RT1 protein related to root thickness of rice and its coding gene and application

Abstract

The application discloses a rice root-thickness-related RT1 protein and a coding gene and application thereof. The application provides the following protein: an amino acid sequence as shown in SEQ ID No. 1 or a protein with 99%, 95%, 90%, 85% or 80% homology and the same function or a fusion protein obtained after a tag is connected to the N terminal and / or C terminal of the protein through substitution, deletion and / or addition of one or more amino acid residues. The RT1 protein and the coding gene provided by the application can regulate the rice root thickness and control the change of the rice root structure, the rice variety root system traits can be improved by using the gene, and the gene has important significance for cultivating new rice drought-resistant varieties.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the RT1 protein related to rice root thickness, its encoding gene, and its applications. Background Technology

[0002] Rice is one of the world's most important food crops and my country's primary staple food crop, providing nutrition and calories for more than half of the population in my country and even the world. However, traditional rice cultivation consumes a large amount of freshwater resources. With global warming and rapid population growth, water scarcity is becoming increasingly serious, and drought has become one of the most severe environmental stressors in agriculture in my country and globally. Drought severely impacts rice yields and poses a significant threat to my country's food security. Therefore, developing new water-saving and drought-resistant rice varieties is of great practical significance.

[0003] Roots are vital nutrient organs for plants, enabling them to absorb water and nutrients and sense soil conditions. A well-developed root system is crucial for optimal crop growth and yield. Studies have shown that root length and root diameter are two agronomic traits most closely related to drought resistance in rice. To date, reports on rice root diameter genes are relatively few, and the molecular mechanisms are not fully understood. Utilizing germplasm resources to discover new root diameter genes can not only enrich our understanding of root development regulation mechanisms but also provide new genetic resources for rice root improvement and upland rice variety breeding.

[0004] Compared to traditional breeding methods, which are characterized by long cycles, high randomness, and unstable varieties, genetic engineering breeding can directly and directionally modify the genetic traits of plants at the gene level, breaking down interspecific isolation, improving the stability of bred varieties, and greatly shortening the breeding cycle. It is one of the effective ways to breed drought-resistant varieties in the future. Summary of the Invention

[0005] The purpose of this invention is to provide a method for controlling rice root crude protein RT1, its encoding gene, and its applications.

[0006] Firstly, this invention claims protection for a protein.

[0007] The protein claimed in this invention is derived from rice, and may specifically be any of the following proteins:

[0008] (A1) A protein with the amino acid sequence shown in SEQ ID No. 1;

[0009] (A2) A protein having the same function by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in (A1).

[0010] Proteins that have 99%, 95%, 90%, 85%, or 80% homology with any of the amino acid sequences defined in (A3)-(A1)-(A2) and have the same function;

[0011] (A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1)-(A3).

[0012] In the aforementioned proteins, the tag refers to a polypeptide or protein fused with the target protein using in vitro DNA recombination technology for expression, to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.

[0013] In the proteins mentioned above, homology refers to the similarity of amino acid sequences. The similarity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI website. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the similarity of a pair of amino acid sequences, the homology value (%) can then be obtained.

[0014] In the aforementioned proteins, the homology of 95% or more can be at least 96%, 97%, or 98%. The homology of 90% or more can be at least 91%, 92%, 93%, or 94%. The homology of 85% or more can be at least 86%, 87%, 88%, or 89%. The homology of 80% or more can be at least 81%, 82%, 83%, or 84%.

[0015] Secondly, the present invention claims protection for nucleic acid molecules encoding the proteins described above.

[0016] The nucleic acid molecule can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA.

[0017] Furthermore, the nucleic acid molecule may be any of the following:

[0018] (B1) The DNA molecule shown in SEQ ID No. 2;

[0019] (B2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (B1) and encodes the protein thereon;

[0020] A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the DNA sequences defined by (B3) and (B1)-(B2) and encodes the protein.

[0021] The stringent conditions for the above nucleic acid molecules can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS. Alternatively, the membrane can be rinsed in SDS; or hybridized at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4 and 1mM EDTA, and then rinsed at 65°C in 0.1×SSC and 0.1% SDS; or hybridized at 65°C in a solution of 6×SSC and 0.5% SDS, and then washed once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.

[0022] In the aforementioned nucleic acid molecules, homology refers to the similarity of nucleotide sequences. The similarity of nucleotide sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI website. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search for the similarity of a pair of nucleotide sequences, the homology value (%) can be obtained.

[0023] In the aforementioned nucleic acid molecules, the homology of 95% or more can be at least 96%, 97%, or 98%. The homology of 90% or more can be at least 91%, 92%, 93%, or 94%. The homology of 85% or more can be at least 86%, 87%, 88%, or 89%. The homology of 80% or more can be at least 81%, 82%, 83%, or 84%.

[0024] Thirdly, the present invention claims protection for expression cassettes, recombinant vectors, recombinant bacteria or transgenic cell lines containing the nucleic acid molecules described above.

[0025] The expression cassette refers to DNA capable of expressing the protein in a host cell. This DNA includes not only a promoter to initiate transcription of the protein-coding gene but also a terminator to terminate transcription. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in this invention include, but are not limited to, constitutive promoters, tissue-specific promoters, and inducible promoters. Enhancers that can be used in this invention may include translational enhancers or transcriptional enhancers, and these enhancer regions may be ATG start codons or adjacent region start codons, etc. The sources of translation control signals are broad and can be natural or synthetic. Translation initiation regions may originate from transcription initiation regions or structural genes.

[0026] To facilitate the identification and screening of transgenic cell lines or recombinant bacteria, the recombinant vectors used can be processed, such as by adding genes that can be expressed in host cells, encoding enzymes or luminescent compounds that produce color changes (luciferase genes, etc.), or antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.).

[0027] The recombinant vector may be a bacterial plasmid, bacteriophage, yeast plasmid, or retroviral packaging plasmid, etc.

[0028] The recombinant bacteria can be prokaryotic cells or lower eukaryotic cells.

[0029] Fourthly, the present invention claims protection for the use of the protein described in the first aspect above, the nucleic acid molecule described in the second aspect above, or the expression cassette, recombinant vector, recombinant bacteria, or transgenic cell line described in the third aspect above, in any of the following:

[0030] (a1) Regulates plant root thickness;

[0031] (a2) Regulating plant root volume;

[0032] (a3) Regulates plant root development;

[0033] (a4) Regulates plant drought resistance;

[0034] (a5) Regulates plant resistance to osmotic stress;

[0035] (a6) Regulate the diameter of the stele in plant roots and the thickness of the cortex or aerenchyma;

[0036] (a7) Regulates the cell wall thickness of plant root sclerenchyma tissue;

[0037] (a8) Regulates the lignin content in plant roots.

[0038] In the application described, the expression level and / or activity of the protein increases, resulting in thicker roots and / or increased root volume and / or enhanced drought resistance and / or increased root stele diameter, cortex or aerenchyma thickness and / or increased root sclerenchyma cell wall thickness and / or increased root lignin content; and / or, the expression level and / or activity of the protein decreases, resulting in thinner roots and / or decreased root volume and / or reduced drought resistance and / or decreased root stele diameter, cortex or aerenchyma thickness and / or thinner root sclerenchyma cell wall thickness and / or decreased root lignin content.

[0039] Fifthly, the present invention claims protection for a method for cultivating plant varieties.

[0040] The method for cultivating plant varieties claimed in this invention may be any of the following:

[0041] Method A1: A method for breeding plant varieties having all or some of the traits shown in (b1)-(b6) below, comprising the step of increasing the expression level and / or activity of the proteins described above in the recipient plant;

[0042] (b1) The root thickens;

[0043] (b2) Root volume increases;

[0044] (b3) Enhanced drought resistance;

[0045] (b4) Increased diameter of the root stele, cortex or aerenchyma thickness;

[0046] (b5) Increased cell wall thickness in root sclerenchyma tissue;

[0047] (b6) Increased lignin content in roots;

[0048] Method A2: A method for breeding plant varieties having all or some of the traits shown in (c1)-(c6) below, comprising the step of reducing the expression level and / or activity of the proteins described above in the recipient plant;

[0049] (c1) The root becomes thinner after thickening;

[0050] (c2) The root volume decreases;

[0051] (c3) Reduced drought resistance;

[0052] (c4) The diameter of the root stele and the thickness of the cortex or aerenchyma are reduced;

[0053] (c5) The cell walls of the root sclerenchyma tissue become thinner;

[0054] (c6) Root lignin content decreased;

[0055] In method A1 above, the increase in the expression level and / or activity of the aforementioned protein in the recipient plant can be achieved by any technical means, such as introducing the nucleic acid molecule described in the second aspect above into the recipient plant.

[0056] In method A2 above, the reduction of the expression level and / or activity of the aforementioned proteins in the recipient plant can be achieved by any technical means, such as knocking out or inhibiting the nucleic acid molecules described in the second aspect above in the recipient plant.

[0057] Sixthly, the present invention claims protection for a method for cultivating transgenic plants.

[0058] The method for cultivating transgenic plants claimed in this invention may be any of the following:

[0059] Method B1: A method for cultivating a transgenic plant having all or some of the traits shown in (b1)-(b6) below, comprising the steps of: introducing the nucleic acid molecule described in the second aspect above into a recipient plant to obtain a transgenic plant; wherein the transgenic plant has all or some of the traits shown in (b1)-(b6) below compared with the recipient plant;

[0060] (b1) The root thickens;

[0061] (b2) Root volume increases;

[0062] (b3) Enhanced drought resistance;

[0063] (b4) Increased diameter of the root stele, cortex or aerenchyma thickness;

[0064] (b5) Increased cell wall thickness in root sclerenchyma tissue;

[0065] (b6) Increased lignin content in roots;

[0066] Method B2: A method for cultivating a transgenic plant having all or some of the traits shown in (c1)-(c6) below, comprising the following steps: inhibiting the expression of nucleic acid molecules in a recipient plant capable of expressing the proteins described above, thereby obtaining a transgenic plant; the transgenic plant having all or some of the traits shown in (c1)-(c6) below compared to the recipient plant;

[0067] (c1) The root becomes thinner after thickening;

[0068] (c2) The root volume decreases;

[0069] (c3) Reduced drought resistance;

[0070] (c4) The diameter of the root stele and the thickness of the cortex or aerenchyma are reduced;

[0071] (c5) The cell walls of the root sclerenchyma tissue become thinner;

[0072] (c6) Root lignin content decreased;

[0073] In method B1 above, the nucleic acid molecule can be introduced into the recipient plant in the form of a recombinant vector.

[0074] In this invention, the promoter for initiating gene expression in the recombinant vector is the 35S promoter. More specifically, in one embodiment of this invention, the recombinant vector is a recombinant plasmid obtained by inserting the gene (SEQ ID No. 2) into multiple cloning sites (such as KpnI and SpeI) of the pCM1307 vector.

[0075] In method B2 above, the inhibition of expression of nucleic acid molecules capable of expressing the proteins described above in the recipient plant can be achieved by any technical means that can achieve this purpose, such as by specifically cleaving the nucleic acid molecules with a sequence-specific nuclease (such as CRISPR / Cas9 nuclease) to reduce their expression in the recipient plant.

[0076] In this invention, it is specifically achieved using CRISPER / Cas9 technology; the DNA fragment shown in SEQ ID No. 2 conforms to the 5'-N... X -NGG-3' or 5'-CCN-N X The segment with the -3' sequence arrangement rule is the target sequence; N represents any one of A, G, C, and T, 14≤X≤30, and X is an integer, N X It represents X consecutive deoxyribonucleotides.

[0077] In the method, the recombinant vector carrying the nucleic acid molecule or the gene editing tool used to knock out or inhibit the expression of the nucleic acid molecule in the recipient plant is introduced into the recipient plant. Specifically, this can be done by transforming plant cells or tissues using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electrocoagulation, or Agrobacterium-mediated transformation, and then cultivating the transformed plant tissues into plants.

[0078] In all of the above aspects, the plant may be a monocotyledonous plant.

[0079] Furthermore, the monocotyledonous plant may be a grass family (Poaceae).

[0080] Furthermore, the grass species mentioned can specifically be rice.

[0081] The RT1 protein and its encoding gene provided by this invention can regulate rice root diameter and root volume, and regulate rice drought resistance. This gene can be used to improve the root traits of rice varieties, which is of great significance for breeding new drought-resistant rice varieties. Attached Figure Description

[0082] Figure 1 Candidate gene analysis for qRT1d;

[0083] Figure 2 For the identification of RT1 transgenic plants;

[0084] Figure 3 To identify the root phenotype of RT1 transgenic plants;

[0085] Figure 4 Cytological observation of root cross-section of RT1 transgenic plants;

[0086] Figure 5 To assess the drought resistance of RT1 transgenic plants during the seedling stage. Detailed Implementation

[0087] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0088] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0089] YEP liquid culture medium: Dissolve 10g of yeast extract, 5g of NaCl and 10g of tryptone in distilled water, then bring the volume to 1L with distilled water and autoclave at 121℃ for 15min.

[0090] YEP solid medium: Dissolve 10g of yeast extract, 5g of NaCl and 10g of tryptone in distilled water, then bring the volume to 1L with distilled water, and finally add 15g of agar powder. Autoclave at 121℃ for 15min.

[0091] AAM liquid culture medium: Dissolve 50 ml of AAM (20×), 5 ml of MS (200×), 10 ml of AAM organic (100×), 10 ml of iron salt (100×), 500 mg of hydrolyzed casein, 68.5 g of sucrose, 36 g of glucose, 75 mg of glycine, 877 mg of glutamine, 266 mg of aspartic acid, and 228 mg of arginine in an appropriate amount of deionized water, then bring the volume to 1 L with deionized water, adjust the pH to 5.5, and autoclave at 115℃ for 15 min; finally, add 1 ml of 20 mg / ml acetylsuccione solution and mix well.

[0092] AAM (20×): Dissolve 6.645g CaCl2, 58.8g KCl, 3.4g KH2PO4 and 7.4g MgSO4·7H2O in an appropriate amount of distilled water, and then make up to 1L with distilled water.

[0093] MS micro-scale (200×): Dissolve 166 mg KI, 3.38 g MnSO4·H2O, 1.24 g H3BO3, 50 mg Na2MoO4·2H2O, 1.72 g ZnSO4·7H2O, 5 g CoCl2·6H2O and 5 g CuSO4·5H2O in an appropriate amount of distilled water, and then make up to 1 L with distilled water.

[0094] AAM Organic (100×): Dissolve 50mg of vitamin B1, 50mg of vitamin B5 and 10mg of vitamin B6 in an appropriate amount of distilled water, and then bring the volume up to 1L with distilled water.

[0095] Iron salt (100×): Dissolve 3.73g Na2EDTA.2H2O and 2.78g FeSO4.7H2O in an appropriate amount of distilled water, and then make up to 1L with distilled water.

[0096] NB solid culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, and 3 g of plant gel in 1 L of distilled water, then adjust the pH to 5.8 and autoclave for 20 min.

[0097] Co-culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, and 2 mg of 2,4-D in 1 L of distilled water, adjust the pH to 5.4, sterilize at 121℃ for 15 min, and when cooled to 50-60℃, add 10 g of glucose and 20 mg of acetylsuccinone that have been filtered and sterilized with 0.22 μM.

[0098] Delayed screening medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, and 2 mg of 2,4-D in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121 °C for 15 min, and add 500 mg of cephalosporin that has been filtered and sterilized with 0.22 μM solution when the medium has cooled to 50–60 °C.

[0099] First round of screening culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 500 mg of cephalosporin and 50 mg of hygromycin after filtration sterilization at 0.22 μM when the temperature has cooled to 50-60℃.

[0100] Second round of screening culture medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel and 2,4-D 2 mg in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized with 0.22 μM when the temperature has cooled to 50-60℃.

[0101] Predifferentiation medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, 1 mg of 6-BA, 2 mg of NAA and 5 mg of ABA in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121℃ for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized with 0.22 μM solution when cooled to 50-60℃.

[0102] Differentiation medium: Dissolve 20 mL of 50×N6 large volume stock solution, 10 mL of 100×B5 micro volume stock solution, 1 mL of 1000×B5 organic stock solution, 150 mg of inositol, 300 mg of hydrolyzed casein, 500 mg of glutamine, 600 mg of proline, 30.0 g of sucrose, 3 g of plant gel, 2 mg of 6-BA, 1 mg of NAA, and 1 mg of KT in 1 L of distilled water, adjust the pH to 5.8, sterilize at 121 °C for 15 min, and add 50 mg of hygromycin that has been filtered and sterilized with 0.22 μM solution when the temperature has cooled to 50–60 °C.

[0103] Seedling growth medium: Dissolve 25 mL of 20×MS large volume stock solution, 2.5 mL of 200×MS micro volume stock solution, 2.5 mL of 200×MS iron salt stock solution, 2.5 mL of 200×MS organic stock solution, 3 g of plant gel, 0.5 mg of NAA and 0.25 mg of paclobutrazol in 1 L of distilled water, adjust the pH to 5.8, and sterilize at 121℃ for 15 min.

[0104] The solutes and their concentrations in the 20×MS mother liquor were 38.00 g / L KNO3, 8.80 g / L CaCl2·2H2O, 7.40 g / L MgSO4·7H2O, 3.40 g / L KH2PO4, and 33.00 g / L NH4NO3. The solvent was water, and the pH was natural.

[0105] The solutes and their concentrations in the 200×MS trace mother liquor were 4.46 g / L MnSO4·4H2O, 0.166 g / L KI, 1.24 g / L H3BO3, 1.72 g / L ZnSO4·7H2O, 0.050 g / L Na2MoO4·2H2O, 0.005 g / L CuSO4·5H2O, and 0.005 g / L CoCl2·6H2O. The solvent was water, and the pH was natural.

[0106] The solutes and their concentrations in the 200×MS iron salt mother liquor were 5.56 g / L FeSO4·7H2O and 7.46 g / L Na2·EDTA·2H2O, with water as the solvent and natural pH.

[0107] The solutes and their concentrations in the 200×MS organic mother liquor were 20 g / L inositol, 100 mg / L nicotinic acid, 100 mg / L pyridoxine hydrochloride, 100 mg / L thiamine hydrochloride, and 400 mg / L glycine. The solvent was water, and the pH was natural.

[0108] The solutes and their concentrations in the large volume of 50×N6 mother liquor were 141.50 g / L KNO3, 20 g / L KH2PO4, 23.15 g / L (NH4)2SO4, 9.25 g / L MgSO4·7H2O and 8.30 g / L CaCl2·2H2O, with water as the solvent and natural pH.

[0109] The solutes and their concentrations in the 100×B5 trace mother liquor were 0.3 g / L H3BO3, 1 g / L MnSO4·4H2O, 0.0025 g / L CoCl2·6H2O, 0.0025 g / L CuSO4·5H2O, 0.2 g / L ZnSO4·7H2O, 0.025 g / L Na2MoO4·2H2O, and 0.075 g / L KI. The solvent was water, and the pH was natural.

[0110] The solutes and their concentrations in the 1000×B5 organic mother liquor were 2 g / L glycine, 100 g / L inositol, 1 g / L nicotinic acid, 1 g / L pyridoxine hydrochloride, and 10 g / L thiamine hydrochloride. The solvent was water, and the pH was natural.

[0111] Alternating light and dark culture, with the following conditions: 28℃; 14 hours of light culture / 10 hours of dark culture; light intensity during light culture: 90 μE / m². 2 / s.

[0112] Example 1: Obtaining the RT1 gene

[0113] The inventors of this invention conducted a genome-wide association analysis on root thickness traits from 247 rice microcore germplasms. They found that the QTL qRT1d located on chromosome 1 showed an association signal in all three different models. Figure 1 A). Local LD ​​analysis of qRT1d (r 2 >0.6), resulting in approximately 381kb of candidate blocks ( Figure 1 B). The introduced line IL153, ​​which includes this section, showed an increase in root diameter compared to its parent, YueFu. Figure 1 C and D). This interval contains a total of 59 predicted genes. Combining transcriptome data and permutation tests, four key candidate genes were finally screened out. Among them, ORF4 had the highest expression level in root tissue, especially in the root tissue of upland rice IRAT109, and was significantly higher than that in leaf tissue. Figure 1 E). In the introduced IL153 line, the expression level of ORF4 was also significantly increased ( Figure 1F). Based on the above results, ORF4 is presumed to be a candidate gene for qRT1d, named RT1 (Root Thickness 1). RT1 (LOC_Os01g21120) encodes an AP2 family transcription factor.

[0114] The RT1 gene, derived from the rice variety Nipponbare, was finally obtained through screening. The full-length cDNA sequence of the RT1 gene is 624 bp, and its nucleotide sequence is shown in SEQ ID No. 2. The RT1 gene encodes the RT1 protein, and the amino acid sequence of the RT1 protein is shown in SEQ ID No. 1.

[0115] Example 2: Verification of transgenic function of RT1

[0116] I. Construction of RT1 knockout vector

[0117] (1) Log in to http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html to screen target sites. Alternatively, target sites can be designed manually, and off-target effects can be evaluated at http: / / www.rgenome.net / cas-offinder / . Target site editing efficiency can be predicted using the website http: / / www.crisprscan.org / ?page=sequence. The target site sequences designed in this study are:

[0118] T1:5'-CTACATCCCGGCGCGCCGC-3'

[0119] T2:5'-GGCGTCGGGCCAGAAGTCGG-3'

[0120] (2) Primer design:

[0121] MT1-BsF:ATATATGGTCTCTGGCGNNNNNNNNNNNNNNNGTT MT1-F0:TGNNNNNNNNNNNNNNNNNGTTAGAGCTAGAAATAGC MT2-R0:AACNNNNNNNNNNNNNNNNNCGCTTCTTGGTGCC MT2-BsR:ATTATTGGTCTCTAAACNNNNNNNNNNNNNNNNNNNC

[0122] Replace N in MT1-BsF and MT1-F0 with the target T1 sequence, and replace N in MT2-R0 and MT2-BsR with the reverse complementary sequence of the target T2 sequence, to obtain the following primers:

[0123] RT1-T1-BsF:5'-ATATATGGTCTCTGGCGCTACATCCCGGCGCGCCGC GTT-3'

[0124] RT1-T1-F0:5'-TGCTACATCCCGGCGCGCCGCGTTTTAGAGCTAGAAAT AGC-3'

[0125] RT1-T2-R0:5'-AACCCGACTTCTGGCCCGACGCCCGCTTCTTGGTGC C-3'

[0126] RT1-T2-BsR:5'-ATTATTGGTCTCTAAACCCGACTTCTGGCCCGACG CCC-3'

[0127] (3) Obtaining the target fragment:

[0128] Using the intermediate vector pCBC-MT1T2 (described in the following literature: Xing, HL, Dong, Wang, ZP, Zhang, HY, Han, CY, Liu. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMCPLANT BIOL, 2014) as a template, four-primer PCR amplification was performed (-BsF / -BsR were normal primer concentrations; -F0 / -R0 were diluted 20-fold). The target PCR products were recovered by agarose gel electrophoresis.

[0129] (4) Establish an enzyme digestion-ligation system:

[0130] Enzyme digestion-ligation system (15 μL): 2 μL PCR recovered fragment (964 bp), 2 μL pHUE411 (described in the following literature: Xing, HL, Dong, Wang, ZP, Zhang, HY, Han, CY, Liu. Acrispr / cas9 toolkit for multiplex genome editing in plants. BMC PLANT BIOL, 2014), 1.5 μL 10×NEB T4 Buffer, 1.5 μL T4 Ligase (NEB), 1 μL BsaI (NEB), 1 μL 10×Cutsmart buffer, and bring the volume to 15 μL.

[0131] Reaction conditions: 37℃ for 5 hours; 50℃ for 5 minutes; 80℃ for 10 minutes.

[0132] (5) Transformation and plasmid extraction: 5 μL of the ligation product was used to transform competent E. coli cells. Kan plate screening was performed. After colony PCR detection, sequencing verification was performed. Single clones with correct sequencing were selected for plasmid extraction and named RT1-KO.

[0133] Colony PCR primers:

[0134] OsU3-FD3:5'-GACAGGCGTCTTCTACTGGTGCTAC-3'

[0135] TaU3-RD:5'-CTCACAAATTATCAGCACGCTAGTC-3'

[0136] Sequencing primers:

[0137] OsU3-FD3

[0138] TaU3-FD2:5'-TTGACTAGCGTGCTGATAATTTGTG-3'

[0139] II. Construction of RT1 Overexpression Recombinant Vectors

[0140] Using rice IRAT109 cDNA as a template, PCR amplification was performed using RT1-HA-F and RT1-HA-R to obtain a 624bp PCR product. After sequencing, the PCR product was identified as the CDS of the RT1 gene.

[0141] RT1-HA-F:

[0142]

[0143] (Contains homologous arms and the restriction endonuclease SpeI)

[0144] RT1-HA-R:

[0145]

[0146] (Contains homologous arms, restriction endonuclease KpnI)

[0147] The above sequence was replaced by homologous recombination to replace the fragment between the SpeI and KpnI restriction sites on the expression vector pCM1307-3FLAG (described in the following literature: Rice SPL10 positively regulates trichome development through expression of HL6 and auxin-related genes[J]. Journal of Integrative Plant Biology, 2021., named pCM1307-3FLAG vector in the literature), resulting in the recombinant vector Pro35S::RT1, which is the RT1 overexpression recombinant vector.

[0148] III. Obtaining Genetically Modified Rice

[0149] (1) Recombinant bacteria

[0150] The knockout vector RT1-KO and the overexpression recombinant vector Pro35S::RT1 prepared above were transformed into Agrobacterium tumefaciens EHA105 using a freeze-thaw method to obtain recombinant bacteria, which were used to infect callus of transgenic recipient varieties. The recipient variety for the knockout vector was the background-rich introduction line IL153, ​​and the recipient variety for the overexpression recombinant vector was Nipponbare.

[0151] (2) Rice

[0152] The classic Agrobacterium-mediated callus infection method is adopted, and the specific steps are as follows:

[0153] a. Obtaining embryogenic callus: After removing the shell from mature seeds, disinfect them with alcohol, then with 10% sodium hypochlorite, rinse with sterile water 6-7 times, and air dry for 3 hours. Inoculate on NB medium and incubate in the dark at 28°C for 2 weeks. Peel off the embryogenic callus and subculture it into fresh NB medium for 2 weeks (subculture twice).

[0154] b. Preparation of infection solution: Take the preserved Agrobacterium solution and spread it on a solid culture medium containing rifampicin and the corresponding antibiotic. Incubate in the dark at 28°C for 2 days. Scrape a small amount of Agrobacterium into AAM liquid culture medium. The bacterial concentration OD600 is about 0.3.

[0155] c. Co-culture: Select naturally dispersed, bright yellow granular callus tissue with a diameter of about 3-5 mm into an Erlenmeyer flask, add the prepared infection solution, infect for 10 min, absorb excess infection solution with sterile filter paper, place on a co-culture medium lined with a layer of filter paper, and co-culture at 26℃ for 2-3 days.

[0156] d. Screening of resistant callus: The co-cultured callus was removed and washed rapidly with sterile water, agitated 5-6 times. It was then washed with sterile water containing cephalosporin and carbenicillin for 20 minutes, and finally placed on sterile filter paper to drain for 3 hours. It was then transferred to delayed selection medium. After one week, it was transferred to the first-round selection medium, and after two weeks, it was transferred to the second-round selection medium and cultured for another two weeks.

[0157] e. Differentiation: The resistant callus obtained from screening is inoculated into predifferentiation medium and cultured in the dark at 28°C for 2 weeks. Then it is transferred to differentiation medium and cultured under light for 2-3 weeks to obtain regenerated transgenic seedlings.

[0158] f. Transfer the seedlings to a seedling culture medium. After the seedlings have taken root and grown, remove them from the culture bottle, wash off the culture medium from the roots, harden the seedlings for 1-2 weeks, and then transplant them to the field for planting until they mature.

[0159] The culture medium formulations used in the above-mentioned transgenic process are shown in Table 1.

[0160] Table 1. Formulas of various culture media used in the transgenic process.

[0161]

[0162]

[0163] Note: The basic components of NB medium include N6 macroelements, B5 microelements, B5 organic components, 150 mg / L inositol, 300 mg / L hydrolyzed casein, 500 mg / L glutamine, 600 mg / L proline, 30 g / L sucrose, and 3 g / L plant gel.

[0164] IV. Identification of root-related traits in various transgenic rice varieties

[0165] The root traits of each transgenic rice line (RT1-KO1 / 2, RT1-OE3 / 4) obtained in step three were investigated manually, including root diameter and root volume. At least three plants from each line were selected for testing.

[0166] Figure 2 To identify the mutation sites in RT1 knockout-positive lines and the expression levels of RT1 in overexpression-positive lines. RT1-KO1 inserts one T base and one A base at the first and second target sites, respectively, resulting in frameshift mutations; RT1-KO2 inserts one T base at each of the first and second target sites, respectively, resulting in frameshift mutations. Both are homozygous mutations.

[0167] Knockout detection primers:

[0168] RT1-KO-Check-F: TCATACCGCCCATCCAAATC

[0169] RT1-KO-Check-R:ACTGGTTCTTCCGCTCCCTC

[0170] Total RNA was extracted from leaves and the first strand of cDNA was synthesized by reverse transcription using the reverse transcriptase M-MLV. Using this first strand of cDNA as a template, a specific fragment of the RT1 gene was amplified using primers RT1-qpcr-F and RT1-qpcr-R. A specific fragment of the rice Ubiquitin gene was amplified using primers Ubiquitin-F and Ubiquitin-R and used as an internal control for real-time quantitative analysis.

[0171] RT1-qPCR-F: CTCCGACGAGGTCAAGGA

[0172] RT1-qpcr-R: TGCCGAGGAAGCTCATGTAG

[0173] Ubiquitin-F:ACCAGCTGAGGCCCAAGA

[0174] Ubiquitin-R: ACGATTGATTTAACCAGTCCATGA

[0175] Real-time quantitative PCR was performed on an Applied Biosystems 7500 Real-Time PCR system (ABI, USA), with each experiment repeated in triplicate. The method reported by Livak KJ and Schmittgen TD (2001) was used, i.e., 2... -ΔΔCT Calculate the relative expression level.

[0176] ΔΔCT=(CT.Target-CT.Ubiquitin)Time x-(CT.Target-CT.Ubiquitin)Time 0

[0177] Time x represents any time point, and Time 0 represents the target gene expression at 1-fold after Ubiquitin correction.

[0178] The results showed that the expression level of RT1 in RT1-overexpressing plants was significantly higher than that in wild-type Nipponbare.

[0179] Figure 3 To identify the root phenotype of RT1 transgenic plants.

[0180] Root diameter identification at maturity: The root diameter phenotype of each transgenic material at maturity under field conditions was identified. At least three plants of each material were measured. For each plant, the five thickest roots visible to the naked eye about 1 cm from the base were taken. The root diameter was scanned and measured using WinRHIZO software, and the average value was taken as the root diameter value of the material.

[0181] Seedling Root Phenotypic Identification: The root phenotype of each transgenic plantlet at one month of hydroponic cultivation was identified. Root diameter was measured using the same method as at maturity. Three of the thickest roots visible to the naked eye, approximately 1 cm from the base of each plant, were taken, with at least 10 plants of each material measured. Root volume was measured using a graduated cylinder and the displacement method.

[0182] The results showed that RT1 overexpression increased root thickness and root volume, while knockout plants exhibited the opposite phenotype, proving that RT1 is a gene that positively regulates root thickness in rice and also positively affects root volume.

[0183] Example 3: Observation of cytological cross-section of root base of RT1 transgenic plant

[0184] Transverse paraffin sections were prepared from the thickest roots (approximately 1 cm from the base) of RT1 knockout and overexpression transgenic plants grown hydroponically for one month, as well as their corresponding wild-type plants. The sections were 2–4 μm thick and stained with 1% safranin and 0.5% fast green (both stain plant cell walls; safranin stains lignified and suberized cell walls red, reflecting lignin content; fast green stains cellulose cell walls green). The sections were observed under an optical microscope, and the diameter of the stele, the thickness of the aerenchyma, and the thickness of the exodermal cell walls were statistically analyzed. At least three plants were systematically counted for each type of transgenic plant.

[0185] Figure 4 Cytological observation of root cross-sections of RT1 transgenic plants was conducted. Results showed that, compared to the wild-type control IL153, ​​RT1 knockout plants exhibited smaller stele diameter, thinner aerenchyma thickness, and thinner exodermal cell walls; overexpression plants showed the opposite phenotype. This indicates that RT1 regulates root diameter by affecting root stele diameter, aerenchyma thickness, and exodermal cell wall thickness. Furthermore, we found that compared to the wild type, the red staining of the exodermal cell walls in RT1 knockout plants was lighter, while the red staining of both the exodermal and stele cell walls in RT1 overexpression lines was darker. This suggests that RT1 may also positively regulate the lignin content in these tissues.

[0186] Example 4: Identification of drought resistance in RT1 transgenic seedlings

[0187] 20% PEG6000 treatment: Select seeds with uniform germination and plant them in PCR plates with cut holes at the bottom. Hydroponically culture until the two-leaf-one-heart stage (approximately 2 weeks). Then, simulate drought stress treatment using 20% ​​PEG6000 instead of water. For IL153 and RT1 knockout lines, PEG stress treatment was applied for 6 days, followed by rehydration for 3 days; for Nipponbare and RT1 overexpression lines, PEG stress treatment was applied for 4 days, followed by rehydration for 3 days. Survival rate was calculated based on the presence or absence of unfolded leaves.

[0188] Potted plant drought resistance assessment: A 1:1 mixture of potting soil and vermiculite was filled into flowerpots. Seeds from uniformly germinated IL153 and RT1 knockout lines, as well as Nipponbare and RT1 overexpression lines, were planted separately in the same flowerpot containing the mixed soil. The flowerpots were placed in a plastic container filled with water and cultured under normal conditions for about one month. The flowerpots were then removed from the water and withheld from water for 10 days until the soil moisture content reached approximately 10%. Watering was then resumed, and the survival rate was calculated 7 days later based on the presence or absence of unfolded leaves.

[0189] Figure 5 The results of the experiments were used to identify the drought resistance of RT1 transgenic plants at the seedling stage. All the experimental results showed that the survival rate of RT1 knockout lines was significantly lower than that of IL153, ​​while the survival rate of RT1 overexpression lines was significantly higher than that of the Nipponbare control. This indicates that RT1 can positively regulate the drought resistance of rice, and overexpression of RT1 improves the drought resistance of rice.

[0190] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments.

Claims

1. Protein, specifically any of the following: (A1) A protein with the amino acid sequence shown in SEQ ID No. 1; (A2) A protein with the same function as the amino acid sequence shown in (A1) by substitution and / or deletion and / or addition of one or more amino acid residues. Proteins that have 99%, 95%, 90%, 85%, or 80% homology with any of the amino acid sequences defined in (A3)-(A1)-(A2) and have the same function; (A4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1)-(A3).

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is any of the following DNA molecules: (B1) The DNA molecule shown in SEQ ID No. 2; (B2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (B1) and encodes the protein thereon; A DNA molecule that has 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more homology with the DNA sequences defined by (B3) and (B1)-(B2) and encodes the protein.

4. An expression cassette, recombinant vector, recombinant bacteria, or transgenic cell line containing the nucleic acid molecule described in claim 2 or 3.

5. The use of the protein of claim 1, the nucleic acid molecule of claim 2 or 3, or the recombinant vector, recombinant bacteria, or transgenic cell line of claim 4 in any of the following: (a1) Regulates plant root thickness; (a2) Regulating plant root volume; (a3) Regulates plant root development; (a4) Regulates plant drought resistance; (a5) Regulates plant resistance to osmotic stress; (a6) Regulate the diameter of the stele in plant roots and the thickness of the cortex or aerenchyma; (a7) Regulates the cell wall thickness of plant root sclerenchyma tissue; (a8) Regulates the lignin content in plant roots.

6. A method for cultivating plant varieties, comprising any one of the following: Method A1: A method for breeding plant varieties having all or some of the traits shown in (b1)-(b5) below, comprising the step of increasing the expression level and / or activity of the protein of claim 1 in the recipient plant; (b1) The root thickens; (b2) The root volume increases; (b3) Enhanced drought resistance; (b4) Increased diameter of the root stele and thickening of the cortex or aerenchyma; (b5) Thickening of cell walls in root sclerenchyma; (b6) Increased lignin content in roots; Method A2: A method for breeding plant varieties having all or some of the traits shown in (c1)-(c5) below, comprising the step of reducing the expression level and / or activity of the protein of claim 1 in the recipient plant; (c1) The root becomes thinner after thickening; (c2) The root volume decreases; (c3) Reduced drought resistance; (c4) The diameter of the root stele is reduced, and the cortex or aerenchyma is thinned; (c5) The cell walls of the root sclerenchyma tissue become thinner; (c6) The lignin content in the root system is reduced.

7. A method for cultivating transgenic plants, comprising any one of the following: Method B1: A method for cultivating a transgenic plant having all or some of the traits shown in (b1)-(b7) below, comprising the steps of: introducing the nucleic acid molecule of claim 2 or 3 into a recipient plant to obtain a transgenic plant; wherein the transgenic plant has all or some of the traits shown in (b1)-(b7) below compared with the recipient plant; (b1) The root thickens; (b2) The root volume increases; (b3) Enhanced drought resistance; (b4) Increased diameter of the root stele and thickening of the cortex or aerenchyma; (b5) Thickening of cell walls in root sclerenchyma; (b6) Increased lignin content in roots; Method B2: A method for cultivating a transgenic plant having all or some of the traits shown in (c1)-(c7) below, comprising the following steps: inhibiting the expression of a nucleic acid molecule in a recipient plant capable of expressing the protein of claim 1 to obtain a transgenic plant; the transgenic plant having all or some of the traits shown in (c1)-(c7) below compared to the recipient plant; (c1) The root becomes thinner after thickening; (c2) The root volume decreases; (c3) Reduced drought resistance; (c4) The diameter of the root stele is reduced, and the cortex or aerenchyma is thinned; (c5) The cell walls of the root sclerenchyma tissue become thinner; (c6) The lignin content in the root system is reduced.

8. The application according to claim 5 or the method according to claim 6 or 7, characterized in that: The root thickness is the average root thickness of the thickest root at the base.

9. The method according to claim 7 or 8, characterized in that: The nucleic acid molecules were introduced into the recipient plant in the form of a recombinant vector.

10. The application or method according to any one of claims 5-9, characterized in that: The plant is a monocotyledonous plant; further, the monocotyledonous plant is a grass; and even further, the grass is rice.

Images