Quinoline compounds, pharmaceutical compositions and uses thereof

Abstract

The application relates to the field of medicinal chemistry, and specifically provides quinoline compounds, a pharmaceutical composition and purposes thereof, the compound has a structure shown in formula (I): formula (I); wherein, G1-G4, R1-R2, W, Y are as defined in the description, the compound provided by the application has antitumor, weight loss, anti-fatty liver, blood lipid reduction and blood sugar reduction activities.

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical technology, specifically to quinoline compounds, pharmaceutical compositions, and their uses. Background Technology

[0002] Cancer is one of the leading causes of death worldwide, with its incidence and mortality rates rising annually. Traditional cancer treatments, such as surgery, radiotherapy, and chemotherapy, while achieving some efficacy, still have many limitations, such as significant side effects and the tendency to develop drug resistance. Therefore, the development of novel, highly effective, and low-toxicity cancer treatments is urgently needed.

[0003] In recent years, targeting tumor cell energy metabolism has become a novel strategy for cancer treatment. Mitochondria, as the cell's energy factories, play a crucial role in the growth, proliferation, and survival of tumor cells. Mitochondrial RNA polymerase (POLRMT) is a key enzyme in mitochondrial DNA transcription, responsible for transcribing mitochondrial-encoding genes, thereby regulating mitochondrial biosynthesis and function.

[0004] Studies have shown that POLRMT is highly expressed in various tumor cells, and its activity is closely related to tumor cell proliferation, invasion, and metastasis. Inhibiting POLRMT activity can significantly inhibit tumor cell growth, induce apoptosis, and enhance their sensitivity to chemotherapeutic drugs. The first reported attempt to target mitochondria for obesity treatment appeared in the 1930s, when over 100,000 people received the uncoupling agent dinitrophenol (DNP). While this treatment increased metabolic rate and reduced obesity, severe side effects prevented DNP from becoming a mature treatment. Metformin offers an alternative approach by inhibiting oxidative phosphorylation (OXPHOS). This mild mitochondrial complex I (CI) inhibitor is widely used as an antidiabetic drug and can also prevent cancer. POLRMT is aberrantly expressed in obese individuals, and its activity is closely related to fat accumulation and energy metabolism disorders. Inhibiting POLRMT activity can promote lipolysis, inhibit liposynthesis, and improve insulin sensitivity, thereby exerting an anti-obesity effect. Therefore, POLRMT has become a potential target for cancer and obesity treatment.

[0005] Patent document (WO2020 / 188049A1) discloses a quinoline derivative with substitutions at positions 2, 4, and 7, and states that this quinoline derivative can be used as a specific POLRMT inhibitor for cancer treatment. However, these POLRMT inhibitors exhibit poor antitumor activity. Summary of the Invention

[0006] Therefore, one object of the present invention is to provide quinoline compounds, pharmaceutical compositions and their uses to enhance antitumor activity.

[0007] In a first aspect, this application provides a quinoline compound of formula (I) or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals:

[0008] Formula (I); Wherein, G1, G2, G3, and G4 are independently selected from H, halogen, cyano, amino, hydroxyl, or C1-C6 alkyl, and G1, G2, and G3 are not simultaneously H; W is selected from 6- to 10-membered aryl, 5- to 10-membered heteroaryl, 3- to 8-membered heterocyclic alkyl, or -NR5R6; the heteroaryl or heterocyclic alkyl contains 1 to 3 heteroatoms selected from N, O, or S; the aryl, heteroaryl, or heterocyclic alkyl is optionally surrounded by 1 to 4 R atoms. t0 Replaced by, R t0 They may be the same or different, each independently selected from halogens, C1-C6 alkyl groups, halogen-substituted C1-C6 alkyl groups, C1-C6 alkoxy groups, halogen-substituted C1-C6 alkoxy groups, or at least a pair of R groups. t0 The atoms connected together form a 4- to 10-membered carbon ring or a 5- to 10-membered heterocycle, wherein the heterocycle contains 1 to 2 heteroatoms selected from N, O or S; R5 and R6 are independently selected from H or C1-C6 alkyl groups; R1 and R2 are independently selected from H, halogen, cyano, amino, hydroxyl or C1-C6 alkyl, or R1 and R2 and their attached carbon atoms are connected together to form a 3 to 5-membered cycloalkyl group; Y is selected from -NR3R4; R3 and R4 are independently selected from H, cyano, hydroxyl, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted 6- to 10-membered aryl, unsubstituted or substituted 5- to 10-membered heteroaryl, unsubstituted or substituted 3- to 8-membered cycloalkyl, unsubstituted or substituted 3- to 8-membered heterocycloalkyl, or R3 and R4 form an unsubstituted or substituted 4- to 8-membered heterocycle with the N atom attached to them. Substitution means that the H atom on the alkyl, aryl, heteroaryl, cycloalkyl, heterocycloalkyl, or heterocycle is substituted by one or more of -COOH, C1-C3 alkyl, hydroxyl, halogen, or ester group; the heteroaryl, heterocycloalkyl, or heterocycle contains 1 to 3 heteroatoms selected from N, O, or S.

[0009] Unless otherwise stated, the terms used in this specification shall have the following meanings.

[0010] The carbon, hydrogen, oxygen, sulfur, nitrogen, or F, Cl, Br, I involved in the groups and compounds described in this invention include their isotopes, and the carbon, hydrogen, oxygen, sulfur, or nitrogen involved in the groups and compounds described in this invention may optionally be further replaced by one or more of their corresponding isotopes, wherein the isotopes of carbon include 12 C 13 C and 14 C, Isotopes of hydrogen include protium (H), deuterium (D, also called heavy hydrogen), and tritium (T, also called superheavy hydrogen). Isotopes of oxygen include... 16 O、 17 O and 18 O, isotopes of sulfur include 32 S, 33 S, 34 S and 36 S, nitrogen isotopes include 14 N and 15 N, isotopes of fluorine include 17 F and 19 F, isotopes of chlorine include 35 Cl and 37 Cl, isotopes of bromine include 79 Br and 81 Br.

[0011] "alkyl" refers to a straight-chain or branched saturated aliphatic hydrocarbon group with 1 to 20 carbon atoms, preferably an alkyl group with 1 to 8 carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8), more preferably an alkyl group with 1 to 6 carbon atoms, and even more preferably an alkyl group with 1 to 4 carbon atoms. Non-limiting examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, neobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, and various branched isomers thereof; when the alkyl group is substituented, it may optionally be further substituted by one or more substituents.

[0012] "Alkoxy" refers to a group formed by replacing at least one carbon atom in an alkyl group with an oxygen atom. (Non-limiting examples) This includes methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, n-hexoxy, cyclopropoxy, and cyclobutoxy. The definition of alkyl is the same as that of "alkyl" as described above.

[0013] "Aryl" refers to a substituted or unsubstituted aromatic ring, which can be a 5- to 8-membered (e.g., 5, 6, 7, 8-membered) monocyclic ring, a 5- to 12-membered (e.g., 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic ring, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system. It can be a bridged ring or a spirocyclic ring. Non-limiting examples include phenyl and naphthyl groups. The aryl group may optionally be further substituted by one or more substituents.

[0014] "Heteroaryl" refers to a substituted or unsubstituted aromatic ring, which can be a 3- to 8-membered (e.g., 3, 4, 5, 6, 7, 8-membered) monocyclic ring, a 5- to 12-membered (e.g., 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic ring, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system, and contains 1 to 6 (e.g., 1, 2, 3, 4, 5, 6) heteroatoms selected from N, O, or S, preferably 5- to 8-membered heteroaryl. The 1 to 4 (e.g., 1, 2, 3, 4) N and S atoms selectively substituted in the ring of the heteroaryl can be oxidized to various oxidation states. The heteroaryl group can be attached to a heteroatom or a carbon atom. The heteroaryl group can be a bridged ring or a spiro ring. Non-limiting examples include cyclopyridyl, furanyl, thiophenyl, pyranyl, pyrrolidinyl, pyrimidinyl, pyrazinyl, pyridazinyl, imidazolyl, piperidinylbenzimidazolyl, benzopyridyl, and pyrrolopyridyl. The heteroaryl group may optionally be further substituted with one or more substituents.

[0015] "Carbocyclic group" or "carbocyclic" refers to a saturated or unsaturated aromatic ring or non-aromatic ring. When it is an aromatic ring, its definition is the same as that of "aryl" above; when it is a non-aromatic ring, it can be a monocyclic ring of 3 to 10 members (e.g., 3, 4, 5, 6, 7, 8, 9, 10 members), a bicyclic ring of 4 to 12 members (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12 members), or a tricyclic system of 10 to 15 members (e.g., 10, 11, 12, 13, 14, 15 members). It can be a bridged ring or a spirocyclic ring. Non-limiting examples include cyclopropyl, cyclobutyl, cyclopentyl, 1-cyclopentyl-1-enyl, 1-cyclopentyl-2-enyl, 1-cyclopentyl-3-enyl, cyclohexyl, 1-cyclohexyl-2-enyl, 1-cyclohexyl-3-enyl, cyclohexenyl, cyclohexadienyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cycloundecyl, and cyclododecyl. The “carbocyclic group” or “carbocyclic” may optionally be further replaced by one or more substituents.

[0016] "Heterocyclic group" or "heterocycle" refers to a saturated or unsaturated aromatic heterocycle or a non-aromatic heterocycle. When it is an aromatic heterocycle, its definition is the same as the definition of "heteroaryl" above. When it is a non-aromatic heterocycle, it can be a 3- to 10-membered (e.g., 3, 4, 5, 6, 7, 8, 9, 10-membered) monocyclic, a 4- to 12-membered (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system, and contains 1 to 4 (e.g., 1, 2, 3, 4) heteroatoms selected from N, O, or S, preferably a 3- to 8-membered heterocyclic group. The selectively substituted 1 to 4 (e.g., 1, 2, 3, 4) N and S atoms in the ring of the "heterocyclic group" or "heterocycle" can be oxidized to various oxidation states; the "heterocyclic group" or "heterocycle" can be attached to a heteroatom or a carbon atom; the "heterocyclic group" or "heterocycle" can be a bridged ring or a spirocycle. Non-limiting examples of the "heterocyclic group" or "heterocycle" include epoxyethyl, epoxypropyl, azirropropyl, oxacyclobutyl, azirrobutyl, thioheterobutyl, 1,3-dioxopentyl, 1,4-dioxopentyl, 1,3-dioxahexacycloyl, azirroheptyl, oxacycloheptyl, thioheterobutyl, oxazorphinyl, diazorphinyl, thioazorphinyl, pyridinyl, piperidinyl, homopiperidinyl, furfural, etc. nylonyl, thiophenyl, pyranyl, N-alkylpyrroleyl, pyrimidinyl, pyrazinyl, pyridazinyl, piperazinyl, homopiperazinyl, imidazolyl, piperidinyl, morpholinyl, thiomorpholinyl, thiaxylalkyl, 1,3-dithiaalkyl, dihydrofuranyl, dithiapentanecycloyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiaranyl, tetrahydropyrroleyl, tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydropyranyl, benzimidyl Azolyl, benzopyridyl, pyrrolopyridyl, benzodihydrofuranyl, 2-pyrrolinyl, 3-pyrrolinyl, dihydroindolyl, 2H-pyranyl, 4H-pyranyl, dioxacyclohexyl, 1,3-dioxopentyl, pyrrolinyl, dithiaalkyl, dithiamonyl, dihydrothiophenyl, pyrazolyl, imidazolinyl, imidazolinyl, 1,2,3,4-tetrahydroisoquinolinyl, 3-azabicyclo[3] [1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, azabicyclo[2.2.2]hexyl, 3H-indolylquinazinyl, N-pyridylurea, 1,1-dioxothiomorpholinyl, azabicyclo[3.2.1]octyl, azabicyclo[5.2.0]nonyl, oxatricyclo[5.3.1.1]dodecyl, azaadamantyl, and oxaspiro[3.3]heptyl. The “heterocyclic group” or “heterocycle” may optionally be further substituted with one or more substituents.

[0017] "Cycloalkyl" refers to a saturated cycloalkyl group whose ring can be a 3- to 10-membered (e.g., 3, 4, 5, 6, 7, 8, 9, 10-membered) monocyclic ring, a 4- to 12-membered (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic ring, or a 10- to 20-membered (e.g., 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20-membered) polycyclic system, preferably with 3 to 10 carbon atoms, more preferably with 3 to 8 carbon atoms. Non-limiting examples of "cycloalkyl" include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 1,5-cyclooctadienyl, 1,4-cyclohexadienyl, and cyclohepttrienyl, etc. When the cycloalkyl group is substituted, it may optionally be further substituted by one or more substituents.

[0018] "Heterocyclic alkyl" refers to a substituted or unsubstituted saturated non-aromatic cyclic group, which can be a 3- to 8-membered (e.g., 3, 4, 5, 6, 7, 8-membered) monocyclic, a 4- to 12-membered (e.g., 4, 5, 6, 7, 8, 9, 10, 11, 12-membered) bicyclic, or a 10- to 15-membered (e.g., 10, 11, 12, 13, 14, 15-membered) tricyclic system, and contains 1, 2, or 3 heteroatoms from N, O, or S, preferably a 3- to 8-membered heterocyclic group. The 1, 2, or 3 N or S atoms selectively substituted in the ring of the "heterocyclic alkyl" can be oxidized to various oxidation states; the "heterocyclic alkyl" can be attached to a heteroatom or a carbon atom; the "heterocyclic alkyl" can be a bridged ring or a spirocyclic ring. Non-limiting examples of "heterocyclic alkyl" include epoxyethyl, aziridine, oxacyclobutyl, aziridine, 1,3-dioxolanecycloyl, 1,4-dioxolanecycloyl, 1,3-dioxahexacycloyl, aziridine, piperidinyl, piperinyl, morpholinyl, thiomorpholinyl, 1,3-dithiaalkyl, tetrahydrofuranyl, tetrahydropyrroleyl, tetrahydroimidazolyl, tetrahydrothiazolyl, tetrahydropyranyl, aziridine[3.2.1]octyl, aziridine[5.2.0]nonyl, oxacyclo[5.3.1.1]dodecyl, aziridine, and oxaspiro[3.3]heptyl.

[0019] When the terms "alkyl", "alkoxy", "aryl", "heteroaryl", "carbocyclic", "carbocyclic", "heterocyclic", "cycloalkyl", "heterocyclic", or "heterocyclic" mentioned above are substituted, they may be further replaced by 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 selected from F, Cl, Br, I, hydroxyl, mercapto, nitro, cyano, amino, C 1-6 Alkylamino, =O, C 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 alkenyl, C 2-6 alkynyl, -NR t4 Rt5 ,=NR t6 ,-C(=O)OC 1-6 Alkyl group, -OC(=O)C 1-6 Alkyl, -C(=O)NR t4 R t5 C 3-8 cycloalkyl, C 3-8 Heterocyclic alkyl, C 6-10 Aryl, C 5-10 heteroaryl, -C(=O)OC 6-10 Aryl, -OC(=O)C 6-10 Aryl, -OC(=O)C 5-10 heteroaryl, -C(=O)OC 5-10 heteroaryl, -OC(=O)C 3-8 Heterocyclic alkyl, -C(=O)OC 3-8 Heterocyclic alkyl groups, -OC(=O)C 3-8 Cycloalkyl, -C(=O)OC 3-8 cycloalkyl, -NHC(=O)C 3-8 Heterocyclic alkyl groups, -NHC(=O)C 6-10 Aryl, -NHC(=O)C 5-10 heteroaryl, -NHC(=O)C 3-8 cycloalkyl, -NHC(=O)C 3-8 Heterocyclic alkyl groups, -NHC(=O)C 2-6 alkenyl or -NHC(=O)C 2-6 The alkynyl group is replaced by a substituent, and the substituent C is described in the figure. 1-6 Alkyl, C 1-6 Alkoxy, C 2-6 alkenyl, C 2-6 alkynyl group, C 3-8 cycloalkyl, C 3-8 Heterocyclic alkyl, C 6-10 Aryl, C 5-10 heteroaryl, -NHC(=O)C 6-10 Aryl, -NHC(=0)C 5-10 heteroaryl, -NHC(=O)C 3-8 Heterocyclic alkyl groups or -NHC(=O)C 3-8 The cycloalkyl group may optionally be further surrounded by one to three elements selected from OH, F, Cl, Br, I, C. 1-6 Alkyl, C 1-6 Alkoxy, -NR t4 R t5 Or it is replaced by a substituent of =O; where R t4 R t5 Selected from H, C 1-6 Alkyl group, -NH (C=NR)t1 )NR t2 R t3 -S(=O)2NR t2 R t3 -C(=O)R t1 Or -C(=0)NR t2 R t3 , where R t1 Selected from C 1-6 Alkyl, C 1-6 Alkoxy or C 6-10 Aryl; R t2 R t3 Selected from H or C 1-6 Alkyl; wherein the C 1-6 The alkyl group may optionally be further influenced by one or more elements selected from OH, F, Cl, Br, I, and C. 1-6 Alkyl, C 1-6 Alkoxy, C 6-10 Aryl, C 5-10 heteroaryl, C 3-8 cycloalkyl or C 3-8 Substituents of heterocyclic alkyl groups; or R t4 With R t5 The N atom forms a 3- to 8-membered heterocycle, which may contain one or more heteroatoms selected from N, O or S.

[0020] The terms "halogen," "halogen atom," or "halogen atom" used in this invention include fluorine, chlorine, bromine, and iodine. Furthermore, W is selected from 6- to 10-membered aryl, 5- to 6-membered heteroaryl, 5- to 6-membered heterocyclic alkyl, or -NR5R6; the heteroaryl or heterocyclic alkyl contains 1 to 2 heteroatoms selected from N or O, R5 and R6 are independently selected from C1-C3 alkyl groups, and the aryl group is optionally surrounded by 1 to 3 R atoms. t0 Replaced by, R t0 The elements, whether identical or different, are independently selected from halogens, C1-C6 alkyl groups, or halogen-substituted C1-C6 alkyl groups; preferably, W is selected from phenyl groups, wherein the phenyl group is optionally denoted by one or two R atoms. t0 Replaced by, R t0 The elements, whether identical or different, are independently selected from F, Cl, methyl, ethyl, or trifluoromethyl; more preferably, W is selected from phenyl, wherein the phenyl group is denoted by one R. t0 Replaced by, R t0 Selected from F, Cl, or methyl.

[0021] Furthermore, W is selected from the following structure: , , , , , , , , , , Or -NR5R6, R t0 The definitions of R5 and R6 are as described above.

[0022] Furthermore, G4 is selected from H.

[0023] Furthermore, G1, G2, G3 and G4 are independently selected from H, halogen or C1-C3 alkyl groups, and G1, G2 and G3 are not simultaneously H; preferably, G1, G2, G3 and G4 are independently selected from H, F, Cl, methyl or ethyl, and G1, G2 and G3 are not simultaneously H.

[0024] Furthermore, the quinoline compounds have the following structures (II)-(IV):

[0025] In formula (II), G1 is selected from halogens or C1-C3 alkyl groups; preferably F or methyl. In formula (III), G2 is selected from halogens or C1-C3 alkyl groups; preferably F or methyl. In formula (IV), G3 is selected from halogens or C1-C3 alkyl groups; preferably F or methyl.

[0026] Furthermore, R1 and R2 are independently selected from H or C1-C3 alkyl groups, or R1 and R2 and their associated carbon atoms are linked together to form a 3- to 5-membered cycloalkyl group; preferably, R1 and R2 are independently selected from H or C1-C3 alkyl groups.

[0027] Furthermore, R1 and R2 are independently selected from H or methyl; preferably, R1 is selected from H and R2 is selected from methyl.

[0028] Furthermore, R1 and R2 are not both H.

[0029] Furthermore, R3 and R4 are independently selected from H, unsubstituted or substituted C1-C6 alkyl groups, 6- to 8-membered aryl groups, 5- to 6-membered heteroaryl groups, 3- to 5-membered cycloalkyl groups, or R3 and R4 form an unsubstituted or substituted 4- to 6-membered saturated heterocycle with the N atom attached to them, wherein the saturated heterocycle contains 1 to 2 heteroatoms selected from N, O, or S; substitution means that the H atom on the alkyl group or saturated heterocycle is replaced by one or more of -COOH, C1-C3 alkyl groups, hydroxyl groups, F, Cl, and C2-C5 carboxylic acid ester groups; preferably, R3, R4 is independently selected from H, methyl, ethyl, n-propyl, isopropyl, hydroxy-substituted ethyl, hydroxy-substituted n-propyl, phenyl, pyridyl, cyclopropyl, or R3 and R4 form an unsubstituted azirocyclohexyl, carboxyl-substituted azirocyclohexyl, oxazirocyclohexyl, ethyl carboxylate-substituted azirocyclohexyl, fluorine-substituted azirocyclohexyl, or azirocyclopentyl with the N atom attached to them; more preferably, R3 is selected from H, R4 is selected from hydroxy-substituted n-propyl, or R3 and R4 form an unsubstituted azirocyclohexyl or carboxyl-substituted azirocyclohexyl with the N atom attached to them.

[0030] Furthermore, R3 and R4 are not both H.

[0031] Furthermore, the quinoline compounds have the following (VI) structure:

[0032] (VI); Among them, G1, G2, G3, G4, W, Y, and R2 are as defined in any of the preceding items.

[0033] Furthermore, the quinoline compounds have the following (V) structure:

[0034] Formula (V); Among them, G1, G2, G3, G4, W, and R2 are as defined in any of the preceding items.

[0035] R9 is selected from H or C1-C6 alkyl groups; preferably H or methyl.

[0036] Furthermore, the quinoline compounds have the following structures:

[0037] .

[0038] This application also provides a pharmaceutical composition comprising any of the quinoline compounds described above or their stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts or cocrystals, and optionally a pharmaceutically acceptable carrier.

[0039] This application also provides the use of any of the quinoline compounds or their stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts or cocrystals described above, or the pharmaceutical compositions described above, in the preparation of mitochondrial RNA polymerase inhibitors.

[0040] This application also provides the use of any of the quinoline compounds or their stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts or cocrystals described above, or the pharmaceutical compositions described above, in the preparation of antitumor drugs or weight-loss drugs. Preferably, the tumor includes melanoma, liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, colorectal cancer, or ovarian cancer.

[0041] This application also provides the use of any of the quinoline compounds or their stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts or cocrystals described above, or the pharmaceutical compositions described above, in the preparation of a medicament having one or more of the following effects: lipid-lowering, hypoglycemic, anti-fatty liver, promoting insulin secretion, or improving insulin sensitivity.

[0042] This application also provides the use of any of the quinoline compounds or their stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts or cocrystals described above, or the pharmaceutical compositions described above, in the preparation of medicaments for the prevention or treatment of diabetes or fatty liver disease.

[0043] This application also provides intermediates of any of the quinoline compounds described above, wherein the intermediates are selected from compounds having the structures shown in formulas (VII), (VIII), (IX), (X), (XI), (XII), and (XIII):

[0044] G1, G2, G3, G4, R1, R2, W are as defined in any of the above categories; X1 is selected from halogens; R7 is selected from C1-C6 alkyl groups; R8 is selected from C1-C6 alkyl groups.

[0045] Furthermore, R7 is selected from methyl, ethyl, or propyl. Furthermore, R8 is selected from methyl, ethyl, or propyl. Furthermore, X1 is selected from Cl or Br.

[0046] The pharmaceutically acceptable compositions of the present invention further comprise pharmaceutically acceptable carriers, such as those used in the present invention, including any solvent, diluent, or other liquid excipient, dispersant or suspending agent, surfactant, isotonic agent, thickener, emulsifier, preservative, solid binder or lubricant, etc. Substances that can serve as pharmaceutically acceptable carriers include, but are not limited to, ion exchangers, aluminum, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffering substances such as phosphates, glycine, sorbic acid, potassium sorbate, partially glycerol ester mixtures of saturated vegetable fatty acids, water, salts or electrolytes such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, polyol, waxes, polyethylene-polyoxymethylene-blocking polymers, lanolin, sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as carboxymethyl cellulose. Sodium thiosulfate, ethyl cellulose and cellulose acetate; gum powder; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic salts; Ringer's solution; ethanol, phosphate buffer solutions, and other non-toxic and suitable lubricants such as sodium lauryl sulfate and magnesium stearate, colorants, release agents, coatings, sweeteners, flavorings and spices, preservatives and antioxidants.

[0047] "Pharmaceutically acceptable salt" or "its pharmaceutically acceptable salt" refers to a salt in which the compound of the present invention retains the bioavailability and properties of a free acid or free base, and the free acid is obtained by reacting with a non-toxic inorganic or organic base, and the free base is obtained by reacting with a non-toxic inorganic or organic acid. Pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts with a base group such as an amine (amino) group. Examples include salts formed with inorganic acids such as phosphoric acid, sulfuric acid, and hydrochloric acid, or organic acids such as acetic acid, tartaric acid, citric acid, and malic acid, or acidic amino acids such as aspartic acid and glutamic acid, or salts formed by esterifying or amideing the above acids and then reacting with an inorganic base, such as sodium, potassium, calcium, aluminum, or ammonium salts. Salts formed with an acid group such as a sulfonic acid group and an inorganic base, such as sodium, potassium, calcium, aluminum, or ammonium salts.

[0048] "Pharmaceutical composition" refers to a mixture of one or more compounds described in this invention, their pharmaceutically acceptable salts or prodrugs, and other chemical components, wherein "other chemical components" refers to pharmaceutically acceptable carriers, excipients, and / or one or more other therapeutic agents.

[0049] "Carrier" refers to a material that does not cause significant stimulation to an organism and does not eliminate the biological activity and properties of the compound given.

[0050] "Excipients" are inert substances added to a pharmaceutical composition to facilitate administration of the compound. Non-limiting examples include calcium carbonate, calcium phosphate, sugar, starch, cellulose derivatives (including microcrystalline cellulose), gelatin, vegetable oils, polyethylene glycols, diluents, granulating agents, lubricants, binders, and disintegrants.

[0051] "Prodrug" refers to a compound of the present invention that can be metabolized in vivo and converted into a biologically active compound. The prodrug of the present invention is prepared by modifying the amino or carboxyl groups in the compound of the present invention. This modification can be performed through conventional procedures or removed in vivo to obtain the parent compound. When the prodrug of the present invention is administered to a mammalian individual, the prodrug is cleaved to form free amino or carboxyl groups.

[0052] "Co-crystal" refers to a crystal formed by the bonding of an active pharmaceutical ingredient (API) and a co-crystal form (CCF) through hydrogen bonds or other non-covalent bonds. Both API and CCF are solids in their pure states at room temperature, and a fixed stoichiometric ratio exists between the components. Co-crystal is a multi-component crystal, encompassing both binary eutectics formed between two neutral solids and multi-component eutectics formed between a neutral solid and a salt or solvate.

[0053] "Stereoisomers" are isomers that are produced by different spatial arrangements of atoms in a molecule, including cis-trans isomers, enantiomers, and conformational isomers.

[0054] "Metabolic products" refer to the products obtained from the metabolism of a specific compound or its salt in vivo. The metabolites of a compound can be identified using techniques known in the art, and their activity can be characterized by experimental methods as described in this invention. Such products can be obtained by administering the compound through oxidation, reduction, hydrolysis, acylation, deacylation, esterification, defatting, enzymatic cleavage, etc. Accordingly, this invention includes the metabolites of compounds, including metabolites produced by sufficiently exposing the compounds of this invention to mammals for a period of time.

[0055] "Deuterated compound" refers to a deuterated compound formed when one or more hydrogen atoms in a compound group of formula I are replaced by deuterium.

[0056] "Solvate" refers to an association formed by one or more solvent molecules with the compounds of this invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, and aminoethanol. The term "hydrate" refers to an association formed when the solvent molecules are water.

[0057] "Optional" or "optionally" or "selectively" means that the event or condition described below may or may not occur, and the description includes both cases in which the event or condition occurs and cases in which it does not occur. For example, "optionally alkyl-substituted heterocyclic group" means that the alkyl group may or may not be present, and the description includes both cases in which the heterocyclic group is substituted with an alkyl group and cases in which the heterocyclic group is not substituted with an alkyl group.

[0058] The technical solution of this invention has the following advantages: The quinoline compounds provided by this invention can inhibit the proliferation of tumor cells by inhibiting the activity of mitochondrial RNA polymerase. They can be used as mitochondrial RNA polymerase inhibitors, especially POLRMT inhibitors. These inhibitors have good therapeutic effects on diseases related to the inhibitor and various tumor diseases, and have strong anti-cancer cell proliferation activity and strong tumor inhibition rate. In addition, they also have weight loss, anti-fatty liver, lipid-lowering and blood sugar-lowering activities. Attached Figure Description

[0059] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0060] Figure 1 This is a graph showing the results of tumor volume changes in each group of tumor-bearing mice in Experiment Example 2 of this invention; Figure 2 This is a graph showing the changes in body weight of tumor-bearing mice in each group in Experiment Example 2 of this invention; Figure 3 This refers to the weight changes of mice in each group in Experiment Example 4 of this invention; Time (Week) is time (weeks); Figure 4 These are the changes in adipose tissue in each group of mice in Experiment Example 4 of this invention; Tissue mass is tissue weight. Figure 5 This refers to the liver mass of mice in each group in Experiment Example 4 of this invention. Figure 6 shows the food intake of mice in each group in Experiment Example 4 of this invention; Figure 7 This refers to the muscle tissue weight of mice in each group in Experiment Example 4 of this invention; Figure 8 The results of the test for TC and TG content in hepatocytes in Experiment Example 5 of this invention; Figure 9The results of blood glucose and insulin tests in each group of mice in Experiment Example 6 of this invention are shown below; where A is the result of insulin in serum, B is the result of blood glucose, C is the oral glucose tolerance test (OGTT) curve, D is the area under the curve (AUC) of the oral glucose tolerance test (OGTT), E is the AUC result of the insulin tolerance test (ITT), and F is the insulin tolerance test (ITT) curve. Where * or # indicates p < 0.05, ** or ## indicates p < 0.01, *** or ### indicates p < 0.001, **** or #### indicates p < 0.0001, and ns indicates p > 0.05. Detailed Implementation

[0061] The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0062] Where specific experimental steps or conditions are not specified in the examples, they can be performed according to the conventional experimental procedures or conditions described in the literature in this field. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products. The structure of the compounds was determined by nuclear magnetic resonance (NMR) and / or mass spectrometry (MS). NMR shifts (δ) are expressed in 10⁻¹⁰ increments. -6 The unit (ppm) is given. NMR determination is performed using a Bruker Avance 500 or Bruker Avance 300 NMR spectrometer, with deuterium-containing chloroform + / (CDCl3) as the solvent and tetramethylsilane (TMS) as the internal standard.

[0063] The following synthetic methods are typical synthetic methods for the compounds disclosed in this application.

[0064]

[0065] Includes the following steps: (1): will 2,2-Dimethyl-1,3-dioxane-4,6-dione undergoes a substitution reaction with raw material 1 to produce compound (XIII); (2): Compound (XIII) undergoes a cyclization reaction in diphenyl ether to generate compound (XII); (3): Compound of formula (XII) reacts with phosphorus trihalides to produce compound of formula (XI); (4): Compounds of formula (XI) and compounds The compound of formula (X) is generated via a Suzuki coupling reaction; (5): Compound (X) undergoes a dealkylation reaction to generate compound (IX); (6): Compounds of formula (IX) and compounds The compound of formula (VIII) is formed by etherification. (7): Compound (VIII) is hydrolyzed and neutralized sequentially to form compound (VII); (8): Compound of formula (VII) reacts with YH via a condensation acylation reaction to generate compound of formula (I); Wherein, G1, G2, G3, G4, R1, R2, Y, and W are as defined above; X1 is selected from halogens; X2 is selected from halogens; R7 is selected from C1-C6 alkyl groups; and R8 is selected from C1-C6 alkyl groups.

[0066] In some embodiments, the reaction temperature in step (1) is 90-110°C, and the reaction time is 1-2 hours. During the reaction, first... 2,2-Dimethyl-1,3-dioxane-4,6-dione is refluxed for 0.5-1.5 h before adding raw material 1 to continue the reaction. In some embodiments, the reaction temperature in step (2) is 240-260 °C and the reaction time is 0.3-1 h. In some embodiments, the reaction solvent in step (3) is dichloromethane, the reaction temperature is below -5 to 5 °C, and the reaction time is 0.2-1 h (e.g., 0.5 h). In some embodiments, a metal catalyst such as tetraphenylphosphine palladium and an alkaline substance (e.g., potassium carbonate or sodium carbonate) are added to the reaction system in step (4), and a mixed solvent of toluene, ethanol, and water is used as the reaction solvent. The reaction is carried out overnight under inert gas reflux. In some embodiments, boron tribromide is used as a dealkylating agent in step (5) for the dealkylation reaction. The dealkylation reaction can be a demethylation reaction. Specifically, compound (X) is dissolved in dichloromethane, cooled to -70 to -85°C, boron tribromide is added dropwise, the temperature is raised to room temperature, and the reaction is stirred for 5-10 days. In some embodiments, in step (6), the reaction temperature is below -5 to 5°C, and the reaction time is 3-5 hours. The reaction occurs in the presence of triphenylphosphine and diisopropyl azodicarbonate. In step (7), the hydrolysis reaction is carried out in the presence of an alkaline substance (e.g., sodium hydroxide). The reaction is carried out at room temperature for 0.5-2 hours. THF and methanol may also be added to the reaction system. An acid solution (e.g., hydrochloric acid solution) is added for neutralization. In step (8), the condensation acylation reaction is carried out in the presence of HATU and DIPEA. The reaction solvent is DCM, and the reaction is carried out at room temperature for 0.5-2 hours.

[0067] For the compounds described in this invention, the step from compound (VII) to the final product is an amide condensation. Depending on the substrate, some compounds may require further ester hydrolysis or deprotection, and after deprotection, alkylation may be required.

[0068]

[0069] In some embodiments, the compound of formula (IX) and the compound The compound of formula (VIII) is synthesized via the Williamson reaction. In some embodiments, the reaction is carried out at room temperature for 2–6 hours.

[0070] Wherein, G1, G2, G3, G4, R1, R2, Y, W, and R7 are as defined above; X2 is selected from halogens. Further, X2 is selected from Cl or Br.

[0071]

[0072] In some embodiments, when W is selected from -NR5R6, R5, R6, G1, G2, G3, G4, X1, and R8 are as defined above; the compound of formula (XI) reacts with compound WH via a substitution reaction to generate the compound of formula (X). In some embodiments, the reaction is carried out in the presence of a palladium metal catalyst (e.g., palladium dichloride) and a basic substance (e.g., N,N'-dimethylethylenediamine). The reaction solvent is THF. The reaction is carried out under reflux for 8-24 hours.

[0073] Wherein, G1, G2, G3, G4, and W are as defined above; X2 is selected from halogens; R7 is selected from C1-C6 alkyl groups; and R8 is selected from C1-C6 alkyl groups.

[0074] DIAD: Diisopropyl azodicarbonate; PPh3: Triphenylphosphine; BBr3: Boron tribromide; DIAD: Diisopropyl azodicarbonate; MeOH: Methanol; HATU: 2-(7-azabenzotriazole)-N,N,N',N'-Tetramethylurea hexafluorophosphate; DCM: Dichloromethane; DIPEA: N,N-Diisopropylethylamine; THF: Tetrahydrofuran; cy-DMEDA: N,N'-Dimethylethylenediamine It will be apparent to those skilled in the art that the order of the synthetic steps depends on the availability of intermediates and the compatibility of functional groups, and can vary from compound to compound.

[0075] Experimental Example 1 Compound 1: (S)-1-((R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The preparation method of compound 1 includes the following steps: first step:

[0076] Procedure: 141.70 mmol of commercially available 2,2-dimethyl-1,3-dioxane-4,6-dione and trimethyl orthoformate (566.79 mmol) were added to a 250 mL reaction flask and refluxed for 1 h. The mixture was then cooled to room temperature, and A (70.85 mmol) was added. Reflux was continued for another 30 min. After TLC confirmed the reaction was complete, the mixture was cooled to room temperature, and the solid precipitated. The precipitate was filtered and washed with 500 mL of ice-cold ethanol to obtain crude product B.

[0077] Step Two:

[0078] Procedure: Heat 150 mL of diphenyl ether to 250 °C and stabilize for 5 minutes. Then add crude intermediate B (10 mmol) and stir for 30 min. After TLC confirms the reaction is complete, cool to room temperature. A solid precipitates out. Filter the solid and wash away the diphenyl ether with 300 mL of petroleum ether to obtain crude intermediate C.

[0079] Step 3:

[0080] Procedure: At 0°C, crude intermediate C (8 mmol) was dissolved in 30 mL of anhydrous dichloromethane, followed by slow dropwise addition of phosphorus tribromide (24 mmol). The reaction was allowed to proceed for 30 min. After TLC confirmed the reaction was complete and solid precipitated, the product was filtered and washed with 100 mL of petroleum ether to obtain crude intermediate D, which was then used directly in the next step.

[0081] Step 4:

[0082] Procedure: Intermediate D (19.53 mmol), 2-methylphenylboronic acid (21.48 mmol), tetra-triphenylphosphine palladium (5% mol), and potassium carbonate (39.05 mmol) were dissolved in a 20 mL mixture of toluene, ethanol, and water in a volume ratio of 5:1:1. The mixture was refluxed overnight under argon protection. After post-treatment, the palladium catalyst was removed by diatomaceous earth filtration. The mixture was then extracted three times with 100 mL of ethyl acetate and 100 mL of water. The organic layer was collected, the solvent was concentrated under reduced pressure, and the mixture was subjected to column chromatography (petroleum ether:ethyl acetate in a volume ratio of 1:1) to obtain intermediate E.

[0083] Step 5:

[0084] Procedure: Under argon protection, intermediate E (5 mmol) was dissolved in anhydrous dichloromethane (20 mL), cooled to -78°C, and then BBr3 (30 mmol) was slowly added dropwise to the reaction solution. The mixture was then brought to room temperature and stirred for about 6 days. The reaction solution was poured into ice water and extracted three times with 100 mL of dichloromethane and 100 mL of water. The organic layers were combined, and the solvent was concentrated under reduced pressure to obtain crude intermediate F, which was directly used in the next step.

[0085] Step 6:

[0086] Procedure: Intermediate F (3.78 mmol), PPh3 (4.92 mmol), and ethyl (S)-2-hydroxypropionate (5.68 mmol) were mixed. The reaction mixture was cooled to 0°C, and DIAD (4.92 mmol) was slowly added dropwise. After stirring at room temperature for 4 hours, the mixture was diluted with 100 mL of ethyl acetate and washed with 100 mL of saturated NaHCO3. The organic layer was dried over Na2SO4, filtered, and evaporated under vacuum. The crude product (ethyl acetate to petroleum ether volume ratio of 8) was purified by silica gel column chromatography to give intermediate G.

[0087] Step 7:

[0088] Procedure: Dissolve intermediate G (1 mmol) in THF and 2M NaOH aqueous solution and add 3 drops of MeOH until the mixture is homogeneous. Bring the reaction mixture to room temperature and stir for 1 hour, then neutralize with 2M HCl and continue stirring for 30 minutes. Extract the mixture with ethyl acetate, wash the organic phase with water, dry over Na2SO4, filter, and concentrate under reduced pressure to obtain intermediate H.

[0089] Step 8:

[0090] Procedure: Intermediate H (0.87 mmol), HATU (1.3 mmol), and ( S Ethyl piperidine-3-carboxylate (1.12 mmol) was dissolved in DCM (5 mL). DIPEA (1.3 mmol) was added, and the mixture was stirred at room temperature for 1.5 hours. The reaction mixture was diluted with 10 mL of DCM and washed successively with 10 mL of water, 10 mL of saturated NaHCO3, and 10 mL of NH4Cl solution. The organic phase was dried over Na2SO4, filtered, and the solvent was concentrated under reduced pressure. The crude product was purified by silica gel column chromatography (ethyl acetate / petroleum ether, v / v ratio 2:1) to give intermediate I.

[0091] Step 9:

[0092] Procedure: Intermediate I (1 mmol) was dissolved in THF and 2M NaOH aqueous solution, and 3 drops of MeOH were added until the mixture was homogeneous. The reaction mixture was brought to room temperature and stirred for 1–3 hours, followed by neutralization with 2M HCl and continued stirring for 30 minutes. The mixture was extracted with 50 mL of ethyl acetate, the organic phase was washed with 50 mL of water, dried over Na2SO4, filtered, concentrated under reduced pressure, and purified by column chromatography (dichloromethane to methanol, v / v ratio 20:1) to obtain target compound 1. Characterization data of compound 1 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.6 Hz, 1H), 7.45 –7.36 (m, 3H), 7.29 – 7.22 (m, 1H), 5.20 (q, J = 6.5 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6, 5.0, 3.8 Hz, 1H), 2.43 (d, J = 0.7 Hz, 3H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.62 (s, 1H). 13 C NMR (125 MHz, Chloroform- d ) δ175.74, 171.63, 152.31, 150.33, 147.08, 145.80, 145.77, 145.75, 145.66, 141.53, 141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31, 124.25, 121.67, 111.07, 110.89, 110.21, 110.16, 75.09, 75.08, 49.17, 46.57, 43.27, 26.96, 23.89, 19.67, 17.83. Example 2 Preparation of Compound 2: (S)-1-((R)-2-((6-chloro-4-(o-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 3-methoxy-4-fluoroaniline in the first step is replaced with 3-methoxy-4-chloroaniline. The characterization data of compound 2 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 8.17 (s, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.55 (d, J = 4.6 Hz, 1H), 7.45 – 7.36 (m, 3H), 7.29 – 7.22 (m, 1H), 5.21 (q, J = 6.6 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6,5.0, 3.8 Hz, 1H), 2.43 (d, J = 0.7 Hz, 3H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.60 (s, 1H). 13 C NMR (125 MHz, Chloroform- d ) δ175.74, 171.68, 154.18, 148.33, 146.76, 142.96, 138.31, 136.42, 129.89, 127.81, 127.13, 125.36, 125.34, 121.66, 120.20, 111.03, 75.60, 49.17, 46.57, 43.27, 26.96, 23.89, 19.67, 17.47. Example 3 Preparation of Compound 3: (S)-1-((R)-2-((6-methyl-4-(o-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 3-methoxy-4-fluoroaniline in the first step is replaced with 3-methoxy-4-methylaniline. The characterization data of compound 3 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.61 (d, J = 4.6 Hz, 1H), 8.06 (d, J =0.9 Hz, 1H), 7.63 (dd, J = 7.7, 1.3 Hz, 1H), 7.54 (d, J = 4.7 Hz, 1H), 7.45 –7.36 (m, 2H), 7.25 (td, J = 7.6, 1.3 Hz, 1H), 5.17 (q, J = 6.6 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6, 5.0, 3.8 Hz, 1H), 2.43 (d, J = 0.7 Hz, 3H), 1.99 – 1.82(m, 2H), 1.81 – 1.65 (m, 2H), 1.61 (d, J = 6.6 Hz, 2H). 13 C NMR (125 MHz, Chloroform- d) δ 175.74, 171.86, 156.94, 149.08, 146.75, 143.54, 138.38,135.84, 129.89, 127.81, 127.13, 125.61, 125.43, 123.48, 120.81, 105.45,75.26, 49.16, 46.58, 43.27, 26.96, 23.89, 19.67, 17.56, 16.20. Example 4 Compound 4: (S)-1-((R)-2-((6-ethyl-4-(o-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 3-methoxy-4-fluoroaniline in the first step is replaced with 3-methoxy-4-ethylaniline. The characterization data for compound 4 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.64 (d, J = 4.6 Hz, 1H), 7.67 – 7.59(m, 2H), 7.57 (d, J = 4.6 Hz, 1H), 7.45 – 7.36 (m, 2H), 7.25 (td, J = 7.6, 1.3Hz, 1H), 5.13 (q, J = 6.4 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J =11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.82 – 2.72 (m, 2H), 2.68 (dddd, J =7.7, 6.6, 5.0, 3.8 Hz, 1H), 2.43 (d, J = 0.7 Hz, 3H), 1.99 – 1.82 (m, 2H), 1.81– 1.65 (m, 2H), 1.62 (s, 1H), 1.23 (t, J = 7.3 Hz, 3H). 13 C NMR (125 MHz, Chloroform- d) δ 175.74, 171.81, 156.23, 149.47, 146.75, 143.62, 138.38,135.89, 129.89, 128.88, 127.81, 127.13, 124.86, 123.49, 120.71, 107.81,75.44, 49.16, 46.58, 43.27, 26.96, 23.89, 23.30, 19.67, 17.56, 14.36. Example 5 Compound 5: (S)-1-((R)-2-((8-chloro-4-(o-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 3-methoxy-4-fluoroaniline in the first step is replaced with 2-chloro-3-methoxyaniline. The characterization data for compound 5 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.54 (d, J = 4.6 Hz, 1H), 8.00 (d, J =9.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.56 (d, J = 4.5 Hz, 1H), 7.45 –7.36 (m, 2H), 7.29 – 7.22 (m, 1H), 7.05 (d, J = 9.2 Hz, 1H), 5.21 (q, J = 6.4 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 –3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6, 5.0, 3.8 Hz, 1H), 2.43 (d, J = 0.7 Hz, 3H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.60 (s, 1H). 13 C NMR (125 MHz, Chloroform- d) δ 175.74, 171.68, 153.50, 146.98, 146.06, 142.29, 138.36,138.18, 129.91, 129.90, 127.81, 127.13, 126.15, 124.99, 120.89, 120.57,117.62, 75.56, 49.17, 46.57, 43.27, 26.96, 23.89, 19.67, 17.79. Example 6 Compound 6: (S)-1-(1-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)cyclobutane-1-carbonyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that step six is ​​modified to the following reaction. Step 6:

[0093] Procedure: Intermediate F (3.78 mmol), K₂CO₃ (4.92 mmol), and ethyl 1-bromocyclobutane carboxylate (5.68 mmol) were dissolved in 20 mL of THF. After stirring at room temperature for 4 hours, the mixture was diluted with 100 mL of ethyl acetate and washed with 100 mL of saturated NaHCO₃. The organic layer was dried over Na₂SO₄, filtered, and evaporated under vacuum. The crude product (ethyl acetate / petroleum ether = 8) was purified by silica gel column chromatography to give intermediate G1.

[0094] The characterization data for compound 6 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.83 – 7.77(m, 2H), 7.59 (d, J = 4.3 Hz, 1H), 7.43 (d, J = 4.6 Hz, 1H), 7.41 – 7.35 (m, 2H), 7.27 (td, J = 7.5, 1.2 Hz, 1H), 3.68 (d, J = 4.0 Hz, 2H), 3.44 – 3.36 (m, 1H), 3.34 – 3.26 (m, 1H), 2.67 (dddd, J = 7.9, 6.2, 4.1, 0.9 Hz, 1H), 2.43 (d, J= 0.7Hz, 3H), 2.34 – 2.19 (m, 4H), 1.89 – 1.72 (m, 5H), 1.71 – 1.60 (m, 1H). 13 C NMR (125 MHz, Chloroform- d ) δ 174.91, 167.48, 152.04, 150.06, 145.71, 145.47,145.42, 145.27, 145.14, 139.87, 139.84, 137.31, 136.61, 129.49, 129.27,127.57, 126.06, 125.44, 125.38, 120.91, 112.12, 112.07, 110.12, 109.94,87.19, 87.16, 47.17, 45.66, 41.73, 31.40, 26.48, 23.65, 19.84, 15.69. Example 7 Compound 7: (S)-1-((R)-2-((5-chloro-4-(o-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 3-methoxy-4-fluoroaniline in the first step is replaced with 3-chloro-5-methoxyaniline. The characterization data for compound 7 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.60 (d, J = 4.6 Hz, 1H), 7.63 (dd, J =7.7, 1.2 Hz, 1H), 7.49 (d, J = 4.6 Hz, 1H), 7.45 – 7.35 (m, 2H), 7.25 (td, J =7.6, 1.3 Hz, 1H), 7.21 (d, J = 2.0 Hz, 1H), 7.09 (s, 0H), 5.11 (q, J = 6.6 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 –3.32 (m, 2H), 2.68 (dddd, J= 7.7, 6.6, 5.0, 3.8 Hz, 1H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.36 (d, J = 6.4 Hz, 3H). 13 C NMR (125 MHz, Chloroform- d ) δ175.74, 171.78, 156.20, 150.67, 147.48, 142.94, 139.05, 138.25, 135.09,129.87, 129.01, 127.83, 127.14, 122.18, 122.05, 118.86, 109.63, 74.59, 49.16,46.58, 43.27, 26.96, 23.89, 19.67, 17.54. Example 8 Compound 8: (S)-1-((R)-2-((4-(2-chlorophenyl)-6-methylquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 3, except that 2-methylphenylboronic acid in step four is replaced with 2-chlorophenylboronic acid. The characterization data for compound 8 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.62 (d, J = 4.8 Hz, 1H), 8.11 – 8.07(m, 0H), 7.69 (dd, J = 7.6, 1.3 Hz, 1H), 7.55 (d, J = 4.7 Hz, 1H), 7.49 – 7.37(m, 2H), 7.35 – 7.28 (m, 1H), 5.17 (q, J = 6.6 Hz, 1H), 3.77 (dd, J = 11.5, 3.8Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J =7.7, 6.6, 5.0, 3.8 Hz, 1H), 2.27 (s, 2H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65(m, 2H), 1.62 (s, 1H). 13C NMR (125 MHz, Chloroform- d ) δ 175.74, 171.86,156.98, 149.37, 147.27, 142.61, 135.04, 134.94, 132.04, 129.74, 129.63,128.30, 126.04, 125.43, 123.41, 120.97, 105.45, 75.26, 49.16, 46.58, 43.27,26.96, 23.89, 17.56, 16.20. Example 9 Compound 9: (S)-1-((R)-2-((4-(2-chlorophenyl)-6-fluoroquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 2-chlorophenylboronic acid. The characterization data for compound 9 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.64 (d, J = 4.6 Hz, 1H), 7.96 (d, J =12.1 Hz, 1H), 7.71 (dd, J = 7.6, 1.3 Hz, 1H), 7.57 (d, J = 4.5 Hz, 1H), 7.49 –7.37 (m, 3H), 7.35 – 7.28 (m, 1H), 5.20 (q, J = 6.5 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.6, 6.6, 4.9, 3.8 Hz, 1H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.62(s, 1H). 13 C NMR (125 MHz, Chloroform- d) δ 175.74, 171.63, 152.31, 150.33,147.49, 146.40, 146.36, 145.77, 145.66, 140.36, 140.33, 135.12, 134.93,132.05, 129.74, 129.62, 128.30, 124.13, 124.07, 121.68, 111.56, 111.38,110.27, 110.22, 75.09, 75.08, 49.17, 46.57, 43.27, 26.96, 23.89, 17.83. Example 10 Compound 10: (S)-1-((R)-2-((4-(2-chloro-4-fluorophenyl)-6-fluoroquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 2-chloro-4-fluorophenylboronic acid. The characterization data for compound 10 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.48 (s, 1H), 7.73 (d, J = 7.4 Hz,1H), 7.65 (s, 1H), 7.56 (s, 1H), 7.23 (d, J = 2.0 Hz, 1H), 7.18 (dd, J = 7.5, 2.0Hz, 1H), 7.16 (s, 1H), 5.15 (s, 1H), 3.59 (s, 1H), 3.54 (s, 1H), 3.46 (d, J =15.4 Hz, 2H), 2.62 (s, 1H), 1.81 (d, J = 11.3 Hz, 2H), 1.69 (d, J = 9.2 Hz (2H), 1.52 (s, 3H). 13 C NMR (125 MHz, Chloroform- d) δ 175.19, 170.56, 159.16, 151.39,146.82, 146.35, 144.73, 134.44, 134.42, 133.15, 131.09, 126.89, 119.61,116.88, 116.85, 114.87, 108.65, 71.65, 48.90, 46.38, 46.04, 28.22, 23.64,16.31. Example 11 Compound 11: (S)-1-((R)-2-((4-(2,4-dimethylphenyl)-6-fluoroquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 2,4-dimethylphenylboronic acid. The characterization data for compound 11 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.64 (d, J = 4.6 Hz, 1H), 7.88 (d, J =4.2 Hz, 1H), 7.80 (d, J = 12.2 Hz, 1H), 7.42 (d, J = 4.6 Hz, 1H), 7.21 – 7.13 (m,2H), 7.02 (dd, J = 2.7, 0.7 Hz, 1H), 5.26 (q, J = 6.6 Hz, 1H), 3.66 (dd, J = 12.4, 3.9 Hz, 1H), 3.60 (dd, J = 12.4, 6.5 Hz, 1H), 3.40 – 3.28 (m, 2H), 2.66 (dddd, J = 7.5, 6.4, 4.9, 3.9 Hz, 1H), 2.58 (s, 3H), 2.48 (s, 2H), 1.87 – 1.79 (m,1H), 1.79 (ddd, J = 6.0, 3.6, 1.4 Hz, 1H), 1.79 – 1.71 (m, 1H), 1.70 – 1.60 (m,1H), 1.56 (d, J = 6.4 Hz, 3H). 13C NMR (125 MHz, Chloroform- d ) δ 174.92, 170.33,152.78, 150.80, 146.45, 146.34, 145.53, 144.77, 144.73, 139.15, 139.12,137.14, 135.51, 135.05, 130.57, 130.20, 127.94, 125.45, 125.40, 120.92,110.30, 110.12, 109.21, 109.16, 74.30, 74.29, 47.11, 46.74, 41.66, 26.44,23.73, 20.90, 20.87, 17.82. Example 12 Compound 12: (S)-1-((R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 3-methylphenylboronic acid. The characterization data for compound 12 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.6 Hz, 1H), 7.45 –7.36 (m, 3H), 7.29 – 7.22 (m, 1H), 5.20 (q, J = 6.5 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6, 5.0, 3.8 Hz, 1H), 2.43 (d, J = 0.7 Hz, 3H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.62 (s, 1H). 13C NMR (125 MHz, Chloroform-d) δ 175.74,171.63, 152.31, 150.33, 147.08, 145.80, 145.77, 145.75, 145.66, 141.53,141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31, 124.25, 121.67,111.07, 110.89, 110.21, 110.16, 75.09, 75.08, 49.17, 46.57, 43.27, 26.96, 23.89, 19.67, 17.83. Example 13 Compound 13: (S)-1-((R)-2-((6-fluoro-4-(2-fluorophenyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 2-fluorophenylboronic acid. Characterization data for compound 13 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.65 (d, J = 4.6 Hz, 1H), 7.98 (d, J =12.1 Hz, 1H), 7.68 (ddd, J = 8.3, 3.9, 1.6 Hz, 1H), 7.57 (dd, J = 4.7, 2.0 Hz,1H), 7.46 – 7.35 (m, 3H), 7.27 – 7.20 (m, 1H), 5.20 (q, J = 6.5 Hz, 1H), 3.77(dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.6, 6.6, 5.0, 3.8 Hz, 1H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65(m, 2H), 1.62 (s, 1H). 13C NMR (125 MHz, Chloroform-d) δ 175.74, 171.63,162.39, 160.40, 152.29, 150.31, 147.93, 146.64, 146.59, 145.77, 145.66,137.47, 137.45, 137.43, 137.40, 133.03, 132.98, 130.88, 130.82, 126.88,126.76, 126.68, 126.65, 123.33, 123.30, 123.27, 123.24, 122.57, 122.54, 114.63, 114.46, 111.95, 111.77, 110.27, 110.22, 75.09, 75.08, 49.17, 46.57, 43.27, 26.96, 23.89, 17.83. Example 14 Compound 14: (S)-1-((R)-2-((4-(3,5-dimethylphenyl)-6-fluoroquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 3,5-dimethylphenylboronic acid. The characterization data for compound 14 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.64 (s, 1H), 7.80 (s, 1H), 7.50 (s,1H), 7.18 – 7.10 (m, 5H), 5.15 (s, 1H), 3.60 (s, 1H), 3.54 (s, 1H), 3.46 (d, J = 17.9 Hz, 2H), 2.61 (s, 1H), 2.33 (d, J = 0.9 Hz, 7H), 1.81 (d, J = 11.3 Hz, 2H), 1.70 (s, 1H), 1.63 (s, 1H), 1.50 (s, 3H). 13 C NMR (125 MHz, Chloroform- d)δ 175.83, 170.56, 151.39, 146.82, 146.35, 145.04, 135.14, 135.11, 133.81,128.45, 127.38, 126.47, 120.01, 117.31, 108.65, 72.05, 48.54, 46.38, 46.04,28.22, 23.26, 21.12, 16.31. Example 15 Compound 15: (S)-1-((R)-2-((6-fluoro-4-(p-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 4-methylphenylboronic acid. Characterization data for compound 15 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.67 (d, J = 4.8 Hz, 1H), 7.97 (d, J =4.8 Hz, 1H), 7.87 (d, J = 12.1 Hz, 1H), 7.68 – 7.62 (m, 2H), 7.44 – 7.37 (m,2H), 5.20 (q, J = 6.5 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5,6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6, 5.0, 3.8 Hz, 1H),2.42 (d, J = 0.9 Hz, 2H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.62 (s,1H). 13C NMR (125 MHz, Chloroform-d) δ 175.74, 171.63, 152.29, 150.31, 147.77,146.30, 146.25, 145.77, 145.66, 141.01, 140.98, 138.93, 133.86, 129.64,129.28, 123.85, 123.80, 121.51, 110.89, 110.71, 110.29, 110.24, 75.09, 75.08,49.17, 46.57, 43.27, 26.96, 23.89, 21.24, 17.83. Example 16 Compound 16: (S)-1-((R)-2-((4-(2,6-dimethylphenyl)-6-fluoroquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 2,6-dimethylphenylboronic acid. Characterization data for compound 16 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.62 (d, J = 4.6 Hz, 1H), 7.86 (d, J =12.1 Hz, 1H), 7.38 (dd, J = 15.6, 4.4 Hz, 2H), 7.22 – 7.17 (m, 1H), 7.12 (dd, J =8.2, 6.8 Hz, 1H), 5.20 (q, J = 6.5 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56(dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6, 5.0,3.8 Hz, 1H), 2.36 (s, 5H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.62 (s,1H). 13C NMR (125 MHz, Chloroform-d) δ 175.74, 171.63, 152.34, 150.36, 146.01,145.77, 145.66, 145.49, 145.45, 140.25, 140.22, 137.36, 136.22, 128.38,127.53, 123.95, 123.90, 120.78, 110.58, 110.40, 110.20, 110.14, 75.09, 75.08,49.17, 46.57, 43.27, 26.96, 23.89, 21.14, 17.83. Example 17 Compound 17: (S)-1-((R)-2-((4-(2-fluorophenyl)-6-methylquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 8, except that 2-chlorophenylboronic acid in step four is replaced with 2-fluorophenylboronic acid. Characterization data for compound 17 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 8.10 (d, J =0.9 Hz, 1H), 7.68 (ddd, J = 8.4, 4.0, 1.6 Hz, 1H), 7.52 (dd, J = 4.6, 2.0 Hz,1H), 7.46 – 7.35 (m, 2H), 7.24 (ddd, J = 10.1, 7.4, 1.6 Hz, 1H), 5.17 (q, J = 6.6Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 –3.32 (m, 2H), 2.68 (dddd, J = 7.6, 6.6, 5.0, 3.8 Hz, 1H), 2.27 (s, 2H), 1.99 –1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.60 (s, 1H). 13C NMR (125 MHz, Chloroform-d) δ 175.74, 171.86, 162.37, 160.38, 156.98, 149.40, 148.00, 139.63, 139.59,133.01, 132.96, 130.88, 130.82, 126.72, 126.68, 126.65, 126.60, 126.13,125.64, 122.62, 122.59, 122.01, 121.97, 114.63, 114.46, 105.48, 75.26, 49.16,46.58, 43.27, 26.96, 23.89, 17.56, 16.20. Example 18 Compound 18: (S)-1-((R)-2-((6-methyl-4-(m-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 8, except that 2-chlorophenylboronic acid in step four is replaced with 3-methylphenylboronic acid. Characterization data for compound 18 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.62 (d, J = 4.6 Hz, 1H), 8.10 (s,1H), 7.58 (d, J = 4.6 Hz, 1H), 7.52 (ddd, J = 7.5, 2.2, 1.3 Hz, 1H), 7.47 – 7.39(m, 2H), 7.15 (dddd, J = 7.7, 2.2, 1.5, 0.7 Hz, 1H), 5.17 (q, J = 6.6 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m,2H), 2.68 (dddd, J = 7.7, 6.6, 5.0, 3.8 Hz, 1H), 2.38 (d, J = 0.7 Hz, 2H), 1.99 –1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.61 (d, J= 6.6 Hz, 2H). 13 C NMR (125 MHz, Chloroform-d) δ 175.74, 171.86, 156.94, 149.69, 147.24, 143.67, 139.75,135.43, 129.77, 129.10, 128.28, 128.01, 125.43, 125.41, 122.71, 120.22,105.47, 75.26, 49.16, 46.58, 43.27, 26.96, 23.89, 21.25, 17.56, 16.20. Example 19 Compound 19: (S)-1-((R)-2-((6-methyl-4-(p-phenylmethyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 8, except that 2-chlorophenylboronic acid in step four is replaced with 4-methylphenylboronic acid. Characterization data for compound 19 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.65 (d, J = 4.8 Hz, 1H), 8.16 – 8.12(m, 0H), 7.98 (d, J = 4.7 Hz, 1H), 7.67 – 7.61 (m, 2H), 7.44 – 7.37 (m, 2H), 5.17 (q, J = 6.6 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6, 5.0, 3.8 Hz, 1H), 2.42(d, J = 0.9 Hz, 2H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H), 1.61 (d, J = 6.6Hz, 2H). 13C NMR (125 MHz, Chloroform-d) δ 175.74, 171.86, 156.94, 149.67,147.25, 143.37, 138.93, 132.97, 129.64, 129.32, 125.45, 125.41, 123.25,120.70, 105.47, 75.26, 49.16, 46.58, 43.27, 26.96, 23.89, 21.24, 17.56,16.20. Example 20 Compound 20: (S)-1-((R)-2-((4-(2,6-dimethylphenyl)-6-methylquinoline-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 8, except that 2-chlorophenylboronic acid in step four is replaced with 2,6-dimethylphenylboronic acid. Characterization data for compound 20 are as follows:

[0095] 1 H NMR (500 MHz, Chloroform- d ) δ 8.60 (d, J = 4.6 Hz, 1H), 8.03 (d, J =0.9 Hz, 1H), 7.39 (d, J = 4.6 Hz, 1H), 7.20 (dd, J = 7.4, 0.8 Hz, 2H), 7.12 (dd, J = 8.2, 6.8 Hz, 1H), 5.17 (q, J = 6.6 Hz, 1H), 3.77 (dd, J = 11.5, 3.8 Hz, 1H), 3.56 (dd, J = 11.5, 6.6 Hz, 1H), 3.44 – 3.32 (m, 2H), 2.68 (dddd, J = 7.7, 6.6,5.0, 3.8 Hz, 1H), 2.36 (s, 5H), 1.99 – 1.82 (m, 2H), 1.81 – 1.65 (m, 2H),1.61 (d, J = 6.6 Hz, 2H). 13C NMR (125 MHz, Chloroform-d) δ 175.74, 171.86,156.94, 148.58, 146.15, 143.43, 137.35, 135.24, 128.38, 127.53, 125.45,125.14, 122.57, 119.94, 105.43, 75.26, 49.16, 46.58, 43.27, 26.96, 23.89,21.15, 17.56, 16.20. Example 21 Compound 21: (R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)-1-(piperidin-1-yl)propane-1-one The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with piperidine. The characterization data of compound 21 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.6 Hz, 1H), 7.45 –7.36 (m, 3H), 7.29 – 7.22 (m, 1H), 5.21 (q, J = 6.5 Hz, 1H), 3.42 – 3.30 (m,4H), 2.43 (d, J = 0.7 Hz, 3H), 1.66 – 1.54 (m, 5H), 1.60 (s, 3H). 13 C NMR (125MHz, Chloroform-d) δ 171.81, 152.31, 150.33, 147.08, 145.80, 145.77, 145.75,145.66, 141.53, 141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31,124.25, 121.67, 111.07, 110.89, 110.21, 110.16, 74.96, 74.96, 47.09, 25.56,24.33, 19.67, 17.83. Example 22 Compound 22: (R)-N,N-diethyl-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)propionamide The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with diethylamine. The characterization data of compound 22 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.0 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.5 Hz, 1H), 7.45 –7.36 (m, 2H), 7.29 – 7.22 (m, 1H), 5.21 (q, J = 6.6 Hz, 1H), 3.51 – 3.37 (m,3H), 2.43 (d, J = 0.7 Hz, 2H), 1.65 (s, 1H), 1.08 (t, J = 7.1 Hz, 4H). 13 C NMR (125MHz, Chloroform-d) δ 170.61, 152.29, 150.31, 147.08, 145.83, 145.82, 145.77,145.72, 141.53, 141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31,124.25, 121.67, 111.08, 110.90, 110.10, 110.05, 74.54, 41.22, 19.67, 17.81,13.36. Example 23 Compound 23: (R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)-N,N-dimethylpropionamide The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with dimethylamine. The characterization data of compound 23 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J= 4.6 Hz, 1H), 7.94 (d, J =12.0 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.5 Hz, 1H), 7.45 –7.36 (m, 3H), 7.29 – 7.22 (m, 1H), 5.29 (q, J = 5.8 Hz, 1H), 2.93 (s, 4H), 1.37(d, J = 5.9 Hz, 3H). 13 C NMR (125 MHz, Chloroform-d) δ 173.92, 152.29, 150.31,147.08, 145.82, 145.80, 145.77, 145.69, 141.53, 141.50, 138.33, 136.40,129.89, 127.81, 127.13, 124.31, 124.25, 121.67, 111.08, 110.90, 110.10,110.05, 72.05, 72.04, 36.92, 19.67, 17.79. Example 24 Compound 24: (R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)-N-isopropylpropionamide The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with isopropylamine. The characterization data of compound 24 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.5 Hz, 1H), 7.45 –7.36 (m, 2H), 7.29 – 7.22 (m, 1H), 6.87 (d, J = 7.9 Hz, 1H), 5.09 (q, J = 5.6 Hz, 1H), 3.96 (ddt, J= 11.2, 8.1, 5.6 Hz, 1H), 2.43 (d, J = 0.7 Hz, 2H), 1.42 (s,1H), 1.17 (dd, J = 15.7, 5.6 Hz, 4H). 13 C NMR (125 MHz, Chloroform-d) δ 173.63,152.03, 150.05, 147.08, 145.82, 145.77, 145.40, 145.29, 141.53, 141.50,138.33, 136.40, 129.89, 127.81, 127.13, 124.31, 124.25, 121.67, 111.08,110.90, 109.91, 109.86, 75.25, 41.73, 22.61, 19.67, 17.33. Example 25 Compound 25: (R)-2-((6-fluoro-4-(2-(trifluoromethyl)phenyl)quinolin-7-yl)oxo)-1-(piperidin-1-yl)propane-1-one The procedure is the same as in Example 21, except that 2-methylphenylboronic acid in step four is replaced with 2-trifluoromethylphenylboronic acid. The characterization data for compound 25 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.65 (d, J = 4.7 Hz, 1H), 7.97 (d, J =12.3 Hz, 1H), 7.88 (dd, J = 6.8, 1.3 Hz, 1H), 7.69 (dp, J = 10.4, 1.3 Hz, 1H),7.61 – 7.54 (m, 2H), 7.48 (d, J = 4.2 Hz, 1H), 7.43 – 7.37 (m, 1H), 5.21 (q, J =6.5 Hz, 1H), 3.42 – 3.30 (m, 3H), 1.67 – 1.54 (m, 7H). 13C NMR (125 MHz, Chloroform-d) δ 171.81, 152.29, 150.31, 147.24, 146.07, 146.02, 145.77,145.66, 142.19, 142.16, 142.14, 142.11, 142.08, 136.20, 136.17, 136.15,136.12, 130.78, 130.75, 130.72, 130.69, 129.99, 129.74, 129.56, 129.49,129.23, 129.22, 129.19, 129.17, 129.14, 127.77, 127.67, 127.65, 127.62, 127.59, 125.57, 123.38, 123.03, 122.69, 122.63, 121.19, 111.31, 111.12, 110.27, 110.21, 74.96, 74.96, 47.09, 25.56, 24.33, 17.83. Example 26 Compound 26: (R)-N-ethyl-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)propionamide The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with ethylamine. The characterization data of compound 26 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.5 Hz, 1H), 7.45 –7.36 (m, 2H), 7.25 (td, J = 7.6, 1.3 Hz, 1H), 7.19 (d, J = 3.8 Hz, 0H), 5.08 (q, J = 5.9 Hz, 1H), 3.34 – 3.19 (m, 2H), 2.43 (d, J = 0.7 Hz, 2H), 1.42 (s, 1H), 1.24 (t, J= 6.2 Hz, 2H). 13 C NMR (125 MHz, Chloroform-d) δ 173.47, 152.03,150.05, 147.08, 145.82, 145.77, 145.43, 145.32, 141.53, 141.50, 138.33,136.40, 129.89, 127.81, 127.13, 124.31, 124.25, 121.67, 111.08, 110.90,109.91, 109.86, 75.50, 35.88, 19.67, 17.24, 14.86. Example 27 Compound 27: (R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)-N-methylpropionamide The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with methylamine. The characterization data of compound 27 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.5 Hz, 1H), 7.45 –7.36 (m, 2H), 7.29 – 7.22 (m, 1H), 6.23 (q, J = 4.8 Hz, 1H), 5.10 (q, J = 5.5 Hz, 1H), 2.78 (d, J = 4.8 Hz, 2H), 2.43 (d, J = 0.7 Hz, 2H), 1.41 (s, 1H). 13C NMR (125MHz, Chloroform-d) δ 175.05, 152.03, 150.05, 147.08, 145.82, 145.77, 145.48,145.37, 141.53, 141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31,124.25, 121.67, 111.08, 110.90, 109.91, 109.86, 74.25, 25.94, 19.67, 17.22. Example 28 Compound 28: (R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)-N-(2-hydroxyethyl)propionamide The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with 2-hydroxyethylamine. The characterization data of compound 28 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.6 Hz, 1H), 7.45 –7.36 (m, 2H), 7.29 – 7.22 (m, 1H), 7.12 (t, J = 5.3 Hz, 1H), 5.92 (t, J = 5.7 Hz, 1H), 5.09 (q, J = 5.9 Hz, 1H), 3.74 – 3.64 (m, 2H), 3.30 – 3.16 (m, 2H), 2.43(d, J = 0.7 Hz, 2H), 1.42 (s, 1H). 13C NMR (125 MHz, Chloroform-d) δ 173.77,152.03, 150.05, 147.08, 145.82, 145.77, 145.41, 145.29, 141.53, 141.50,138.33, 136.40, 129.89, 127.81, 127.13, 124.31, 124.25, 121.67, 111.08,110.90, 109.91, 109.86, 75.58, 60.83, 42.90, 19.67, 17.24. Example 29 Compound 29: (R)-2-((6-methyl-4-(o-benzyl)quinolin-7-yl)oxo)-1-(piperidin-1-yl)propane-1-one The procedure is the same as in Example 3, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with piperidine. The characterization data of compound 29 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.61 (d, J = 4.6 Hz, 1H), 8.06 (d, J =0.9 Hz, 1H), 7.63 (dd, J = 7.7, 1.3 Hz, 1H), 7.54 (d, J = 4.7 Hz, 1H), 7.45 –7.36 (m, 2H), 7.25 (td, J = 7.6, 1.3 Hz, 1H), 5.14 (q, J = 6.5 Hz, 1H), 3.42 –3.30 (m, 4H), 2.43 (d, J = 0.7 Hz, 3H), 1.66 – 1.54 (m, 9H). 13 C NMR (125 MHz, Chloroform-d) δ 171.91, 156.94, 149.08, 146.75, 143.54, 138.38, 135.84,129.89, 127.81, 127.13, 125.61, 125.43, 123.48, 120.81, 105.45, 75.17, 47.09,25.56, 24.33, 19.67, 17.57, 16.20. Example 30 Compound 30: (R)-N,N-diethyl-2-((6-methyl-4-(o-benzyl)quinolin-7-yl)oxo)propionamide The procedure is the same as in Example 3, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with diethylamine. The characterization data of compound 30 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.61 (d, J = 4.6 Hz, 1H), 8.06 (d, J =1.0 Hz, 1H), 7.63 (dd, J = 7.7, 1.3 Hz, 1H), 7.54 (d, J = 4.7 Hz, 1H), 7.45 –7.36 (m, 2H), 7.29 – 7.22 (m, 1H), 5.20 (q, J = 6.6 Hz, 1H), 3.51 – 3.37 (m,4H), 2.43 (d, J = 0.7 Hz, 3H), 2.27 (s, 2H), 1.63 (s, 2H), 1.08 (t, J = 7.1 Hz, 6H). 13 C NMR (125 MHz, Chloroform-d) δ 171.29, 156.88, 149.04, 146.75, 143.54,138.38, 135.84, 129.89, 127.81, 127.13, 125.61, 125.33, 123.48, 120.81,105.32, 74.87, 41.13, 19.67, 17.57, 16.20, 13.36. Example 31 Compound 31: (R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)-1-(pyrrolidone-1-yl)propane-1-one The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with tetrahydropyrrole. The characterization data of compound 31 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J=12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.3 Hz, 1H), 7.53 (d, J = 4.6 Hz, 1H), 7.45 –7.36 (m, 2H), 7.29 – 7.22 (m, 1H), 5.21 (q, J = 6.5 Hz, 1H), 3.48 – 3.36 (m,3H), 2.43 (d, J = 0.7 Hz, 2H), 1.85 (t, J = 4.1 Hz, 3H), 1.62 (s, 1H). 13 C NMR (125MHz, Chloroform-d) δ 172.15, 152.31, 150.33, 147.08, 145.80, 145.77, 145.75,145.66, 141.53, 141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31,124.25, 121.67, 111.07, 110.89, 110.21, 110.16, 74.96, 74.96, 47.96, 24.98,19.67, 17.83. Example 32 Compound 32: (R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)-1-morpholinopropane-1-one The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with 1,4-oxazinecyclohexane. The characterization data of compound 32 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.6 Hz, 1H), 7.45 –7.36 (m, 2H), 7.29 – 7.22 (m, 1H), 5.20 (q, J = 6.6 Hz, 1H), 3.75 – 3.57 (m,5H), 2.43 (d,J = 0.7 Hz, 2H), 1.62 (s, 1H). 13 C NMR (125 MHz, Chloroform-d) δ171.33, 152.31, 150.33, 147.08, 145.80, 145.77, 145.75, 145.66, 141.53,141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31, 124.25, 121.67,111.07, 110.89, 110.21, 110.16, 75.04, 75.03, 66.49, 46.47, 19.67, 17.83. Example 33 Compound 33: (R)-2-((6-methyl-4-(o-phenylmethyl)quinolin-7-yl)oxo)-N-phenylpropionamide The procedure is the same as in Example 3, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with aniline. The characterization data of compound 33 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.98 (s, 1H), 8.61 (d, J = 4.6 Hz, 1H), 8.06 (d, J = 0.9 Hz, 1H), 7.66 – 7.51 (m, 3H), 7.45 – 7.29 (m, 3H), 7.25(td, J = 7.6, 1.2 Hz, 1H), 7.05 (tt, J = 7.0, 1.1 Hz, 1H), 5.10 (q, J = 5.7 Hz, 1H), 2.43 (d, J = 0.7 Hz, 2H), 1.45 (d, J = 5.7 Hz, 2H). 13C NMR (125 MHz, Chloroform-d) δ 171.18, 156.74, 149.04, 146.75, 143.54, 138.38, 138.32,135.84, 129.89, 129.16, 127.81, 127.13, 125.71, 125.61, 125.33, 123.48,121.30, 120.81, 105.32, 76.66, 19.67, 17.28, 16.20. Example 34 Compound 34: (R)-2-((6-methyl-4-(o-benzyl)quinolin-7-yl)oxo)-N-(pyridin-2-yl)propionamide The procedure is the same as in Example 3, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with 2-aminopyridine. The characterization data of compound 34 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 9.58 (s, 1H), 8.61 (d, J = 4.6 Hz, 1H), 8.30 (dd, J = 4.3, 1.8 Hz, 1H), 8.06 (d, J = 0.9 Hz, 1H), 7.80 (td, J = 7.4, 1.7 Hz, 1H), 7.63 (dd, J = 7.7, 1.3 Hz, 1H), 7.59 – 7.51 (m, 2H), 7.45 – 7.36(m, 2H), 7.25 (td, J = 7.6, 1.2 Hz, 1H), 7.12 (ddd, J = 7.1, 4.4, 1.5 Hz, 1H),5.24 (q, J = 5.7 Hz, 1H), 2.43 (d, J = 0.7 Hz, 3H), 1.44 (d, J = 5.7 Hz, 3H). 13C NMR(125 MHz, Chloroform-d) δ 171.86, 156.81, 151.62, 149.62, 149.04, 146.75,143.54, 139.08, 138.38, 135.84, 129.89, 127.81, 127.13, 125.61, 125.36,123.48, 120.81, 120.35, 114.15, 105.39, 76.36, 19.67, 17.28, 16.20. Example 35 Compound 35: (R)-N-cyclopropyl-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)propionamide The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with cyclopropylamine. The characterization data of compound 35 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.5 Hz, 1H), 7.45 –7.36 (m, 3H), 7.29 – 7.22 (m, 1H), 6.94 (d, J = 7.3 Hz, 1H), 5.09 (q, J = 5.7 Hz, 1H), 3.23 (dp, J = 7.5, 4.6 Hz, 1H), 1.38 (d, J = 5.7 Hz, 3H), 0.99 (dd, J = 10.7, 4.7 Hz, 2H), 0.74 (dd, J = 10.8, 4.6 Hz, 2H). 13C NMR (125 MHz, Chloroform-d) δ173.21, 152.03, 150.05, 147.08, 145.82, 145.77, 145.39, 145.28, 141.53,141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31, 124.25, 121.67,111.08, 110.90, 109.91, 109.86, 75.48, 23.15, 19.67, 17.33, 8.51. Example 36 Compound 36: (R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)-N-(3-hydroxypropyl)propionamide The procedure is the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 is replaced with 3-amino-1-propanol. The characterization data of compound 36 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.94 (d, J =12.1 Hz, 1H), 7.64 (dd, J = 7.7, 1.2 Hz, 1H), 7.53 (d, J = 4.6 Hz, 1H), 7.45 –7.36 (m, 3H), 7.29 – 7.22 (m, 1H), 7.10 (t, J = 4.9 Hz, 1H), 5.09 (q, J = 5.9 Hz, 1H), 3.65 (dd, J = 6.0, 5.1 Hz, 1H), 3.57 (q, J = 5.6 Hz, 2H), 3.26 – 3.13 (m,2H), 2.43 (d, J = 0.7 Hz, 3H), 1.63 (p, J = 5.9 Hz, 2H), 1.42 (s, 1H). 13C NMR (125MHz, Chloroform-d) δ 173.79, 152.03, 150.05, 147.08, 145.82, 145.77, 145.43,145.32, 141.53, 141.50, 138.33, 136.40, 129.89, 127.81, 127.13, 124.31,124.25, 121.67, 111.08, 110.90, 109.91, 109.86, 75.58, 59.22, 38.24, 32.70,19.67, 17.24. Example 37 Compound 37: (S)-1-((R)-2-((6-fluoro-4-(pyridin-4-yl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 4-pyridineboronic acid. The characterization data for compound 37 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.69 – 8.65 (m, 2H), 8.48 (d, J = 4.6Hz, 1H), 7.88 (dd, J = 8.1, 4.6 Hz, 2H), 7.84 – 7.79 (m, 2H), 7.52 (d, J = 12.1Hz, 1H), 5.26 (q, J = 6.6 Hz, 1H), 3.66 (dd, J = 12.4, 3.9 Hz, 1H), 3.60 (dd, J =12.4, 6.5 Hz, 1H), 3.40 – 3.28 (m, 2H), 2.66 (dddd, J = 7.6, 6.5, 5.0, 4.0 Hz,1H), 1.87 – 1.70 (m, 3H), 1.70 – 1.60 (m, 1H), 1.56 (d, J = 6.4 Hz, 3H). 13 C NMR (125 MHz, Chloroform- d) δ 174.92, 170.33, 152.80, 150.82, 150.13, 146.59,146.48, 145.79, 145.72, 145.68, 142.27, 138.38, 138.35, 126.17, 126.11,121.42, 121.19, 110.61, 110.43, 109.19, 109.14, 74.30, 74.29, 47.11, 46.74,41.66, 26.44, 23.72, 17.82. Example 38 Compound 38: (S)-1-((R)-2-((6-fluoro-4-morpholinoquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that step four is changed to the following reaction:

[0096] Procedure: Intermediate D (19.53 mmol), morpholine (21.48 mmol), palladium dichloride (5% mol), cy-DMEDA (4% mol), and potassium carbonate (39.05 mmol) were dissolved in THF (20 mL). The mixture was refluxed overnight under argon protection. The palladium catalyst was removed by diatomaceous earth filtration. The mixture was then extracted three times with 100 mL ethyl acetate and 100 mL water. The organic layer was collected, the solvent was concentrated under reduced pressure, and the mixture was subjected to column chromatography (petroleum ether: ethyl acetate = 1:1) to obtain intermediate E2.

[0097] The characterization data of compound 38 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.50 (d, J = 4.9 Hz, 1H), 7.93 (d, J =12.1 Hz, 1H), 7.52 (d, J = 4.2 Hz, 1H), 7.02 (d, J = 5.1 Hz, 1H), 5.26 (q, J = 6.6Hz, 1H), 3.76 (ddd, J = 10.8, 6.0, 3.3 Hz, 4H), 3.66 (dd, J = 12.4, 3.9 Hz, 1H), 3.60 (dd, J= 12.4, 6.5 Hz, 1H), 3.40 – 3.28 (m, 6H), 2.66 (dddd, J = 7.6, 6.5,5.0, 3.9 Hz, 1H), 1.87 – 1.71 (m, 3H), 1.71 – 1.60 (m, 1H), 1.56 (d, J = 6.4Hz, 3H). 13 C NMR (125 MHz, Chloroform- d ) δ 174.92, 170.33, 152.70, 150.72,148.97, 148.93, 148.19, 146.61, 146.50, 145.51, 145.47, 118.26, 118.21,111.60, 111.54, 110.16, 109.98, 106.24, 74.31, 74.30, 66.91, 50.76, 47.11,46.74, 41.66, 26.44, 23.72, 17.82. Example 39 Compound 39: (S)-1-((R)-2-((4-(dimethylamino)-6-fluoroquinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 38, except that the raw material morpholine in step four is replaced with dimethylamine.

[0098] The characterization data of compound 39 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.61 (d, J = 4.2 Hz, 1H), 7.93 (d, J =12.3 Hz, 1H), 7.52 (d, J = 4.2 Hz, 1H), 7.04 (d, J = 4.3 Hz, 1H), 5.26 (q, J = 6.6Hz, 1H), 3.66 (dd, J = 12.4, 3.9 Hz, 1H), 3.60 (dd, J = 12.4, 6.5 Hz, 1H), 3.40 –3.28 (m, 2H), 2.94 (s, 4H), 2.66 (dddd, J= 7.5, 6.5, 4.9, 3.9 Hz, 1H), 1.87 –1.71 (m, 3H), 1.71 – 1.59 (m, 1H), 1.56 (d, J = 6.4 Hz, 3H). 13 C NMR (125 MHz, Chloroform- d ) δ 174.92, 170.33, 152.96, 150.98, 150.91, 150.90, 147.72,146.64, 146.53, 145.47, 145.43, 117.66, 117.61, 111.96, 111.91, 109.68,109.50, 105.23, 74.31, 74.30, 47.11, 46.74, 44.75, 41.66, 26.44, 23.72,17.82. Example 40 Compound 40: (S)-1-((R)-2-((6-fluoro-4-(pyridin-3-yl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid The procedure is the same as in Example 1, except that 2-methylphenylboronic acid in step four is replaced with 3-pyridineboronic acid. The characterization data for compound 40 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 9.01 (d, J = 1.9 Hz, 1H), 8.64 (dd, J =4.8, 1.7 Hz, 1H), 8.50 (d, J = 4.6 Hz, 1H), 7.90 (d, J = 4.4 Hz, 1H), 7.82 (dt, J =8.4, 1.9 Hz, 1H), 7.68 (d, J = 4.8 Hz, 1H), 7.52 (d, J = 12.0 Hz, 1H), 7.37 (dd, J = 8.2, 4.8 Hz, 1H), 5.26 (q, J = 6.6 Hz, 1H), 3.66 (dd, J = 12.4, 3.9 Hz, 1H), 3.60 (dd, J= 12.4, 6.5 Hz, 1H), 3.40 – 3.28 (m, 2H), 2.66 (dddd, J = 7.5, 6.5,4.9, 3.9 Hz, 1H), 1.87 – 1.71 (m, 2H), 1.71 – 1.60 (m, 1H), 1.56 (d, J = 6.4Hz, 3H). 13 C NMR (125 MHz, Chloroform- d ) δ 174.92, 170.33, 152.81, 150.83,150.78, 148.74, 146.59, 146.48, 146.35, 146.20, 146.15, 137.12, 137.09,135.95, 133.30, 125.26, 125.20, 123.10, 120.64, 111.13, 110.94, 109.25,109.20, 74.30, 74.29, 47.11, 46.74, 41.66, 26.44, 23.72, 17.82. Example 41 Compound 41: (R)-1-(4,4-difluoropiperidin-1-yl)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)propane-1-one The procedure was the same as in Example 1, except that ethyl (S)-piperidine-3-carboxylate in step 8 was replaced with 4,4-difluoropiperidine. The characterization data for compound 41 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 2H), 7.88 (d, J =4.2 Hz, 2H), 7.83 – 7.76 (m, 4H), 7.43 (d, J = 4.6 Hz, 2H), 7.41 – 7.37 (m,1H), 7.40 – 7.35 (m, 3H), 7.27 (td, J = 7.5, 1.2 Hz, 2H), 5.24 (q, J = 6.6 Hz, 2H), 3.58 – 3.44 (m, 9H), 2.43 (d, J = 0.7 Hz, 6H), 2.22 (dtdd,J = 17.4, 14.3,7.8, 5.5 Hz, 9H), 1.57 (s, 3H). 13 C NMR (125 MHz, Chloroform- d ) δ 170.48,152.78, 150.80, 146.45, 146.34, 145.53, 144.77, 144.73, 139.85, 139.82,137.31, 136.61, 129.49, 129.27, 127.57, 126.06, 125.40, 125.34, 122.93,121.04, 120.91, 119.14, 110.30, 110.12, 109.21, 109.16, 74.23, 41.11, 41.06,41.02, 32.51, 32.32, 32.14, 19.84, 17.82. Example 42 Compound 42: Ethyl(S)-1-((R)-2-((6-fluoro-4-(o-benzyl)quinolin-7-yl)oxo)propionyl)piperidine-3-carboxylic acid ester The procedure is the same as in Example 1, and the product is obtained by proceeding to step seven. The characterization data for compound 42 are as follows: 1 H NMR (500 MHz, Chloroform- d ) δ 8.63 (d, J = 4.6 Hz, 1H), 7.88 (d, J =4.2 Hz, 1H), 7.83 – 7.76 (m, 2H), 7.43 (d, J = 4.6 Hz, 1H), 7.41 – 7.35 (m,2H), 7.27 (td, J = 7.5, 1.2 Hz, 1H), 5.26 (q, J = 6.6 Hz, 1H), 4.14 (qd, J = 6.3,3.1 Hz, 2H), 3.74 – 3.68 (m, 2H), 3.40 – 3.28 (m, 2H), 2.67 (qd, J = 7.3, 6.6,5.1 Hz, 1H), 2.43 (d, J = 0.7 Hz, 3H), 1.87 – 1.67 (m, 4H), 1.56 (d,J = 6.4 Hz, 3H), 1.23 (t, J = 6.4 Hz, 3H). 13 C NMR (125 MHz, Chloroform- d ) δ 174.15, 170.37,152.78, 150.80, 146.45, 146.34, 145.53, 144.77, 144.73, 139.85, 139.82,137.31, 136.61, 129.49, 129.27, 127.57, 126.06, 125.40, 125.34, 120.91,110.30, 110.12, 109.21, 109.16, 74.30, 74.29, 60.59, 47.44, 46.72, 43.14,25.54, 23.57, 19.84, 17.82, 14.25. Experimental Example 1 1. Anti-cell proliferation activity assay Pancreatic cancer cells MIA-PaCa-2, liver cancer cells Hep-G2, and lung cancer cells A549 (derived from ATCC, USA) were seeded at 2000 cells / well in 96-well plates, with 100 µL of culture medium added to each well. Cells were randomly divided into experimental and control groups. The experimental group received 100 µL / well of the solutions of the compounds prepared in this invention, the positive control drug (CAS No. 2304621-06-3), or the control compounds (concentrations of 1 nM, 10 nM, 100 nM, 1 μM, 10 μM, and 100 μM, respectively, dissolved and diluted to the corresponding concentrations in culture medium before use). The control group received 100 µL / well of culture medium the following day. Cell viability was then measured using the following SRB assay: 1) Cell fixation: 168 hours after drug administration, aspirate the culture medium from the wells and add 200 μL of 10% TCA (trichloroacetic acid) solution pre-cooled at 4℃ to each well to fix the cells. After standing for 5 min, transfer to a 4℃ refrigerator for 1 h of fixation. Remove and rinse 5 times with deionized water, then air dry at room temperature.

[0099] 2) Staining: After the 96-well plate has been air-dried at room temperature, add 100 μL of 0.4% (w / v) SRB (sulfonylrhodamine B) staining solution (prepared with 1% acetic acid) to each well. After staining for 30 min, discard the staining solution and rinse 5 times with 1% (v / v) acetic acid to remove unbound dye. Air-dry at room temperature.

[0100] 3) Detection: The dye bound to cell proteins was dissolved in 100 μL of unbuffered Tris (tris(hydroxymethyl)aminomethane) alkaline solution (10 mM, pH=10.5), shaken on a horizontal shaker for 20 min, and the absorbance was measured at 545 nM using an ELISA reader. The inhibition rate was calculated as: Inhibition rate = [1 – (Change in absorbance of experimental group / Change in absorbance of blank group)] × 100%. The compound was subjected to IC50 assay. 50 The IC50 was determined by measuring the inhibition rate at six concentrations of the target compound (1 nM, 10 nM, 100 nM, 1 μM, 10 μM, and 100 μM). A linear regression was performed between the negative logarithm of the molar concentration and the inhibition rate. The concentration at which the inhibition rate reached 50% was then identified as the IC50 of the compound. 50 value.

[0101] 2. Real-time quantitative PCR Using the MIA-PaCa-2 cell line, 500,000 cells / well were seeded in 6-well plates. The next day, 500 nM solutions of each compound were added (dissolved and diluted to the corresponding concentration with DMSO before use). After incubation for 6 hours, RNA was extracted using a Q-PCR test kit (manufacturer: TransGen). The RNA concentration was then measured and reverse transcription was performed. ND1 primers (F: TCCTGCCATCATGACCCTTG, R: CTGCGGCGTATTCGATGTTG) were then added and amplified using a real-time quantitative PCR instrument to obtain the changes in the amount of ND1-related RNA in the compounds.

[0102] Table 1: Activity data of some compounds of the present invention

[0103] a The fold increase in ND1 mRNA expression level in the treatment group relative to the blank control group (MIA-PaCa-2 cells, compound concentration 500 nM). As shown in Table 1, compound 1-36 exhibits stronger antiproliferative activity against MIA-PaCa-2, Hep-G2, and A5491 cell lines than the positive control drug IMT1B, and also shows stronger inhibition of mitochondrial-associated factor ND1 than the positive control drug IMT1B.

[0104] Furthermore, the types of substituents G1, G2, and G3 affect antitumor activity. When other substituents remain constant, the antitumor activity of compounds with substituents G1 or G2 selected from those disclosed in this application (excluding H) is significantly enhanced compared to when substituent G3 is selected from those disclosed in this application (excluding H). Moreover, compared to other substituents, when G1, G2, or G3 is selected from F or methyl, the antitumor activity of the compound is significantly enhanced. Compounds with W selected from ortho-substituted benzene rings exhibit greater antitumor activity than compounds with W selected from para-substituted benzene rings, which in turn exhibit greater activity than compounds with W selected from meta-substituted benzene rings.

[0105] Experimental Example 2: Antiproliferative Activity of Optimized Compounds on Different Cell Lines Compounds 1, 3, 8, 13, 29, and 36, exhibiting superior activity, underwent further screening for expanded antiproliferative activity in cells. Malignant glioma cells SF295, ovarian cancer cells A2780, melanoma cells SK-MEL-5, leukemia cells HL-60, breast cancer cells MDA-MB-468, lymphoma cells RAMOS, colon cancer cells DLD-1, and prostate cancer cells 22RV1 (derived from ATCC, USA) were seeded at 2000 cells / well in 96-well plates, with 100 µL of culture medium added to each well. Cells were randomly divided into experimental and control groups. The experimental group received 100 µL / well of the prepared compound or positive control drug (CAS No. 2304621-06-3) solution (concentrations of 1 nM, 10 nM, 100 nM, 1 μM, 10 μM, and 100 μM, dissolved and diluted to the corresponding concentration in culture medium before use). The control group received 100 µL / well of the prepared compound or positive control drug (CAS No. 2304621-06-3) solution (concentrations of 1 nM, 10 nM, 10 μM, and 100 μM, respectively, dissolved and diluted to the corresponding concentration in culture medium before use). The control group received 100 µL / well of the prepared compound or positive control drug solution (CAS No. 2304621-06-3) the following day. µL / well of culture medium was used, and cell viability was then determined using the following SRB assay: 1) Cell fixation: 168 hours after drug administration, aspirate the culture medium from the wells and add 200 μL of 10% TCA (trichloroacetic acid) solution pre-cooled at 4°C to each well to fix the cells. After standing for 5 min, transfer to a 4°C refrigerator for 1 h of fixation. Remove and rinse 5 times with deionized water, then air dry at room temperature.

[0106] 2) Staining: After the 96-well plate has dried at room temperature, add 100 μL of 0.4% (w / v) SRB staining solution (prepared with 1% acetic acid) to each well. After staining for 30 min, discard the staining solution and rinse 5 times with 1% (v / v) acetic acid to remove unbound dye. Let it air dry at room temperature.

[0107] 3) Detection: Dissolve the dye bound to cell proteins in 100 μL of unbuffered Tris-base solution (10 mM, pH=10.5), shake on a horizontal shaker for 20 min, and measure the absorbance at 545 nM using a microplate reader. The inhibition rate is calculated as: Inhibition rate = [1 – (Change in absorbance of experimental group / Change in absorbance of blank group)] × 100%. The compound is subjected to IC50 assay. 50 The IC50 was determined by measuring the inhibition rate at six concentrations of the target compound (1 nM, 10 nM, 100 nM, 1 μM, 10 μM, and 100 μM). A linear regression was performed between the negative logarithm of the molar concentration and the inhibition rate. The concentration at which the inhibition rate reached 50% was then identified as the IC50 of the compound. 50 value.

[0108] Table 2 Screening of the preferred compounds for antiproliferative activity against different cell lines (i.e., IC50). 50 value)

[0109] Note: The activity unit is IC. 50 (nM) As can be seen from Table 2, the representative compound exhibits stronger antiproliferative activity against multiple cell lines than the positive control drug IMT1B.

[0110] Experimental Example 3: Treatment of human 22RV1 prostate cancer xenografts in nude mice On day 0, 22RV1 prostate cancer cells in the exponential growth phase were subcutaneously transplanted into female Balb / c nude mice, which were then cultured in individually ventilated cages (IVCs). The diameter of the xenografts in the nude mice was measured using calipers. The tumors were cultured until they reached 100-150 mm in diameter. 3 The animals were then randomly divided into three groups of six each. Drug administration was initiated as shown in Table 3. Except for Group 1 (Control), the other groups were administered saline solutions of compounds 1, 3, 8, 13, 29, 36, and the positive control drug IMT1B via gavage or oral administration at a concentration of 100 mg / kg. Administration continued for 25 days, once daily. Group 1 received the same volume of saline solution via gavage or oral administration in parallel. After each treatment, the antitumor effect of the test substances was dynamically observed by measuring the length and width of the tumors, and the mice were weighed. After the administration period, the mice were sacrificed, and the tumors were surgically removed and weighed.

[0111] The formula for calculating tumor volume (TV) is: TV = 1 / 2 × a × b 2Where a and b represent length and width, respectively. The relative tumor volume (RTV) is calculated based on the measurement results using the formula: RTV = V t / V0. Where V0 is the tumor volume measured when the drug is administered in separate cages (i.e., d0), V t The tumor volume is recorded at each measurement. The animal's weight and the long and short axes of the tumor are measured every other day, and a curve showing the changes in the animal's weight and tumor volume is plotted.

[0112] Table 3 Dosing Regimen

[0113] Experimental results: Compounds 1, 3, 8, 13, 29, and 36 showed good tolerance to treatment, and even after treatment with higher doses, [the condition improved]. Figure 2 As can be seen, there was no significant difference in body weight compared to the control group, and no signs of toxicity were observed. After administration of 100 mg / kg, from... Figure 1 It can be seen that mice treated with compounds 1, 3, 8, 13, 29, and 36 showed tumor growth inhibition and had a stronger tumor-suppressing effect than the positive control drug IMT-1B.

[0114] Experiment Example 4: Test of the fat-reducing activity of the compound 1. Experimental Methods Starting at 4 weeks of age, male C57BL / 6N mice were subjected to an obesity model under conditions of 22°C, 50% humidity, and a 12-hour light-dark cycle. Group 1 (normal diet group, negative control group) received a normal diet, while the other groups were fed a high-fat diet for eleven consecutive weeks. The high-fat diet group mice reached a weight of 35g. Group 2 (high-fat diet control group) received oral saline via gavage, while the other groups received oral saline solutions of compounds 1, 3, 8, 13, and 29 at a concentration of 30 mg / kg, respectively, for six consecutive weeks, once daily. Group 1 received the same volume of saline via gavage in parallel. After each treatment, the mice were weighed.

[0115] Table 4 Dosing Regimen

[0116] Using compounds 1, 3, and 8 as representative compounds, mice were euthanized after administration of compounds 1, 3, and 8. Relevant tissues were then dissected and collected, including inguinal subcutaneous white adipose tissue (iWAT), anterior subcutaneous white adipose tissue (asWAT), epididymal white adipose tissue (eWAT), retroperitoneal white adipose tissue (rWAT), and mesenteric white adipose tissue (mWAT). The tissues were weighed, and the total weight was calculated. Simultaneously, muscle and liver were collected and weighed. Food intake was recorded for each group of animals after administration.

[0117] 2. Experimental Results Experimental results showed that compounds 1, 3, 8, 13, and 29 exhibited good tolerance to treatment. Figure 3 As shown in the table below, compared with the high-fat diet control group, the drug-treated groups all showed better lipid-lowering effects, and the weight of obese mice decreased significantly, demonstrating excellent anti-obesity activity. In addition, the weight of the drug-treated groups was similar to that of the normal diet group, which proves the lipid-lowering effect of the compound.

[0118] Table 5 Weight Changes

[0119] like Figure 4 As shown, compounds 1, 3, and 8 significantly reduced fat content in adipose tissue at various sites. Furthermore, the livers of mice were weighed, as shown... Figure 5 As shown, the liver weight of the treated group was significantly lower than that of the high-fat diet control group, indicating that these compounds have certain anti-fatty liver activity. Figure 6 and Figure 7 As shown, the compound administration group had no significant effect on the food intake and muscle content of mice, further demonstrating the safety of the compound.

[0120] Experimental Example 5: Test of the lipid-lowering activity of the compound 1. Experimental Methods Primary liver cells and HL-7702 human hepatocytes were seeded at 500,000 cells / well in 6-well plates. After 24 hours, when the cell confluence reached 80%, cells were randomly divided into control, model, metformin, lovastatin, low-dose, medium-dose, and high-dose groups. Except for the control group, all groups were supplemented with 200 μM oleic acid and 100 μM palmitic acid to establish the cell model. In addition to the model groups, 2 μL of the corresponding compound solution was administered simultaneously (specifically, the metformin group was given 200 μM metformin solution, the lovastatin group was given 10 μM lovastatin solution, and the low-dose, medium-dose, and high-dose groups were given Compound 1 solutions at concentrations of 10 nM, 100 nM, and 1000 nM, respectively; all solutions were dissolved and diluted to the corresponding concentrations in DMEM medium before use). The model groups were administered the same culture medium in parallel.

[0121] Twenty-four hours after drug administration, the DMEM medium in the six-well plates was discarded, and the cells were washed twice with PBS to remove residual old medium and modeling agent. 300 μL of trypsin was added to each well to digest the cells until they became spherical. Digestion was stopped by adding 500 μL of DMEM containing FBS. The cells were pipetted and transferred to 2 mL EP tubes, centrifuged at 1000 rpm for 3 min, and the supernatant was discarded. The cells were then washed once with 500 μL of PBS to remove residual trypsin. The cell pellet was resuspended in 1 mL of PBS to obtain a cell suspension. TC and TG levels were measured using a triglyceride (TG) assay kit and a total cholesterol (TC) assay kit, respectively, according to the instructions.

[0122] 2. Experimental Results like Figure 8 As shown, the lipid-lowering effect of compound 1 on primary liver cells and HL-7702 cells was tested. Compared with metformin and lovastatin, compound 1 showed strong lipid-lowering activity.

[0123] Experiment Example 6: Test of the hypoglycemic activity of the compound 1. Animal grouping and drug administration Healthy male C57BL / 6J mice, SPF grade, 6 weeks old. They were housed in a clean-grade animal room with a temperature controlled at 22-25℃ and humidity at 55±5%, using a 12 / 12-hour light / dark cycle (light time 7:00-19:00), and had free access to food and water. They were acclimatized for one week. Thirty mice were randomly selected as the blank control group, and the remaining mice were used as the model group. The normal control group (Chow) was fed a standard diet, while the model group was fed a 60% high-fat diet (from ResearchDiets, D12492). The model group was considered successfully established as diabetic after 6 weeks of the high-fat diet, with a significant difference in body weight and mean fasting blood glucose (6 hours after fasting) above 10.5 mmol / L compared to the blank control group.

[0124] Grouping and Administration: After successful model establishment, the model groups were randomly divided into a model group (HFD) and a drug group (Compound 1) using a random number table method, with 6 animals in each group. The drug group was administered 30 mg / kg, diluted with distilled water before administration by gavage. This was done once daily for 8 weeks. The normal control group and the model control group were each given an equal volume of water by gavage once daily for 8 weeks.

[0125] On the last day of drug administration, the blood insulin and glucose levels of each group of animals were tested, and the results are shown in the table below. Figure 9 A and Figure 9 As shown in B in the diagram.

[0126] On the second day after the last day of drug administration, an insulin tolerance test (ITT) was performed. On the day of the experiment, animals were fasted for 4 hours (with normal water intake), blood was collected from the tail tip (0 min), and then administered with 0.05 u·mL⁻¹. -1 Insulin solution was administered intraperitoneally at a dose of 0.5 u·kg. -1 Blood samples were collected at 15, 30, 60, 90, and 120 minutes post-injection to measure blood glucose levels and calculate AUC. Results are shown below. Figure 9 E and Figure 9 As shown in F in the diagram.

[0127] On the second day after the last day of drug administration, an oral glucose tolerance test (OGTT) was performed. On the day of the experiment, animals were fasted for 16 hours (with normal water intake), blood was collected from the tail tip (0 min), and then administered at 0.2 g / mL. -1 Glucose solution was administered orally at a dose of 2 g / kg. -1 Blood samples were collected at 15, 30, 60, 90, and 120 minutes post-injection to measure blood glucose levels and calculate AUC. Results are shown below. Figure 9 C and Figure 9 As shown in D in the diagram.

[0128] 2. Experimental Results like Figure 9 As shown, compound 1 can promote insulin secretion and improve insulin sensitivity, exhibiting good hypoglycemic activity in mice.

[0129] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.

Claims

1. A quinoline compound of formula (I) or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals: Formula (I); in, G1, G2, G3 and G4 are independently selected from H, halogen, cyano, amino, hydroxyl or C1-C6 alkyl, and G1, G2 and G3 are not all H at the same time; W is selected from 6- to 10-membered aryl, 5- to 10-membered heteroaryl, 3- to 8-membered heterocyclic alkyl, or -NR5R6; the heteroaryl or heterocyclic alkyl contains 1 to 3 heteroatoms selected from N, O, or S; the aryl, heteroaryl, or heterocyclic alkyl is optionally surrounded by 1 to 4 R atoms. t0 Replaced by, R t0 They may be the same or different, each independently selected from halogens, C1-C6 alkyl groups, halogen-substituted C1-C6 alkyl groups, C1-C6 alkoxy groups, halogen-substituted C1-C6 alkoxy groups, or at least a pair of R groups. t0 The atoms connected together form a 4- to 10-membered carbon ring or a 5- to 10-membered heterocycle, wherein the heterocycle contains 1 to 2 heteroatoms selected from N, O or S; R5 and R6 are independently selected from H or C1-C6 alkyl groups; R1 and R2 are independently selected from H, halogen, cyano, amino, hydroxyl or C1-C6 alkyl, or R1 and R2 and their attached carbon atoms are connected together to form a 3 to 5-membered cycloalkyl group; Y is selected from -NR3R4; R3 and R4 are independently selected from H, cyano, hydroxyl, unsubstituted or substituted C1-C6 alkyl, unsubstituted or substituted 6- to 10-membered aryl, unsubstituted or substituted 5- to 10-membered heteroaryl, unsubstituted or substituted 3- to 8-membered cycloalkyl, unsubstituted or substituted 3- to 8-membered heterocycloalkyl, or R3 and R4 form an unsubstituted or substituted 4- to 8-membered heterocycle with the N atom attached to them. Substitution means that the H atom on the alkyl, aryl, heteroaryl, cycloalkyl, heterocycloalkyl, or heterocycle is substituted by one or more of -COOH, C1-C3 alkyl, hydroxyl, halogen, or ester group; the heteroaryl, heterocycloalkyl, or heterocycle contains 1 to 3 heteroatoms selected from N, O, or S.

2. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to claim 1, characterized in that, W is selected from 6- to 10-membered aryl, 5- to 6-membered heteroaryl, 5- to 6-membered heterocycloalkyl, or -NR5R6; the heteroaryl or heterocycloalkyl contains 1 to 2 heteroatoms selected from N or O, R5 and R6 are independently selected from C1-C3 alkyl groups, and the aryl group is optionally surrounded by 1 to 3 R atoms. t0 Replaced by, R t0 The elements, whether identical or different, are independently selected from halogens, C1-C6 alkyl groups, or halogen-substituted C1-C6 alkyl groups; preferably, W is selected from phenyl groups, which are optionally substituted with 1 to 2 R atoms. t0 Replaced by, R t0 Whether the components are the same or different, each is independently selected from F, Cl, methyl, ethyl, or trifluoromethyl; more preferably, W is selected from phenyl, wherein the phenyl is oxidized by one R t0 Replaced by, R t0 Selected from F, Cl, or methyl.

3. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to claim 1 or 2, characterized in that, W is selected from the following structure: , , , , , , , , , , Or -NR5R6, R t0 The definitions of R5 and R6 are as defined in claim 1 or 2.

4. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to any one of claims 1-3, characterized in that, G4 is selected from H.

5. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to any one of claims 1-4, characterized in that, G1, G2, G3 and G4 are independently selected from H, halogen or C1-C3 alkyl groups, and G1, G2 and G3 are not simultaneously H; preferably, G1, G2, G3 and G4 are independently selected from H, F, Cl, methyl or ethyl, and G1, G2 and G3 are not simultaneously H.

6. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to claim 1, characterized in that, The quinoline compounds have the following structures (II)-(IV): In formula (II), G1 is selected from halogens or C1-C3 alkyl groups; preferably F or methyl. In formula (III), G2 is selected from halogens or C1-C3 alkyl groups; preferably F or methyl. In formula (IV), G3 is selected from halogens or C1-C3 alkyl groups; preferably F or methyl.

7. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to any one of claims 1-6, characterized in that, R1 and R2 are independently selected from H or C1-C3 alkyl groups, or R1 and R2 and their associated carbon atoms are linked together to form a 3- to 5-membered cycloalkyl group; preferably, R1 and R2 are independently selected from H or C1-C3 alkyl groups.

8. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to claim 7, characterized in that, R1 and R2 are independently selected from H or methyl; preferably, R1 is selected from H and R2 is selected from methyl.

9. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to any one of claims 1-8, characterized in that, R3 and R4 are independently selected from H, unsubstituted or substituted C1-C6 alkyl groups, 6- to 8-membered aryl groups, 5- to 6-membered heteroaryl groups, 3- to 5-membered cycloalkyl groups, or R3 and R4 forming an unsubstituted or substituted 4- to 6-membered saturated heterocycle with the N atom attached to them, wherein the saturated heterocycle contains 1 to 2 heteroatoms selected from N, O, or S; substitution means that the H atom on the alkyl group or saturated heterocycle is replaced by one or more of -COOH, C1-C3 alkyl groups, hydroxyl groups, F, Cl, and C2-C5 carboxylic acid ester groups; preferably, R3, R4 ... 4 is independently selected from H, methyl, ethyl, n-propyl, isopropyl, hydroxy-substituted ethyl, hydroxy-substituted n-propyl, phenyl, pyridyl, cyclopropyl, or R3, R4 and the N atom attached to them form azirocyclohexyl, carboxyl-substituted azirocyclohexyl, oxazirocyclohexyl, ethyl carboxylate-substituted azirocyclohexyl, fluorine-substituted azirocyclohexyl or azirocyclopentyl; more preferably, R3 is selected from H, R4 is selected from hydroxy-substituted n-propyl, or R3, R4 and the N atom attached to them form unsubstituted azirocyclohexyl or carboxyl-substituted azirocyclohexyl.

10. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to any one of claims 1-9, characterized in that, R3 and R4 are not both H.

11. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to any one of claims 1-10, characterized in that, The quinoline compounds have the following (VI) structure: (VI); Wherein, G1, G2, G3, G4, W, Y, and R2 are as defined in any one of claims 1-10.

12. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to any one of claims 1-11, characterized in that, The quinoline compounds have the following (V) structure: Formula (V); Wherein, G1, G2, G3, G4, W, and R2 are as defined in any one of claims 1-10; R9 is selected from H or C1-C6 alkyl groups; preferably H or methyl.

13. The quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts, or cocrystals according to any one of claims 1-12, characterized in that, The quinoline compounds have the following structures:

14. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises any of the quinoline compounds or their stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts or cocrystals as described in any of claims 1-13, and optionally a pharmaceutically acceptable carrier.

15. Use of any quinoline compound or its stereoisomer, deuterated product, solvate, prodrug, metabolite, pharmaceutically acceptable salt or cocrystal as described in any one of claims 1-13, or the pharmaceutical composition of claim 14, in the preparation of a mitochondrial RNA polymerase inhibitor.

16. The use of any quinoline compound or its stereoisomers, deuterated derivatives, solvates, prodrugs, metabolites, pharmaceutically acceptable salts or cocrystals as described in any one of claims 1-13, or the use of the pharmaceutical composition of claim 14 in the preparation of an antitumor drug or a weight-loss drug, preferably, wherein the tumor includes melanoma, liver cancer, pancreatic cancer, lymphoma, acute myeloid leukemia, breast cancer, glioblastoma, cervical cancer, kidney cancer, colorectal cancer or ovarian cancer.

17. Use of any quinoline compound or its stereoisomer, deuterated product, solvate, prodrug, metabolite, pharmaceutically acceptable salt or cocrystal as described in any one of claims 1-13, or the pharmaceutical composition of claim 14, in the preparation of a medicament having one or more of the following effects: lipid-lowering, hypoglycemic, anti-fatty liver, promoting insulin secretion, or improving insulin sensitivity.

18. Use of any quinoline compound or its stereoisomer, deuterated product, solvate, prodrug, metabolite, pharmaceutically acceptable salt or cocrystal as described in any one of claims 1-13, or the pharmaceutical composition of claim 14, in the preparation of a medicament for the prevention or treatment of diabetes or fatty liver disease.

19. An intermediate of any quinoline compound according to claims 1-13, characterized in that, The intermediate is selected from one of the compounds having the structures shown in Formula (VII), Formula (VIII), Formula (IX), Formula (X), Formula (XI), Formula (XII), and Formula (XIII): G1, G2, G3, G4, R1, R2, and W are as defined in any one of claims 1-13; X1 is selected from halogens; R7 is selected from C1-C6 alkyl groups; R8 is selected from C1-C6 alkyl groups.

Images