADPH) in the pentose phosphate pathway used for biosynthesis is inhibited, which in turn leads to a decrease in GSH content and exacerbates the damage of ROS to tumor cells. On the other hand, the released GOx catalyzes the oxidation of glucose into H2O2 and gluconic acid in the cell, which can provide H2O2 for G4 / Hemin DNAzyme, and together with glucose uptake inhibition, achieve starvation therapy based on glucose consumption. The above processes synergistically induce tumor cell apoptosis.

[0017] Although hyaluronic acid receptors such as CD44 are widely present on the cell surface, in normal cells, the pH of lysosomes is insufficient to degrade ZIF-8, and the expression level of miR-21 is low, so the above-mentioned reactions can hardly occur.

[0018] This invention utilizes a one-pot method to co-encapsulate GOx and Hemin within ZIF-8, and then modifies the surface with DNA hairpins and HA to construct a multifunctional nanotherapeutic system. When used as a sensor, this material leverages the fluorescence quenching properties of ZIF-8 to keep the fluorescent group modified on the hairpin DNA in a "closed" state in the absence of the target. Simultaneously, combined with hybridization chain reaction (HCR) signal amplification technology, the HCR reaction is triggered in the presence of the target miRNA-21, causing the fluorescent group to move away from the ZIF-8 surface, thus restoring the fluorescence signal and achieving signal amplification.

[0019] This system, triggered by miR-21, can achieve: GLUT-1 DNAzyme-mediated gene silencing, downregulating glucose transporter expression, and blocking exogenous glucose uptake; GOx catalyzing the consumption of endogenous glucose to generate H2O2, thus achieving starvation therapy; and G4 / Hemin DNAzyme utilizing H2O2 to catalyze the generation of large amounts of ROS, thus achieving chemokinetic therapy.

[0020] The present invention has the following advantages: The nanotherapeutic material of this invention exhibits low background signal and high signal-to-noise ratio when used as a detection sensor; it also boasts high detection sensitivity with a detection limit as low as 0.193 pM; the sensor is easy to operate, requiring no complex instruments or professional operators, making it suitable for point-of-care testing and clinical diagnostic applications; furthermore, it possesses excellent selectivity, capable of distinguishing miRNA-21 from its analogues and base mismatch sequences, reducing false positive results; in addition, its preparation method is simple and low-cost, exhibiting good biocompatibility and stability. This system can block exogenous glucose uptake, catalyze endogenous glucose consumption to achieve starvation therapy, and catalyze the generation of large amounts of ROS to achieve chemokinetic therapy. This triple synergistic effect significantly enhances the anti-tumor effect, with a total cell apoptosis rate reaching 45.91%. The system possesses dual controlled-release characteristics of pH response and miR-21 response, enabling tumor-specific activation and reducing toxic side effects on normal tissues. Attached Figure Description

[0021] Figure 1 This is a schematic diagram illustrating the principle of the nano-diagnostic and therapeutic system of this invention; Figure 2 These are TEM images of ZIF-8(a) and AD@HG@ZIF-8(b); Figure 3 These are the Zeta potentials of different materials; Figure 4 This is the FT-IR spectrum of AD@HG@ZIF-8; Figure 5 It is a UV-Vis absorbance scan of different materials; Figure 6 The fluorescence scans (a) and fluorescence intensities (b) are for treatment groups with different loading rates. Figure 7 The fluorescence scans (a) and fluorescence intensities (b) of the treatment groups with different encapsulation rates are shown. Figure 8 The fluorescence response spectra at different miRNA-21 concentrations are shown in Figure (A), and the linear regression curve of fluorescence intensity at 525 nm versus the logarithm of miRNA-21 concentration is shown in Figure (B). Figure 9 This represents the fluorescence intensity of miRNA-21 and its analogues at 525 nm. Figure 10 It is the change in pH value of the reaction system over time; Figure 11 It is a visible light absorbance scan of different reaction systems; Figure 12 These are Western blot images of GLUT-1 in MDA-MB-231 cells from different treatment groups; Figure 13 The data represent the ROS production levels in MDA-MB-231 cells under different treatment groups; (a) CLSM images of different treatment groups, scale bar 20 μm; (b) FCM analysis of different treatment groups; (c) quantification of the average fluorescence intensity in (b). express p <0.001; Figure 14 The images show the apoptosis of MDA-MB-231 cells in different treatment groups. Among them, a is a fluorescence micrograph of Calcein AM, PI, and the superposition of the two; b is the cell viability detected by CCK8; and c is a comparison of fluorescence intensity in different channels. Detailed Implementation

[0022] The present invention will be further described below with reference to the embodiments and accompanying drawings, but the present invention is not limited to the following embodiments.

[0023] Example 1: Preparation of Nanotherapeutic Materials 1. Preparation of Nanotherapeutic Materials (1) Commercial synthesis and modification of H1 and H2 oligonucleotides: H1: 5'-ATCAGACTGAT / BHQ1 / GTTGGTTACGAACCGCCCTCAGGGAGGGCGGGGTTGGGGCAACAT / FAM / CAGTCTGATAAGCTACTACCGAG-3'; H2: 5'-GGGCGGTTCGTAACCAACATCAGTCTGATAGCGAGGCTCCGAGCCGGTCGAAATGAGGTGCACGGCTCGGTAGTAGCTTATCAGACTGATGTTGG-3'; Oligonucleotides H1 and H2 were prepared as stock solutions and diluted to 20 μM with HEPES buffer (10 mM HEPES, 1 M NaCl, 50 mM MgCl2, pH=7.2). The solutions were then incubated in a water bath at 95°C for 5 min and an ice bath for at least 15 min to obtain hairpin structures H1 and H2. (2) 1 mL of Zn(NO3)2·6H2O solution (2.9749 mg / mL) was slowly added to 1 mL of 2-methylimidazole aqueous solution (13.136 mg / mL), and 30 μL of GOx solution (240 mg / mL) and 20 μL of Hemin solution (100 mM) were added at the same time. The mixture was stirred at 12000 r / min for 10 min at room temperature, the product was collected by centrifugation, washed three times with water, and freeze-dried to obtain HG@ZIF-8. (3) Take 100 μL hairpin H1 (20 μM), 100 μL hairpin H2 (20 μM), 100 μL HG@ZIF-8 (6 mg / mL), 200 μL HA solution (10 mg / mL) and 500 μL HEPES buffer, stir at 300 r / min for 24 h at room temperature, centrifuge to collect the product, wash with water three times to obtain AD@HG@ZIF-8.

[0024] TEM characterization showed that AD@HG@ZIF-8 inherited the appearance of ZIF-8, exhibiting a regular polyhedral shape with a particle size of approximately 240 nm. EDS elemental analysis showed that P (from DNA), S (from GOx), and Fe (from Hemin) were uniformly distributed. ζ-potential ( Figure 3 ) and FT-IR ( Figure 4 This confirms that DNA and HA were successfully adsorbed onto the ZIF-8 surface.

[0025] 2. Assembly verification of diagnostic and therapeutic materials ZIF-8, H@ZIF-8, and G@ZIF-8 were prepared using a method similar to that described in step (2) above: 1 mL of Zn(NO3)2·6H2O solution (2.9749 mg / mL) was slowly added to 1 mL of 2-methylimidazole aqueous solution (13.136 mg / mL), stirred at 12000 r / min for 10 min at room temperature, the product was collected by centrifugation, washed three times with water, and freeze-dried to obtain ZIF-8; 1 mL of Zn(NO3)2·6H2O solution (2.9749 mg / mL) was slowly added to 1 mL of 2-methylimidazole aqueous solution (13.136 mg / mL), and 20 μL of Hemin solution (100 mM) was added at the same time. The mixture was stirred at 12000 r / min for 10 min at room temperature, the product was collected by centrifugation, washed three times with water, and freeze-dried to obtain H@ZIF-8. 1 mL of Zn(NO3)2·6H2O solution (2.9749 mg / mL) was slowly added to 1 mL of 2-methylimidazole aqueous solution (13.136 mg / mL), and 30 μL of GOx solution (240 mg / mL) was added simultaneously. The mixture was stirred at 12000 r / min for 10 min at room temperature, the product was collected by centrifugation, washed three times with water, and freeze-dried to obtain G@ZIF-8. The above materials (0.6 mg / mL), AD@HG@ZIF-8 (0.6 mg / mL), and Hemin were subjected to UV-Vis absorbance scans, and the results are as follows: Figure 5 As shown in Figure a, free Hemin exhibits a distinct characteristic absorption peak at 412 nm. AD@HG@ZIF-8 also showed a characteristic absorption peak at 412 nm, while blank ZIF-8 and HG@ZIF-8 showed no absorption peak at this wavelength. This result indicates that Hemin has been successfully encapsulated within AD@HG@ZIF-8, and the structural integrity of Hemin remains intact after encapsulation.

[0026] The mixture of H1 and H2 in an equimolar ratio was used as DNA, and UV-Vis absorbance scans were performed with ZIF-8, HG@ZIF-8, and AD@HG@ZIF-8 at concentrations of 0.6 mg / mL, respectively. The results are as follows. Figure 5 As shown in Figure b, free DNA exhibits a distinct nucleic acid characteristic absorption peak (curved DNA) at 260 nm. Neither ZIF-8 nor HG@ZIF-8 shows characteristic absorption near 260 nm, indicating that the blank vector does not interfere at this wavelength. AD@HG@ZIF-8 shows a characteristic absorption peak at 260 nm, consistent with the position of free DNA. This result indicates that H1 and H2 hairpin DNA have successfully bound to the ZIF-8 surface via electrostatic adsorption, providing a material basis for the subsequent miR-21-triggered HCR reaction.

[0027] The loading rate of DNA hairpins in a nanoreactor was determined by fluorescence spectroscopy using the quenching effect of ZIF-8 on the FAM fluorescent group. FAM-labeled oligonucleotides with the same bases as H1 and H2 were synthesized to form hairpin structures, abbreviated as Y-DNA. These were then co-incubated with HG@ZIF-8 nanomaterials to fully load DNA into the nanocarrier, yielding Y-DNA@ZIF-8. After incubation, unloaded free DNA was separated by centrifugation (12000 rpm, 10 min), and the supernatant was collected. The fluorescence emission spectrum of the supernatant in the 500-650 nm range was measured using a fluorescence spectrophotometer at an excitation wavelength of 488 nm, and the fluorescence intensity at 520 nm was recorded. Using the fluorescence intensity of an equal volume of Y-DNA solution not incubated with the nanomaterials as a 100% reference, the loading rate was calculated using the following formula: Load factor (%) = Among them, FL 上清 The fluorescence intensity of the supernatant in the experimental group is FL. 对照 The fluorescence intensity is the same as that of an equal volume of γ-DNA solution in the control group.

[0028] The results are as follows Figure 6 As shown, free Y-DNA exhibits a strong fluorescence emission peak at 520 nm. In contrast, after co-incubation with HG@ZIF-8, the fluorescence intensity of the waste liquid of Y-DNA at 520 nm significantly decreased, indicating that most of the FAM-labeled DNA hairpins were adsorbed by HG@ZIF-8. Simultaneously, the fluorescence intensity of the Y-DNA@ZIF-8 complex was extremely low, essentially consistent with that of blank ZIF-8, demonstrating that the FAM fluorescence in the DNA hairpins adsorbed on the ZIF-8 surface was effectively quenched by ZIF-8. These results indicate that ZIF-8 has a good loading capacity for DNA hairpins. The calculated DNA loading rate on the HG@ZIF-8 surface was 66.85%.

[0029] Utilizing the characteristic fluorescence emission of glucose oxidase (GOx) at 350 nm under 280 nm excitation light, the encapsulation efficiency of GOx in a nanoreactor was determined by fluorescence spectroscopy: ZIF-8 and HG@ZIF-8 nanoparticles were prepared, and unencapsulated free GOx was separated by centrifugation (12000 rpm, 10 min), and the supernatant was collected. The fluorescence intensity of the supernatant at 350 nm was measured using a fluorescence spectrophotometer at an excitation wavelength of 280 nm. The fluorescence intensity of an equal volume of GOx solution not incubated with the nanomaterials was used as a control, set as 100%, and the encapsulation efficiency was calculated using the following formula: Encapsulation rate (%) = Among them, FL上清 The fluorescence intensity of the supernatant in the experimental group is FL. 对照 The fluorescence intensity is the same as that of the control group with an equal volume of GOx solution.

[0030] The results are as follows Figure 7 As shown, free GOx exhibits a strong characteristic fluorescence emission peak at 350 nm. In contrast, the fluorescence intensity of the supernatants from both the G@ZIF-8 and HG@ZIF-8 groups at 350 nm is significantly reduced, indicating that most of the GOx has been successfully encapsulated within the ZIF-8. The fluorescence intensity of the HG@ZIF-8 group supernatant is slightly lower than that of the G@ZIF-8 group, presumably because the co-encapsulation of heme affects the crystal structure of ZIF-8 to some extent, slightly enhancing its encapsulation ability for GOx. The blank ZIF-8 group shows no fluorescence signal at 350 nm, proving that the carrier itself does not interfere with the detection. The calculated GOx encapsulation efficiency is 55.25%.

[0031] Example 2: Detection of miR-21 by AD@HG@ZIF-8 1. Detection limit In Example 1, AD@HG@ZIF-8 was prepared as a 6 mg / mL suspension. 5 μL of this suspension was then added to 5 μL of miRNA-21 at different final concentrations (0, 10, 50, 100, 500, 1000, 5000, 10000, 100000 pM), and incubated at 37°C for 2 h. Detection was performed using a fluorescence spectrophotometer (excitation 488 nm, emission 500-650 nm). Figure 8 The results showed that the fluorescence intensity increased with increasing miRNA-21 concentration. Within the range of 0.01–100 nM, the fluorescence intensity at 525 nm exhibited a linear relationship with the logarithm of the concentration: Y = 178.117 lg C - 17.834 (R0). 2 =0.996), detection limit 0.193 pM (3σ method).

[0032] 2. Specificity Synthesized miR-21 and its analogues (Mut-1, Mut-2, Mut-3, miR-155, miR-221, miR-20a, miR-122, miR-375, miR-210): miR-21 5'-UAGCUUAUCAGACUGAUGUUG-3' Mut-1 5'- UAGCUUAUCTGACUGAUGUUGA-3' Mut-2 5'-UAGCUUAUCTCACUGAUGUUGA-3' Mut-3 5'-UAGCUUAUCTCTCUGAUGUUGA-3' miR-155 5'- UUAAUGCUAAUCGUGAUAGGGGU-3' miR-221 5'-AGCUACAUUGUCUGCUGGGUUUC-3' miR-20a 5'-UAAAGUGCUUAUAGUGCAGGUAG-3' miR-122 5'-UGGAGUGUGACAAUGGUGUUUG-3' miR-375 5'-UUGUUCGUUCGGCUCGCGUGA-3' miR-210 5'-CUGUGCGUGUGACAGCGGCUGA-3'.

[0033] In Example 1, AD@HG@ZIF-8 was prepared as a 6 mg / mL suspension. 5 μL of the suspension was added to 5 μL of miRNA-21 and its analogues at the same final concentration, with water as a control. The excitation wavelength of the fluorescence spectrophotometer was set to 488 nm, and the fluorescence intensity at 525 nm was detected.

[0034] The results are as follows Figure 9 As shown, only miR-21 produced strong fluorescence, while other analogs (Mut-1, Mut-2, Mut-3, miR-155, miR-221, miR-20a, miR-122, miR-375, miR-210) showed weak signals. This demonstrates that AD@HG@ZIF-8 has good specificity for the analytes.

[0035] Example 3: Validation of Catalytic Activity AD@G@ZIF-8 was prepared by adsorbing hairpin H1, hairpin H2 and HA on the outside of G@ZIF-8 according to the method in Example 1.

[0036] 1. GOx activity Prepare a 17.6 mM glucose solution, take 5 mL and place it in a beaker, insert a calibrated pH electrode, and after the reading stabilizes, add 5 mL of 600 μg / mL HG@ZIF-8 solution. Record the pH change of the reaction solution continuously under magnetic stirring; use the ZIF-8 of the same concentration prepared in Example 2 as a control.

[0037] Figure 10 The results showed that the pH value decreased from 7.5 to 5.7 within 30 min, indicating that AD@HG@ZIF-8 could exert GOx activity.

[0038] 2. G tetrapeptide activity (1) The peroxidase-like activities of different systems were determined by the TMB colorimetric method: Take 1.6 mL of 0.1 M pH 4.0 NaAc-HAc buffer, add 100 μL of miR-21 aqueous solution, 100 μL of (60 μg / mL) AD@HG@ZIF-8 aqueous dispersion, and 100 μL of 5 mM TMB colorimetric solution in sequence. After mixing, add 100 μL of 0.5 mM H2O2 solution and incubate at room temperature for 5 min. Label the mixture as AD@HG@ZIF-8+miR-21+H2O2+TMB. Measure the absorbance at 452 nm using a UV-Vis spectrometer. The system was constructed using the above method, replacing the H2O2 solution with 100 μL NaAc-HAc buffer, and labeled as AD@HG@ZIF-8+miR-21+ TMB. Depend on Figure 11 The absorbance values ​​of both indicate that since there is no glucose in the system and no hydrogen peroxide is produced, and there is no exogenous hydrogen peroxide, TMB will not change color.

[0039] (2) The glucose oxidase activity of different nanomaterials was determined by the TMB colorimetric method: Take 1.6 mL of 0.1 M pH 4.0 NaAc-HAc buffer, and add 100 μL of miR-21 aqueous solution, 100 μL of (60 μg / mL) AD@HG@ZIF-8 dispersion, 100 μL of 30 mM glucose standard solution, and 100 μL of 5 mM TMB sequentially for color development. Vortex mix well, incubate at room temperature in the dark for 5 min, and label as AD@HG@ZIF-8+miR-21+Glu+TMB; measure the absorbance at 452 nm using a UV-Vis spectrometer. Following the method described above, 100 μL of 60 μg / mL ZIF-8, AD@G@ZIF-8, and HG@ZIF-8 dispersions were used to replace the AD@HG@ZIF-8 dispersion to construct systems, which were labeled as ZIF-8+miR-21+Glu+TMB, AD@G@ZIF-8+miR-21+Glu+TMB, and HG@ZIF-8+miR-21+Glu+TMB, respectively. Depend on Figure 11 As can be seen from the absorbance values ​​of the above system, the lack of Hemin or H1 and H2 in the system will cause G4 to fail to form, thus failing to produce strong absorbance.

[0040] (3) The activity of glucose oxidase under different conditions was determined by the TMB colorimetric method: Take 1.6 mL of 0.1 M pH 4.0 NaAc-HAc buffer, and add 100 μL of miR-21 aqueous solution, 100 μL of (60 μg / mL) AD@HG@ZIF-8 dispersion, 100 μL of 30 mM glucose standard solution, and 100 μL of 5 mM TMB sequentially for color development. Vortex mix well, incubate at room temperature in the dark for 5 min, and label as AD@HG@ZIF-8+miR-21+Glu+TMB; measure the absorbance at 452 nm using a UV-Vis spectrometer. The system was constructed by replacing the miR-21 aqueous solution with 100 μL NaAc-HAc buffer as described above, and denoted as AD@HG@ZIF-8+Glu+TMB. Depend on Figure 11 The absorbance values ​​of the above system show that the lack of miR-21 in the system prevents the formation of H1 and H2 HCRs, resulting in the failure of G4 formation and thus the inability to produce strong absorbance.

[0041] The above results collectively demonstrate that the system exhibits significant peroxidase activity (highest absorbance at 452 nm) only when miR-21 and glucose are present simultaneously, and that HCR-dependent G4 / Hemin formation is key to catalytic activity.

[0042] Example 4: Cellular-level gene silencing and metabolic regulation MDA-MB-231 cells were incubated at 37°C for 24 h with a mixture of 200 nM H1 and H2, 60 μg / mL ZIF-8, 60 μg / mL HG@ZIF-8, and 60 μg / mL AD@HG@ZIF-8, respectively. Cells were washed three times with PBS and then lysed in 1× lysis buffer (1 mL RIPA I + 10 μL phosphatase inhibitor + 10 μL protease inhibitor). 40 μg of protein was collected, reduced with 2.5% β-mercaptoethanol, separated by SDS-PAGE, and transferred to a 0.45 μm PVDF membrane according to standard Western blot procedures for further processing. The primary antibody was recombinant Anti-GLUT-1 rabbit polyclonal antibody (1:1000), and the secondary antibody was goat anti-rabbit antibody IgG H&L (HRP) (ab97051) (1:10000).

[0043] Figure 12 The results showed that GLUT-1 protein expression in the AD@HG@ZIF-8 group decreased to 0.42 times that of the control group; glucose uptake was significantly reduced; GSH level decreased to 66%; and MDA production was the highest. This indicates that the system can effectively silence GLUT-1, block glucose uptake, deplete GSH, and induce lipid peroxidation.

[0044] Example 5: Effects of AD@HG@ZIF-8 on reactive oxygen species production and apoptosis in MDA-MB-231 cells. 1. Reactive oxygen species MDA-MB-231 cells were mixed with 200 nM H1 and H2 solution, 60 μg / mL ZIF-8, 60 μg / mL HG@ZIF-8, 60 μg / mL AD@ZIF-8, and 60 μg / mL AD@HG@ZIF-8, respectively, and incubated at 37°C for 24 h. Cells incubated in HEPES served as controls. After washing the cells with PBS, they were stained with DCFH-DA (10 μM) for 30 min. Before the end of the incubation, Hoechst 33342 was added and incubated for 15 min. After washing three times with PBS, the cells were observed under a laser confocal microscope (CLSM).

[0045] MDA-MB-231 cells were mixed with 200 nM H1 and H2 solution, 60 μg / mL ZIF-8, 60 μg / mL HG@ZIF-8, 60 μg / mL AD@ZIF-8, and 60 μg / mL AD@HG@ZIF-8 suspensions, and incubated at 37°C for 24 h, with cells incubated in HEPES serving as a control. The original culture medium was then collected, cells were washed with PBS, digested with trypsin, and the digestion was terminated using pre-collected culture medium. The cell suspension was centrifuged at 1000 g for 5 minutes, the supernatant was discarded, and the cells were resuspended in PBS and counted. 1×10⁶ cells were collected. 5 Cells were centrifuged again at 1000 g for 5 minutes, the supernatant was discarded, and the cells were gently resuspended in 200 μL of Annexin V-FITC binding buffer. Then, 5 μL of Annexin V-FITC and 5 μL of PI staining solution were added, mixed thoroughly, and incubated at room temperature in the dark for 20 minutes, followed by placement on ice. Flow cytometry analysis was performed on each sample, collecting 30,000 cell events and detecting the fluorescence intensity of the FITC and PI channels. Data were processed using NovoExpress software.

[0046] CLSM and flow cytometry Figure 13The AD@HG@ZIF-8 treatment group showed the strongest green fluorescence, indicating the highest ROS level. The mean fluorescence intensity (MFI) of the HEPES control group and the ZIF-8 group indicated that the empty vector did not induce ROS production; the MFI of the HG@ZIF-8 group was slightly enhanced, attributed to the inherent peroxidase-like activity of Hemin producing a small amount of ROS; the MFI of the DNA group (H1+H2 only) and the AD@ZIF-8 group were similar to the control group, confirming that ROS cannot be effectively produced in the absence of GOx and Hemin; while the MFI of the AD@HG@ZIF-8 group was significantly higher than that of the control group, with a significant rightward shift in peak position. These results indicate that only when GOx, Hemin, and DNA hairpin components are complete and HCR is triggered by miR-21 can the system synergistically produce a large amount of ROS, confirming the synergistic effect mechanism of starvation therapy and CDT. The total apoptosis rate of the AD@HG@ZIF-8 group reached 45.91%, significantly higher than other control groups.

[0047] 2. Apoptosis HEPES, a mixed solution of 200 nM H1 and H2, ZIF-8 (60 μg / mL), HG@ZIF-8 (60 μg / mL), AD@ZIF-8 (60 μg / mL), and AD@HG@ZIF-8 (60 μg / mL) were co-incubated with MDA-MB-231 cells for 24 h. After washing the cells with PBS, Calcein AM / PI detection working solution was added, and the cells were incubated at 37°C in the dark for 30 min. The cells were then observed under a laser confocal microscope, and the fluorescence intensity in the red and green channels was recorded.

[0048] Calcein-AM / PI staining ( Figure 14 The results showed that the AD@HG@ZIF-8 group had the most significant cell death, while the CCK8 group had the lowest cell survival rate.

Claims

1. A nanomaterial for diagnosis and treatment based on ZIF-8 and hybridization chain reaction, characterized in that, ZIF-8 includes surface-adsorbed H1, H2, and hyaluronic acid; Both H1 and H2 are hairpin structures; the nucleotide sequences of H1 and H2 are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively, and the 11th nucleotide of H1 is modified with a quenching group; the 56th nucleotide of H1 is modified with a fluorescent group. The ZIF-8 internally encapsulates glucose oxidase and heme chloride.

2. The nanotherapeutic material according to claim 1, characterized in that, The fluorescent group and quenching group are selected from FAM and BHQ1, TAMRA and BHQ3, or Cy3 and BHQ2.

3. A method for preparing nanotherapeutic materials as described in claim 1 or 2, characterized in that, Includes the following steps: (1) Add Zn(NO3)2·6H2O solution to 2-methylimidazole solution, and add glucose oxidase and heme chloride at the same time. After the reaction, separate the product, wash and dry it to obtain ZIF-8 nanoparticles HG@ZIF-8 co-encapsulated with glucose oxidase and heme chloride. (2) The hairpin structure H1 and H2 are mixed with the HG@ZIF-8 prepared in step (1) and hyaluronic acid in a buffer solution, stirred and incubated at room temperature, and the product is separated and collected for purification to obtain HG@ZIF-8 nanoparticles adsorbed with H1, H2 and hyaluronic acid, i.e. nanotherapeutic materials. In step (1), the molar ratio of Zn(NO3)2·6H2O to 2-methylimidazole is 1:4-20; preferably 1:10-20; the molar ratio of Zn(NO3)2·6H2O to heme chloride is 3-7:1; and the ratio of glucose oxidase to Zn(NO3)2·6H2O is 100-200:1 U / μmol. In step (2), the molar ratio of H1 to H2 is 1:1; the ratio of H1, HG@ZIF-8 and hyaluronic acid is (1-5) mol: (0.5-1) g: (2-4) mg / mL.

4. The preparation method according to claim 3, characterized in that, In step (2), the H1 or H2 of the hairpin structure is obtained by thermal denaturation of the corresponding oligonucleotide of H1 or H2 followed by ice annealing.

5. The use of a nanotherapeutic material as described in claim 1 or 2 in the preparation of reagents or drugs.

6. A reagent or drug prepared from a nanotherapeutic material as described in claim 1 or 2.

7. The drug according to claim 6, characterized in that, The drug is an anti-tumor drug, and the tumor is a tumor that highly expresses miR-21.

8. The medicament according to claim 7, characterized in that, The tumors mentioned are triple-negative breast cancer, non-small cell lung cancer, cholangiocarcinoma, pancreatic cancer, rectal cancer, thyroid cancer, nasopharyngeal carcinoma, laryngeal cancer, oral cancer, and glioma.

Images