Rice f-box protein rfb5 and application thereof in regulating grain shape and weight of rice

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to application of rice F-box protein RFB5 in regulating rice grain shape and weight. The application provides a protein RFB5 for regulating rice grain shape and weight and a nucleic acid molecule for coding the protein RFB5, wherein the protein RFB5 is a protein as shown in any one of SEQ ID NO. 1-3 in a sequence listing, and the nucleic acid molecule is a DNA molecule as shown in any one of SEQ ID NO. 4-7 in the sequence listing. The application creates RFB5 gene mutation materials by using a CRISPR / Cas9 gene editing technology, and analysis proves that the RFB5 gene has a function of positively regulating rice grain shape and weight, and the gene function discovery provides a new way for improving rice yield and cultivating high-yield and high-quality rice varieties.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the rice F-box protein RFB5 and its application in regulating rice grain shape and weight. Background Technology

[0002] Rice (Oryza sativa L.) is a crucial food crop in my country, and its yield directly impacts national food security. Grain shape (grain length, width, area, diameter, etc.) is a core agronomical trait determining yield and quality; optimizing grain shape can significantly increase thousand-grain weight and yield, and improve the appearance and quality of rice. However, the genetic regulatory network of grain shape is complex, involving multiple gene interactions and environmental responses, and its molecular mechanisms are not yet fully understood. Addressing the challenges and significant needs of synergistically improving rice yield and quality, the mining of rice grain shape genes and the elucidation of their regulatory mechanisms have been a hot topic in crop research. This has important practical significance for breeding high-yield and high-quality rice varieties and also contributes to national food security and sustainable agricultural development.

[0003] Rice grain shape is a complex quantitative trait with a complex genetic basis, jointly regulated by multiple minor QTLs (quantitative trait loci) and major QTLs. Thanks to advancements in rice genomics, genetics, and molecular biology techniques, significant progress has been made in the cloning and functional study of rice grain shape genes. Researchers have utilized genetic mapping populations such as double haploid (DH), backcross introduction lines (BIL), recombinant inbred lines (RIL), and near-isogenic lines (IL) to discover and clone a large number of genes regulating grain shape. Most rice grain size-regulating genes exhibit pleiotropic effects. Major genes such as GS2, GS3, OsLG3, TGW3 / GL3.3, GL4, TGW6, and GL6 regulate grain length and weight; major genes such as GW2, TGW2, GW5, GW6, and GW8 regulate grain width and weight; and major genes such as OsNF-YB1 and WTG1 regulate grain width and thickness.

[0004] Despite some progress in the study of rice grain shape regulation mechanisms, the genetic regulatory network of grain shape is complex, involving multiple gene interactions and environmental responses, and some rice grain shape genes and their molecular mechanisms have not yet been fully elucidated. Summary of the Invention

[0005] The purpose of this invention is to provide a rice F-box protein RFB5 and its application in regulating rice grain shape and weight. This invention utilizes CRISPR / Cas9 gene editing technology to create RFB5 gene mutant materials, and analysis proves that the RFB5 gene has the function of positively regulating rice grain shape and weight. This gene function discovery provides a new approach to improving rice yield and breeding high-yield and high-quality rice varieties.

[0006] On the one hand, the present invention provides a protein RFB5 that regulates rice grain shape and grain weight, wherein the protein RFB5 is any one of the following:

[0007] A1) Proteins as shown in any amino acid sequence of SEQ ID NO. 1-3 in the sequence listing;

[0008] A2) is a homologous protein derived from rice that shares more than 98% identity with the protein described in A1) and has the same function;

[0009] A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A1).

[0010] On the other hand, the present invention also provides a nucleic acid molecule encoding the protein RFB5, wherein the nucleic acid molecule is any of the following:

[0011] B1) DNA molecules as shown in any of SEQ ID NO.4-6 in the sequence listing;

[0012] B2) DNA molecules as shown in SEQ ID NO.7 of the sequence listing;

[0013] B3) is derived from a DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) or B2) and encodes the protein RFB5.

[0014] B4) hybridizes under stringent conditions with a nucleotide sequence defined by B1) or B2) and encodes a DNA molecule that encodes the protein RFB5.

[0015] On the other hand, the present invention also provides the application of the protein RFB5 or the nucleic acid molecule described herein, wherein the application is any one of the following:

[0016] C1) Application in regulating rice grain shape and / or increasing rice grain weight; or,

[0017] C2) Application in the cultivation of rice germplasm for improved grain shape and / or increased grain weight; or

[0018] C3) Application as a target in the cultivation of rice germplasm with improved grain shape and / or increased grain weight.

[0019] On the other hand, the present invention also provides sgRNA or a recombinant plasmid expressing said sgRNA, wherein the target sequence of said sgRNA is 5'-CTCCCGCCTCCCCGTCAAGT-3' (SEQ ID NO:8).

[0020] On the other hand, the present invention also provides a method for increasing rice grain weight and / or improving rice grain shape, the method comprising increasing the content of protein RFB5 in recipient rice or increasing the activity of protein RFB5 in recipient rice or increasing the expression level of the gene encoding protein RFB5 in recipient rice, to obtain rice with increased grain weight and / or improved grain shape; wherein the protein RFB5 is as described above.

[0021] On the other hand, the present invention also provides the application of substances that increase the content of protein RFB5 in recipient rice, or increase the activity of protein RFB5 in recipient rice, or increase the expression of the gene encoding protein RFB5 in recipient rice in improving rice grain weight and / or improving rice grain shape, wherein the protein RFB5 is as described above, and the nucleic acid molecule encoding the gene of protein RFB5 is as described above.

[0022] Compared to existing technologies, this invention locates a genetically stable QTL qGrain5 with a high phenotypic contribution rate for grain shape and isolates and clones a novel gene, RFB5, that regulates rice grain shape and weight. This invention utilizes CRISPR / Cas9 gene editing technology to create RFB5 gene mutant materials. Phenotypic and gene expression analyses of the mutants demonstrate that rice varieties with high RFB5 gene expression levels have larger grain area, diameter, thousand-grain weight, and grain width. This indicates a positive correlation between RFB5 gene expression levels in young panicle tissue and grain area, diameter, thousand-grain weight, and grain width traits, further supporting the evidence that the RFB5 gene positively regulates grain shape and weight in rice varieties. Attached Figure Description

[0023] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.

[0024] Figure 1 To locate the RFB5 gene and obtain sequence information between parents. Figure 1 Figure A shows the location of the QTL qGrain5 in the grain and the DNA sequence differences of the candidate gene RFB5 between parents. ORF stands for Open Reading Frame, numbers represent base positions, black boxes represent exons, lines represent introns, ATG is the start codon, and TAA is the stop codon. Figure 1 Figure B in the diagram shows the amino acid sequence information of the RFB5 protein. ZH11: Zhonghua No. 11. * indicates the presence of amino acid differences.

[0025] Figure 2 Edit information for crispr-rfb5 plants. rfb5-cr represents crispr-rfb5 plants, black boxes represent exons, straight lines represent introns, ATG, start codon, TAA, and stop codon.

[0026] Figure 3 This provides the RFB5 protein domain and the sequence information of the crispr-rfb5 material. Figure 3 Figure A: Schematic diagram of the RFB5 protein domain. Figure 3 Figure B in the table shows the amino acid sequence information of the RFB5 protein in the crispr-rfb5 material (rfb5-cr) and the wild-type plant (WT, Zhonghua 11, also known as ZH11). The amino acid sequences in red text represent the F-box domains; the underlines indicate frameshift mutations of the RFB5 protein in the crispr-rfb5 material (rfb5-cr).

[0027] Figure 4 The agronomic phenotypic characteristics of the crispr-rfb5 material. Figure 4 Figure A in the figure: Comparison of brown rice grain phenotypes between the cristr-rfb5 material (rfb5-cr) and wild-type plants (wild type, WT, Zhonghua 11, also known as ZH11, the same below); Figure 4 Figure B in the figure: Comparison of grain phenotypes between the crispr-rfb5 material (rfb5-cr) and wild-type plants; Figure 4 Figure C in the figure: Comparison of grain length between the crispr-rfb5 material (rfb5-cr) and wild-type plants; Figure 4 Figure D in the figure: Comparison of grain width between the crispr-rfb5 material (rfb5-cr) and wild-type plants; Figure 4 Figure E in the figure: Comparison of grain length-to-width ratio between the crispr-rfb5 material (rfb5-cr) and wild-type plants; Figure 4 Figure F in the figure: Comparison of grain diameter between the cristr-rfb5 material (rfb5-cr) and wild-type plants; Figure 4 Figure G in the figure: Comparison of grain area between the cristr-rfb5 material (rfb5-cr) and wild-type plants; Figure 4 Figure H in the figure: Comparison of thousand-grain weight of crispr-rfb5 material (rfb5-cr) and wild-type plants; Figure 4 Figure I in the figure: Comparison of spike length between the crispr-rfb5 material (rfb5-cr) and wild-type plants; Figure 4 Figure J in the figure: Comparison of plant height between cristr-rfb5 material (rfb5-cr) and wild-type plants.

[0028] Figure 5 This study investigated the tissue expression of the RFB5 gene and the phenotype of the varietal grains. Figure 5 Figure A in the figure shows the expression of the RFB5 gene in five tissues (root, stem, mature leaf, leaf sheath, and young spike) of the varieties V20B and CPSLO17. Figure 5 Figure B in the figure: Comparison of brown rice grain phenotypes between varieties V20B and CPSLO17, bar value 10mm; Figure 5 Figure C in the figure: Comparison of grain phenotypes between varieties V20B and CPSLO17, bar value 10mm; Figure 5 Figure D in the table: Comparison of grain area for varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure E in the figure: Comparison of grain diameter between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure F in the figure: Comparison of grain weight between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure G in the figure: Comparison of grain length between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure H in the figure: Comparison of grain width between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure I in the table: Comparison of grain length-to-width ratio between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure J: Comparison of brown rice grain area between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 K-plot in the figure: Comparison of brown rice grain diameter between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure L in the figure: Comparison of brown rice grain weight between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure M in the figure: Comparison of brown rice grain length between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure N: Comparison of brown rice grain width between varieties V20B and CPSLO17 in 2023 and 2024; Figure 5 Figure O in the figure: Comparison of the length-to-width ratio of brown rice grains of varieties V20B and CPSLO17 in 2023 and 2024. Detailed Implementation

[0029] The following examples are provided to better understand the present invention, but do not limit the invention. Unless otherwise specified, the experimental methods in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0030] Example 1: Rice grain shape QTL qRGS5 positioning

[0031] Based on high-density genetic linkage maps constructed using recombinant inbred lines (RILs) derived from the coarse-grained variety V20B and the fine-grained variety CPSLO17, and combined with phenotypic data of rice grain traits (area, diameter, and thousand-grain weight) from 150 RIL populations, this invention utilizes the ICIM-ADD method in IciMapping 4.0 software to perform QTL mapping for three grain traits (area, diameter, and thousand-grain weight). The QTL mapping results are shown in Table 1. All three grain traits (area, diameter, and thousand-grain weight) were detected within the same rice grain trait QTL qGrain5 in the M1578478-M1557404 region on chromosome 5. The LOD values ​​of QTL qGrain5 for area, diameter, and thousand-grain weight were 4.83, 4.83, and 6.721, respectively, explaining 11.35%, 11.34%, and 17.07% of the population phenotypic variation (all with phenotypic contribution rates greater than 10%). The additive effects were 0.084, 0.698, and 1.221, respectively, indicating that qGrain5 is a major QTL with a high phenotypic contribution rate for grain traits, and the alleles that enhance the grain traits all originated from the parent V20B.

[0032] Table 1. QTL analysis of rice grain traits

[0033]

[0034] Example 2 Candidate gene RFB5

[0035] To analyze the physical location of the QTL qGrain5 locus on the chromosome, using the *Oryza sativas sp. japonica cv. Nipponbare* as a reference sequence, a BLAST search was performed on the DNA sequences marked M1578478 and M1557404 on The Rice Annotation Project (RAP) website, selecting the Rice genome sequence (IRGSP-1.0) database. The search results showed that the physical distance between the QTL qGrain5 locus (M1578478-M1557404) was only 41.3 kb. Figure 1As shown. To further search for candidate genes at the qGrain5 locus, a JBrowser search was performed on the RAP website. The results revealed that the qGrain5 localization region contains six open reading frames (ORFs), named ORF1-ORF6. To identify candidate genes for the QTL qGrain5 locus, specific primers were designed based on the sequence information of the six open reading frames (ORF1-ORF6), and PCR amplification of the exogenous DNA of the six ORFs was performed on the parental V20B and CPSLO17. Through sequencing and sequence alignment analysis, the candidate gene for the QTL qGrain5 locus was identified and named RFB5 (Rice F-Box protein 5).

[0036] The RFB5 protein consists of 167 amino acids. The amino acid sequence of the parent V20B is shown in SEQ ID NO: 1, the amino acid sequence of the parent CPSLO17 is shown in SEQ ID NO: 2, and the amino acid sequence of Zhonghua 11 (ZH11, hereinafter the same) is shown in SEQ ID NO: 3. Simultaneously, the nucleotide sequence of the parent V20B is shown in SEQ ID NO: 4, the nucleotide sequence of the parent CPSLO17 is shown in SEQ ID NO: 5, and the amino acid sequence of Zhonghua 11 (ZH11, hereinafter the same) is shown in SEQ ID NO: 6. Its CDS sequence is shown in SEQ ID NO: 7.

[0037] DNA sequence differences of the RFB5 gene between parents are shown in the figure. Figure 1 Figure A shows three SNP differences in the first exon and two SNP differences in the first intron. At 75 bp after the start codon ATG of the RFB5 gene, ZH11 is base A, and V20B and CPSLO17 are base C; at 154-155 bp after ATG, ZH11 is base GG, V20B is base AT, and CPSLO17 is base GG; at 242 bp after ATG, ZH11 and V20B are base C, and CPSLO17 is base T; at 516 bp after ATG, ZH11 and V20B are base C, and CPSLO17 is base A; at 525 bp after ATG, ZH11 and V20B are base A, and CPSLO17 is base G. Figure 1 Figure A in the table shows the differences in the amino acid sequence of RFB5 protein between parents. Figure 1In Figure B, at position 25a.a., ZH11 is glutamic acid (E), and V20B and CPSLO17 are aspartic acid (D); at position 52a.a., ZH11 is glycine (G), V20B is isoleucine (I), and CPSLO17 is glycine (G); at position 81a.a., V20B and ZH11 are proline (P), while CPSLO17 is leucine (L). Figure 1 (Figure B in the diagram).

[0038] Example 3: RFB5 gene negatively regulates rice grain weight and grain size

[0039] To analyze the biological function of the RFB5 gene, this invention uses the CRISPR / Cas9 genome editing system from the laboratory of Liu Yaoguang at South China Agricultural University (Ma X, Zhu Q, Chen Y and Liu Y G. CRISPR / Cas9 Platforms for Genome Editing in Plants: Developments and Applications. MolPlant. 2016, 9(7): 961-974.). Target site U3 (guide sequence: CTCCCGCCTCCCCGTCAAGTCGG (SEQ ID NO: 8)) was designed near the start codon of the RFB5 gene. Specific primers U3-F and U3-R were designed, and primer sequence information is shown in Table 2. The vector backbone is pLY-crISP R / Cas9-MH, and the CRISPR vector CRISPR-RFB5 for the RFB5 gene was constructed.

[0040] Table 2 shows the CRISPR vector construction primers and detection primers used.

[0041]

[0042] To create crispr-rfb5 genetic material with an RFB5 gene mutation, the vector CRISPR-RF B5 was transformed into Agrobacterium tumefaciens EHA105, and the callus of Zhonghua 11 (ZH11, hereinafter the same) was infected using Agrobacterium-mediated transformation. Specific primers CR-RFB5-F / CR-RFB5-R were designed on both sides of the RFB5 gene target site, and combined with vector primers SP-L / SP-R. PCR detection and TA cloning sequencing analysis were used to obtain plants with an editing mutation at the target site (CTCCCGCC TCCCCGTCAAGT), named rfb5-cr. Compared with wild-type plants (WT, Zhonghua 11 is also known as ZH11, hereinafter the same), the RFB5 gene of rfb5-cr plants has an insertion of a T base 109 bp downstream of ATG (see...). Figure 2).

[0043] The RFB5 gene annotation indicates that it is an RFB5-F-box domain containing protein. The CDS sequence of the RFB5 gene is shown in SEQ ID NO: 7. The RFB5 protein consists of 167 amino acids, and its amino acid sequence is shown in SEQ ID NO: 1. The amino acid sequence of the parental V20B is shown in SEQ ID NO: 2, and the amino acid sequence of the RFB5 gene in the parental C PSLO17 is shown in SEQ ID NO: 3. A search on the SMART website (http: / / smart.embl-heidelberg.de / smart / ) revealed that the RFB5 protein contains a conserved F-box domain (see...). Figure 3 (See Figure A in the diagram). The amino acid sequence of the F-box domain is shown in Figure A. Figure 3 Figure B in the diagram. Searches on the websites Plant-mPLoc (http: / / www.csbio.sjtu.edu.cn / bioinf / plant-multi / ) and ProtComp v.9.0 (http: / / www.softberry.com / ) revealed that the RFB5 protein is a nuclear localization protein. Compared to wild-type plants (WT), the rfb5-cr plants underwent a frameshift mutation (V is a synonymous mutation) starting from valine (Val, V) at position 37, disrupting the F-box domain and forming a truncated protein of only 82 amino acids (see Figure B). Figure 3 (Figure B in the diagram) shows that the normal biological function of the RFB5 protein has been lost, indicating that the rfb5-cr plant is a loss-of-function mutant.

[0044] Under natural summer planting conditions in Wuhan, Hubei Province, the brown rice grain phenotypes of the cristr-rfb5 material and wild-type plants (wild type, WT, Zhonghua 11, also known as ZH11, hereinafter the same) were as follows: Figure 4 As shown in Figure A, the grain phenotype is as follows: Figure 4 As shown in Figure B. Measurements by the appearance quality analyzer indicated that, compared to wild-type plants (WT), the grain length of rice from rfb5-cr plants lacking RFB5 gene function (…) Figure 4 (C diagram in the image), particle width ( Figure 4 (D diagram in the middle), diameter ( Figure 4 (F diagram in the middle), area ( Figure 4 G diagram in the figure), thousand-grain weight ( Figure 4 The H-plots in the figures all decreased, and the differences were extremely significant; the length-to-width ratio of the grains showed no significant difference. Figure 4 (Figure E in the diagram); while the ear length increases ( Figure 4 (Figure I in the image) The plant height has increased significantly. Figure 4(See Figure J in the figure). These results indicate that the RFB5 gene positively regulates rice grain shape and weight. The grain shape and weight of rfb5-cr plants with loss of RFB5 gene function are reduced, which also verifies that the rice grain trait QTL qGrain5 regulates grain area, diameter and thousand-grain weight.

[0045] Example 4: Function of the RFB5 gene in spikelet development

[0046] Gene function is closely related to gene expression location. To analyze the tissue expression pattern of the RFB5 gene, this invention detected the expression levels of the RFB5 gene in five different tissues (stem, root, mature leaf, leaf sheath, and young spike) of plants from varieties V20B and CPSLO17. The RFB5 gene was expressed in all five tissues, indicating constitutive expression. The tissue expression patterns of the RFB5 gene in varieties V20B and CPSLO17 were completely consistent, with the highest expression level in the young spike tissue, followed by the stem, then mature leaves, leaf sheaths, and roots (see...). Figure 5 Figure A in the figure shows that the RFB5 gene is actively expressed and plays a biological role during the development of rice panicles.

[0047] Example 5: Grain shape and weight among varieties are positively correlated with RFB5 gene expression levels.

[0048] Grains develop from young spikelet tissue. To examine the intrinsic relationship between the actively expressed RFB5 gene in young spikelet tissue and grain (rice grain and brown rice grain) phenotype, this invention analyzed the tissue expression differences of the RFB5 gene between varieties V20B and CPSLO17. In young spikelets and roots, the expression level of the RFB5 gene in variety V20B was significantly higher than that in variety CPSLO17; in leaf sheaths, there was no difference in the expression level of the RFB5 gene between varieties V20B and CPSLO17; in stems and mature leaves, the expression level of the RFB5 gene in variety V20B was significantly lower than that in variety CPSLO17 (see...). Figure 5 (Figure A in the figure). Under natural summer planting conditions in Guiyang, Guizhou, the brown rice grain phenotypes of varieties V20B and CPSLO17 are as follows: Figure 5 As shown in Figure B, the grain phenotype is as follows: Figure 5 As shown in Figure C. Furthermore, grain quality assessments in 2023 and 2024 both indicated that, compared to variety CPSLO17, variety V20B had a significantly larger grain (rice and brown rice) area, with a highly significant difference (see Figure C). Figure 5 (See Figures D and J in the diagram); V20B grains (rice grains and brown rice grains) showed a significantly increased diameter, with highly significant differences (see Figures D and J in the diagram). Figure 5 (See Figures E and K in the original text); V20B grains (rice grains and brown rice grains) showed a significant increase in grain weight, with highly significant differences (see Figures E and K in the original text). Figure 5 (See F and L diagrams in the figure); V20B grains (rice grains and brown rice grains) showed no difference in grain length (see F and L diagrams in the figure); Figure 5 (See G and M diagrams); V20B grains (rice grains and brown rice grains) showed a significant increase in grain width, with highly significant differences (see G and M diagrams). Figure 5 (See H and N diagrams in the figure); the length-to-width ratio of V20B grains (rice grains and brown rice grains) was significantly reduced, with highly significant differences (see H and N diagrams in the figure). Figure 5 (Figures I and O in the original text). These data reveal that the V20B variety, which has a high expression level of the RFB5 gene in the young panicle tissue, has large grain area, diameter, thousand-grain weight, and grain width. That is, the expression level of the RFB5 gene in the young panicle tissue is positively correlated with the grain area, diameter, thousand-grain weight, and grain width traits, which also confirms that the RFB5 gene positively regulates the grain shape and grain weight of rice varieties.

[0049] Unless otherwise specifically stated, the numerical values ​​set forth in these embodiments do not limit the scope of the invention. In all examples shown and described herein, any specific value should be interpreted as merely exemplary and not as a limitation, unless otherwise specified; therefore, other examples of exemplary embodiments may have different values.

Claims

1. RFB5, a protein that regulates rice grain shape and weight, is characterized by: The protein RFB5 is any one of the following: A1) Proteins as shown in any amino acid sequence of SEQ ID NO. 1-3 in the sequence listing; A2) is a homologous protein derived from rice that shares more than 98% identity with the protein described in A1) and has the same function; A3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of A1) or A1).

2. A nucleic acid molecule encoding the protein RFB5 of claim 1, characterized in that, The nucleic acid molecule is any one of the following: B1) DNA molecules as shown in any of SEQ ID NO.4-7 in the sequence listing; B2) is derived from a DNA molecule that has 75% or more identity with the nucleotide sequence defined in B1) and encodes the protein RFB5 of claim 1. B3) hybridizes with the nucleotide sequence defined in B1) under stringent conditions and encodes a DNA molecule of the protein RFB5 as claimed in claim 1.

3. The application of the protein RFB5 according to claim 1 or the nucleic acid molecule according to claim 2, characterized in that, For any of the following, C1) Application in regulating rice grain shape and / or increasing rice grain weight; or, C2) Application in the cultivation of rice germplasm for improved grain shape and / or increased grain weight; or C3) Application as a target in the cultivation of rice germplasm with improved grain shape and / or increased grain weight.

4. sgRNA or a recombinant plasmid expressing said sgRNA, characterized in that, The target sequence of the sgRNA is 5'-CTCCCGCCTCCCCGTCAAGT-3'.

5. A method for increasing rice grain weight and / or improving rice grain shape, characterized in that, The method includes increasing the content of protein RFB5 in recipient rice, increasing the activity of protein RFB5 in recipient rice, or increasing the expression level of the gene encoding protein RFB5 in recipient rice, to obtain rice with increased grain weight and / or improved grain shape; wherein the protein RFB5 is as described in claim 1.

6. The application of a substance that increases the content of protein RFB5 in recipient rice, or increases the activity of protein RFB5 in recipient rice, or increases the expression of the gene encoding protein RFB5 in recipient rice, in improving rice grain weight and / or improving rice grain shape, wherein the protein RFB5 is as described in claim 1, and the nucleic acid molecule encoding the gene of protein RFB5 is as described in claim 2.

Images