A recombinant protein of norovirus P particle chimeric netB protein and a preparation method and application thereof

Abstract

The application discloses a recombinant protein of norovirus P particle chimeric NetB protein and a preparation method and application thereof. The application uses a NoV P particle protein as an immune carrier, integrates a Clostridium perfringens NetB protein antigen into an epitope ring of a norovirus P domain, and obtains the recombinant protein of the norovirus P chimeric NetB protein, which can be self-assembled into a 24-mer VLP particle with better immunogenicity in vitro. Therefore, the norovirus P particle chimeric NetB protein can better present the NetB protein, enhance the antigenicity and immunogenicity of the NetB protein, and the protein can be used as a candidate antigen to prepare a Clostridium perfringens vaccine for preventing and treating chicken necrotic enteritis, thereby providing a new method for preventing and treating the chicken necrotic enteritis.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a recombinant protein of norovirus P particle chimeric NetB protein, its preparation method, and its application. Background Technology

[0002] Necrotic enteritis (NE) is a common disease in broiler chicken farming, primarily caused by Clostridium perfringens (Cp), and characterized by hemorrhagic necrosis and fibrosis of the intestinal epithelial mucosa. Following the ban on antibiotics in feed in my country, the incidence of NE in chickens has increased significantly, leading to substantial economic losses in the poultry industry. Studies have shown that the absence of α-toxin can still cause NE, and further research has identified NetB toxin. After studying NetB toxin, most scholars believe that Cp carrying NetB toxin is the main pathogen of avian NE. Further research revealed that constructing recombinant NetB toxin (rNetB) as a vaccine to control NE could protect poultry against mild NE disease after immunization. When poultry were immunized with a combination of rNetB, bacteriocins, and free toxoids, significant protection against moderate and severe NE disease was observed. Recombinant toxin vaccines targeting Cp, aimed at controlling NE disease, have become a research hotspot after the ban on antibiotics. Patent CN119192395A also disclosed that by truncating CPA and NetB proteins and fusing the helper protease Fba in series with the three gene sequences through a linker, a recombinant protein was obtained. It was found that the NCF recombinant protein could induce SPF chickens to produce antibodies, and the subunit vaccine formulated with it could achieve 100% immune protection in SPF chickens.

[0003] However, research on vaccines targeting Cp, the main pathogen of NE, remains to be explored. Therefore, providing an optimized approach that can significantly improve the immunogenicity of NetB antigen is of great significance for offering a new method for the prevention and control of necrotizing enteritis in chickens. Summary of the Invention

[0004] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide a recombinant protein comprising a norovirus P domain and Clostridium perfringens NetB protein.

[0005] A second objective of this invention is to provide a polynucleotide sequence encoding the aforementioned recombinant protein.

[0006] A third objective of this invention is to provide a method for preparing the above-mentioned recombinant protein.

[0007] The fourth objective of this invention is to provide a recombinant expression vector, recombinant bacterial strain, vaccine, and pharmaceutical composition.

[0008] A fifth object of the present invention is to provide the use of the above-mentioned recombinant protein, recombinant expression vector, recombinant strain, vaccine, and pharmaceutical composition in the preparation of products that inhibit Clostridium perfringens.

[0009] A sixth object of the present invention is to provide the use of the above-mentioned recombinant protein, recombinant expression vector, recombinant strain, vaccine, and pharmaceutical composition in the preparation of a medicament for the prevention and / or treatment of intestinal damage in chickens.

[0010] The above-mentioned objective of this invention is achieved through the following technical solution:

[0011] This invention provides a recombinant protein consisting of a norovirus P particle chimeric with Clostridium perfringens NetB protein. The recombinant protein comprises a norovirus P domain and Clostridium perfringens NetB protein. The amino acid sequence of the Clostridium perfringens NetB protein is shown in SEQ ID No. 2. The amino acid sequence of the norovirus P domain is shown in SEQ ID No. 4. The amino acid sequence of the recombinant protein is shown in SEQ ID No. 6.

[0012] Norovirus was first isolated from fecal samples during a gastroenteritis outbreak in Norwalk, Ohio in 1929. Norovirus has a simple, rough surface without an envelope; its diameter is approximately 27–32 nm. Its main structural protein, VP1, forms the viral capsid. This main structural protein is divided into S and P domains. The S domain participates in forming the polyhedral structure of the capsid, while the P domain protrudes from the capsid, forming the P dimer in the outer region. The P domain contains a receptor binding site, and the individual P domain can self-assemble in vitro into structurally stable and fully functional VLP particles. In vitro expression of P region proteins with different terminal modifications can form three complex forms: dimers, 12-mer P particles, and 24-mer P particles (see [link to relevant documentation]). Figure 1 Each P protein in the P particle dimer has three outwardly projecting loop structures at its terminal: loop 1, loop 2, and loop 3 (see...). Figure 2Norovirus P-granule protein is an excellent immunogenic vector. By inserting a foreign antigen sequence into the gene sequence of the P-granule circular structure, a chimeric P-granule protein carrying this antigen can be formed through prokaryotic expression, and this antigenic protein is displayed on the surface of the P-granule. P-granules produced by prokaryotic expression exhibit high immunogenicity and stability, remaining stable under low temperature, freezing, lyophilization, and ambient temperature conditions. Furthermore, because each P monomer has three surface rings, inserting a foreign antigen into these rings results in 24 to 72 antigen copies on the P-granule surface, which can significantly enhance the antigenicity and immunogenicity. Therefore, norovirus P-granules, as an antigen presentation vector platform, have broad prospects and perfectly meet the optimization requirements of NetB's genetically engineered vaccines.

[0013] This invention combines norovirus P particles with NetB protein antigen, specifically by integrating the NetB protein antigen into the loop 2 of the norovirus P domain. The resulting recombinant protein, a norovirus P-chimeric NetB protein, can self-assemble in vitro into 24-mer VLP particles with enhanced immunogenicity. Therefore, combining norovirus P particles with NetB protein allows for better presentation of the NetB protein, enhancing its antigenicity and immunogenicity.

[0014] Furthermore, the encoded recombinant protein is a loop 2 loop in which NetB is integrated into the NoV P domain.

[0015] The present invention provides a polynucleotide sequence encoding the above-mentioned recombinant protein.

[0016] Preferably, the nucleotide sequence encoding the recombinant protein is shown in SEQ ID No. 5.

[0017] This invention provides a method for preparing the above-mentioned recombinant protein, comprising the following steps:

[0018] S1. Construct a recombinant expression vector containing the above-mentioned polynucleotide sequence;

[0019] S2. The recombinant expression vector obtained in step S1 is transferred into the expression strain, positive clones are screened and then induced to express, thus obtaining the recombinant protein.

[0020] Furthermore, the recombinant expression vector in step S1 is pGEX4T-1-P-NetB.

[0021] Furthermore, the expression strain in step S2 is BL21(DE3) competent cells.

[0022] Furthermore, step S2, the recombinant protein, also includes a purification step.

[0023] The present invention also provides a recombinant expression vector containing the above-mentioned polynucleotide sequence.

[0024] The present invention also provides a recombinant bacterium containing the above-mentioned polynucleotide sequence or the above-mentioned recombinant expression vector.

[0025] The present invention also provides a vaccine, which is prepared from the above-mentioned recombinant protein as an antigen.

[0026] The present invention also provides a pharmaceutical composition comprising the above-described vaccine and a pharmaceutically acceptable carrier.

[0027] This invention utilizes Norovirus P particle protein as an immune carrier. NetB protein, which is embedded in norovirus P particles, can self-assemble into 24-mer VLP in vitro. Therefore, using norovirus P chimeric NetB protein as a candidate antigen for preparing subunit vaccines has good immunogenicity.

[0028] Therefore, the present invention also provides the use of the above-mentioned recombinant protein, the above-mentioned recombinant expression vector, the above-mentioned recombinant bacteria, the above-mentioned vaccine or the above-mentioned pharmaceutical composition in the preparation of articles inhibiting Clostridium perfringens.

[0029] The present invention also provides the use of the above-mentioned recombinant protein, the above-mentioned recombinant expression vector, the above-mentioned recombinant strain, the above-mentioned vaccine or the above-mentioned pharmaceutical composition in the preparation of a medicament for preventing and / or treating damage to the chicken intestine.

[0030] Furthermore, the chicken intestinal injury is necrotizing enteritis.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] This invention provides a recombinant protein of norovirus P particles chimeric with NetB protein, its preparation method, and its applications. This invention utilizes Norovirus P particle protein as an immunogenic carrier to integrate Clostridium perfringens NetB protein antigen into the epitope loop of the norovirus P domain. The resulting recombinant protein of norovirus P chimeric with NetB protein can self-assemble in vitro into 24-mer VLP particles with better immunogenicity, allowing for sufficient presentation of the NetB protein. Therefore, chimeric norovirus P particles with NetB protein can better present the NetB protein, enhancing its antigenicity and immunogenicity. This protein can be used as a candidate antigen to prepare Clostridium perfringens vaccines for the prevention and control of necrotizing enterocolitis in chickens, providing a new method for the prevention and control of necrotizing enterocolitis in chickens. Attached Figure Description

[0033] Figure 1 For norovirus VP1 and P domain, the isolated P domain forms P particles.

[0034] Figure 2 These are three epitope loops on the P particles and P dimers of norovirus.

[0035] Figure 3 This is a map of the recombinant plasmid pGEX4T-1-P-NetB.

[0036] Figure 4 This is a predicted spatial structure diagram of the recombinant protein P-NetB. Note: The left image shows the P-granule protein, and the right image shows the P-NetB protein.

[0037] Figure 5 This is a PCR identification result of the recombinant plasmid pGEX4T-1-P-NetB in Example 1. Lane M: 2000 Ladder Marker; Lane 1: P-NetB amplified fragment.

[0038] Figure 6 The results of SDS-PAGE Coomassie Brilliant Blue staining of purified P-NetB protein in Example 2 are shown. Lane M: Protein marker; Lane 1: Sample transfer buffer; Lane 2: Washing buffer; Lane 3: First elution buffer; Lane 4: Second elution buffer.

[0039] Figure 7 This is a Western blot identification result of the purified P-NetB protein in Example 2.

[0040] Figure 8 This is an image of the 24-mer protein identified by electron microscopy of the P-NetB protein in Example 3. Detailed Implementation

[0041] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0042] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0043] The following examples are for illustrative purposes only and are not intended to limit the scope of protection of the present invention.

[0044] In the description of this invention, "room temperature" refers to 0–40°C, more preferably 20–30°C.

[0045] Example 1: Preparation of Recombinant Vector

[0046] 1) Gene identification and analysis of NetB protein:

[0047] The gene sequence of the NetB protein was obtained through GenBank. The sequence was optimized according to the codon preference of E. coli without changing the amino acid sequence, resulting in the NetB protein with the nucleotide sequence shown in SEQ ID No. 1 and the amino acid sequence shown in SEQ ID No. 2.

[0048] 2) Construction of pGEX4T-1-P-NetB recombinant plasmid:

[0049] The NoV P domain cDNA sequence was obtained from the NCBI gene database, and its structure is as follows: Figure 1 As shown, the separated P domains form P particles, and the three epitopes on the norovirus P particles and P dimers loop as follows: Figure 2 As shown. Without altering the amino acid sequence, the sequence was optimized according to the codon preference of *E. coli*, resulting in NoV P particles with nucleotide sequences as shown in SEQ ID No. 3 and amino acid sequences as shown in SEQ ID No. 4.

[0050] The optimized nucleotide sequence of the NetB protein was integrated into loop 2 of the NoV P domain (length: 1914 bp, GC%: 48%), and synthesized by BGI Genomics to obtain a polynucleotide encoding the recombinant protein (P-NetB recombinant protein, whose amino acid sequence is shown in SEQ ID NO. 6) of the chimeric Clostridium perfringens NetB protein of norovirus P particle (as shown in SEQ ID NO. 5). Then, the polynucleotide encoding the P-NetB recombinant protein was inserted into the pGEX4T-1 vector to construct the recombinant plasmid pGEX4T-1-P-NetB, the structure of which is shown in [image missing]. Figure 3 As shown.

[0051] Predicting the spatial structure of recombinant protein P-NetB using SWISS-MODEL, such as Figure 4 As shown, compared with the P particle group, the red protrusion below P-NetB is the loop 2 region, which indicates that the exogenous antigen will be displayed on the outermost surface of the particle, showing that the designed recombinant chimeric P particle surface can successfully display the NetB protein.

[0052] 3) Construction and identification of the recombinant expression vector pGEX4T-1-P-NetB:

[0053] 3.1) The P-NetB fragment and pGEX4T-1 plasmid (both containing BamHI and XhoI restriction sites) were double-digested, and the double digestion system is shown in Table 1.

[0054] Table 1 Double enzyme digestion system

[0055]

[0056] Five tubes of each of the above were prepared, totaling 100 μL, and the mixture was reacted in a water bath at 37°C for at least 4 hours.

[0057] 3.2) Purify the enzyme digestion products of P-NetB and pGEX4T-1:

[0058] (A) First, weigh a clean 1.5 mL centrifuge tube, then place the gel containing the enzyme digestion product into it to determine the weight of the gel. Assuming the gel density is 1 g / mL, the gel volume is calculated using the following formula: a 0.3 g gel sheet has a volume of 0.3 mL. Mix the gel with binding buffer (XP2) at a 1:1 volume ratio and incubate at 50-60°C until the gel is completely dissolved. Shake the mixture every 2-3 minutes.

[0059] (B) Place the DNA Mini Column in a 2 mL collection tube.

[0060] (C) Add the completely melted DNA agarose solution (no more than 700 μL) from step (A) to the DNAMiniColumn. Centrifuge at 10,000 × g for 1 min at room temperature. Discard the filtrate and reuse the collection tube. Repeat this step.

[0061] (D) Add 300 μL binding buffer (XP2), centrifuge at maximum speed (≥13,000 g) for 1 min at room temperature, discard the filtrate and reuse the collection tube, add 700 μL SPW washing buffer, centrifuge at maximum speed for 1 min at room temperature, discard the filtrate and reuse the collection tube.

[0062] (E) Centrifuge the HiBind DNAMini Column at maximum speed for 2 min until dry. Note: It is important to dry the HiBind DNAMini Column matrix before elution, as residual ethanol may interfere with the following steps.

[0063] (F) Transfer the HiBind DNA Mini Column to a clean 1.5 mL microcentrifuge tube. Add 15–30 μL of elution buffer or deionized water directly to the central membrane of the column. Note: The efficiency of DNA elution from the HiBind DNA Mini Column is pH-dependent. If using deionized water to elute DNA, ensure the pH is around 8.5.

[0064] (G) Let stand at room temperature for 2 min. Centrifuge at maximum speed for 1 min. Note: Approximately 70% of the bound DNA will be eluted in the first elution, while the remaining DNA will be eluted in the second elution, but at a lower concentration. Finally, store the DNA at -20°C and calculate the recovery concentration using an Epoch microplate spectrophotometer.

[0065] 3.3) The P-NetB fragment and the enzyme digestion product of pGEX4T-1 were ligated. The ligation system is shown in Table 2 below. After adding the reagents, the reaction system was placed in a gene amplification instrument at 16°C overnight (12-16 h).

[0066] Table 2 Connection System

[0067]

[0068] 3.4) Conversion of linker products:

[0069] Take 100 μL of DH5α competent cells at -80℃, thaw them on ice, add 10 μL of the ligation product from the previous step, mix well, and incubate on ice for 30 min. Incubate in a 42℃ water bath for 90 s, then place on ice for 2 min. Add 400 μL of LB liquid medium, incubate at 37℃ with shaking at 220 rpm for 45 min to restore plasmid resistance. Centrifuge at 4℃ and 4000 rpm for 5 min, discard 400 μL of supernatant, and spread the remaining bacterial culture onto ampicillin plates. Incubate at 37℃ for 30 min (plates upright). After complete absorption of the bacterial culture, invert the plates and incubate for about 12 h, until single colonies are visible to the naked eye.

[0070] 3.5) Identification of the bonding products:

[0071] Primers were designed based on the base sequence of the recombinant plasmid to amplify a length of 1914 bp.

[0072] Upstream primer: 5'-3'TGCAACGGCCGTTGCTCAAG (SEQ ID NO.7);

[0073] Downstream primer: 5'-3'TTAGCAACGGCCGTTGCATAATGC (SEQ ID NO.8).

[0074] Propagate positive single colonies with the correct fragment size, inoculate them into 5 mL of LB medium containing 100 μg / mL Amp+, and incubate at 37℃ with shaking at 200 rpm for 16-20 h, followed by plasmid extraction.

[0075] (A) Dispense 5 mL of bacterial culture into 5 centrifuge tubes and centrifuge at 10,000 × g for 1 min.

[0076] (B) Pour out the culture medium, add 250 μL of resuspension to each, and mix by pipetting.

[0077] (C) After adding 250 μL of lysis buffer, gently shake the tube for 2-3 minutes; avoid vigorous mixing during the process, as this will shear the chromosomal DNA and result in lower plasmid purity; and do not allow the lysis reaction to proceed for more than 5 minutes; store solution II should be sealed when not in use to avoid acidification by carbon dioxide in the air.

[0078] (D) Add 350 μL of neutralizing solution, immediately invert several times until a flocculent white precipitate forms, avoiding localized precipitation.

[0079] (E) Centrifuge at maximum speed (>13,000g) for 10 min.

[0080] (F) Insert the HiBind DNA Mini Column into a 2mL collection tube, carefully aspirate the supernatant obtained in step (E) into the bottle, avoiding aspirating particles and cell debris, and centrifuge at maximum speed for 1 min.

[0081] (G) Discard the filtrate, reuse the collection tube, add 500 μL of HBC Buffer, and centrifuge at maximum speed for 1 min.

[0082] (H) Discard the filtrate and reuse the collection tube, add 700 μL DNAWash Buffer, and centrifuge at the highest speed for 1 min.

[0083] (I) Discard the filtrate and centrifuge the empty HiBind DNA Mini Column at maximum speed for 2 min. It is important to dry the HiBind DNA Mini Column matrix before elution, as residual ethanol may interfere with subsequent operations.

[0084] (J) Place the HiBind DNA Mini Column into a 1.5 mL microcentrifuge tube.

[0085] (K) Add 30 μL of sterile deionized water to the center of the column membrane.

[0086] (L) Let stand at room temperature for 1 minute, then centrifuge at the highest speed for 1 minute. Approximately 70% of the bound DNA is eluted in the first elution, while the remaining DNA is eluted in the second elution, but at a lower concentration.

[0087] The recombinant plasmid pGEX4T-1-P-NetB was obtained.

[0088] 3.6) Remove BL21(DE3) competent cells from the cryogenic freezer, thaw them on ice, add plasmid pGEX4T-1-P-NetB (100 ng), mix thoroughly, incubate on ice for 30 min, react at 42℃ for 45 s, incubate on ice for 3 min, add 100 μL LB medium, incubate at 37℃ and 200 rpm for 60 min on a shaker, and evenly spread on Ampoules. + Incubate overnight at 37°C inverted position on agar plates. Colony PCR identification is performed the next day: single colonies are picked from the culture plate and inoculated onto fresh Amp culture medium. + On LB agar plates, prepare the PCR reaction system as shown in Table 3 below (primers are the same as above).

[0089] Table 3 PCR reaction system

[0090]

[0091] The PCR reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ heat denaturation for 10 s, 60℃ annealing for 10 s, and 72℃ extension for 80 s, for a total of 25 cycles; and a final extension at 72℃ for 10 min. After PCR, agarose gel electrophoresis was performed at 120V for 30 min, and the results were analyzed using a gel imaging system.

[0092] The PCR identification results of the recombinant expression vector pGEX4T-1-P-NetB are shown in the figure below. Figure 5 As shown, lane M represents the 2000-lane ladder marker, and lane 1 represents the P-NetB amplified fragment. PCR-positive plasmids were sent to BGI Genomics for sequencing. The sequencing results were compared with those of P-NetB, and the results were correct. The recombinant (expression) vector pGEX4T-1-P-NetB and the expression strain were successfully constructed.

[0093] Example 2: Preparation and purification of norovirus P particle chimeric NetB recombinant protein

[0094] I. Experimental Methods

[0095] 1) Induction and identification of recombinant proteins.

[0096] The positive expression strain from Example 1 was inoculated into 4 mL of LB medium containing 100 μg / mL Amp+ and cultured at 37°C with shaking at 200 rpm. When the OD600 was between 0.4 and 0.6, IPTG with a final concentration of 0.5 mM was added to the positive clone and empty bacterial culture tubes, respectively, and cultured at 16°C for 18 h. The other two tubes served as negative controls for the positive clone and empty bacterial culture, and the expression and solubility of the protein were detected.

[0097] The steps are as follows:

[0098] Sample preparation: Take 450 μL of the precipitate after centrifugation of culture medium, resuspend it in 300 μL of lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 5% glycerol, pH 8.0), and sonicate for 1 minute.

[0099] Whole bacterial sample: Take 100 μL of PBS, mix it with 50 μL of loading buffer (5×), heat at 100℃ for 10 min, and centrifuge at 12000 rpm for 5 min.

[0100] Supernatant and inclusion body samples: Take 200 μL of lysis buffer, centrifuge at 15000 rpm for 10 minutes, and collect the supernatant and precipitate separately. Mix 10 μL of loading buffer (6×) into 50 μL of supernatant to obtain the supernatant sample. Resuspend the precipitate in 10 μL of loading buffer (6×) and 50 μL of PBS to obtain the inclusion body sample. Heat at 100℃ for 10 minutes, then centrifuge at 15000 rpm for 5 minutes, ready for sample loading.

[0101] 2) Coomassie brilliant blue staining detection

[0102] According to BeyoGel of Beyotime Company TM The experiment was conducted using the SDS-PAGE precast gel (Tris-Gly, 4-20%, 12 wells), including precast gel preparation, sample well cleaning, and sample loading. Electrophoresis was then performed at 80V for 30 min and 120V for 60 min. The gel was then pried open, and the target gel was cut for later use. Gel staining was performed according to the instructions of the Beyotime Coomassie Brilliant Blue staining kit (P0017A), including gel staining, incubation at room temperature for 1 h, destaining overnight, and gel imaging. The results showed successful induction of expression.

[0103] 3) Purification of recombinant proteins

[0104] The recombinant expression bacteria were amplified in large quantities at 10,000 rpm for 10 min. The bacterial cells were collected, resuspended in 10 mL of binding buffer, and sonicated for 50 min. The supernatant was then collected at 10,000 rpm for 20 min, filtered through a 0.45 μm filter membrane, and then purified using PurKine. TM The GST-TagPurification Nickel Column kit is used to purify proteins. The specific purification steps are as follows:

[0105] (a) Column packing: Resuspend the medium and add an appropriate amount of medium to the chromatography column according to the amount of protein to be purified, and let it stand.

[0106] (b) Equilibration: Add 5-10 column volumes of equilibration buffer (140 mM NaCl; 2.7 mM KCl; 10 mM Na2HPO4; 1.8 mM KH2PO4; pH 7.4) to the column to equilibrate the chromatography column until the conductivity and pH of the effluent remain unchanged (consistent with the equilibration buffer).

[0107] (c) Sample loading: Add the prepared protein extract sample (prepared by mixing the protein extract with an equal volume of binding buffer) to the resin for incubation. To avoid clogging the chromatography column, the sample should be centrifuged or microfiltered (0.45 μm).

[0108] (d) Washing: After loading the sample, wash the chromatography column with 5-10 column volumes of equilibration buffer and collect the eluent.

[0109] (e) Elution: Elute with elution buffer (50 mM Tris-HCl pH 8.0, 10 mM reduced glutathione. The glutathione concentration needs to be adjusted appropriately according to the binding affinity of the target protein. Glutathione is easily oxidized and should be prepared fresh before use), collect the eluent, and store at -80°C.

[0110] (f) Detection: Components containing the target protein were detected and identified by Coomassie brilliant blue staining and Western blotting.

[0111] 4) Recombinant protein Western blotting analysis

[0112] (a) Electrophoresis: The expressed target protein was used as a sample for SDS-PAGE electrophoresis. Before the end of electrophoresis, one appropriately sized PVDF membrane and four sheets of filter paper of the same size were cut. The PVDF membrane was first activated by soaking in methanol for 5 min, and then soaked in electrotransfer buffer for 10 min. The filter paper and sponge were briefly soaked in electrotransfer buffer.

[0113] (b) Transfer: After electrophoresis, cut the desired gel portion and soak it in electrotransfer buffer for 10 minutes. Place the gel in the following order: negative electrode plate, sponge, two layers of filter paper, membrane, separating gel, two layers of filter paper, sponge, and positive electrode plate. During placement, use a glass rod to remove any air bubbles that may exist between the filter paper, gel, and membrane; otherwise, air bubble marks will be visible on the membrane during development. Place the transfer plate into the electrotransfer tank, add electrotransfer buffer to the top edge of the membrane, maintain a constant voltage of 80V, and electrotransfer for 60 minutes.

[0114] (c) Washing the membrane: After the transfer, the PVDF membrane is washed three times with TBST or PBST buffer at 37°C for 5 minutes each time;

[0115] (d) Blocking: Immerse the washed membrane in 5% skim milk blocking solution and shake at 80 rpm for 1 hour at room temperature or overnight at 4°C; Washing: Wash the membrane 3 times with TBST or PBST buffer at 37°C for 5 minutes each time;

[0116] (e) Primary antibody incubation: The HIS monoclonal antibody was diluted with TBST at a ratio of 1:5000 and incubated with PVDF membrane at 37°C for 1 hour or at 4°C overnight.

[0117] (f) Washing: Wash the membrane three times with TBST or PBST buffer at 37°C for 5 min each time;

[0118] (g) Secondary antibody incubation: Dilute the goat anti-mouse IgG polyclonal antibody with TBST at a ratio of 1:10000, immerse the PVDF membrane in it, and incubate at room temperature for 1 hour;

[0119] (h) Washing: Wash the membrane three times with TBST or PBST buffer at 37°C for 5 min each time;

[0120] (i) Color development: Use ECL color development solution for 2-3 min, then terminate the reaction with TBST, and observe the specific bands using a chemiluminescence imaging system.

[0121] like Figure 6 The image shows the Coomassie Brilliant Blue staining results of the purified P-NetB recombinant protein. Lane M: Protein marker; Lane 1: Sample transfer buffer; Lane 2: Washing buffer; Lane 3: First elution buffer; Lane 4: Second elution buffer. The bands pointed to by the arrows in the figure correspond to the P-NetB recombinant protein, and the detection results confirm that the P-NetB recombinant protein was indeed obtained.

[0122] like Figure 7 The image shows the Western blot results of purified P-NetB, where lane M is the protein marker and lane 1 is for loading purified P-NetB recombinant protein.

[0123] Example 3: Observation of the formation of P-NetB multimer protein using transmission electron microscopy

[0124] Take the purified P-NetB protein from step 4) of Example 2, dilute it to a protein concentration of 1 mg / mL, take 10 μL of the diluted protein sample, add it to a copper grid for precipitation for 1 min, and absorb the floating liquid with filter paper. Add 10 μL of uranium acetate to a copper grid for precipitation for 1 min, absorb the floating liquid with filter paper, and dry at room temperature for several minutes. Perform electron microscopy imaging under 80-120 kV conditions to observe the morphology of protein particles, and photograph and save the transmission electron microscopy imaging results.

[0125] like Figure 8As shown in the figure, the P-NetB protein successfully self-assembled in vitro into a 24-mer VLP with a diameter of approximately 20 nm.

Claims

1. A recombinant protein, characterized in that, The recombinant protein comprises a norovirus P domain and Clostridium perfringens NetB protein; the amino acid sequence of the Clostridium perfringens NetB protein is shown in SEQ ID No. 2; the amino acid sequence of the norovirus P domain is shown in SEQ ID No. 4; and the amino acid sequence of the recombinant protein is shown in SEQ ID No.

6.

2. A polynucleotide sequence encoding the recombinant protein of claim 1.

3. The method for preparing the recombinant protein according to claim 1, characterized in that, Includes the following steps: S1. Construct a recombinant expression vector containing the polynucleotide sequence described in claim 2; S2. The recombinant expression vector obtained in step S1 is transferred into the expression strain, positive clones are screened and then induced to express, thus obtaining the recombinant protein.

4. A recombinant expression vector, characterized in that, The recombinant expression vector contains the polynucleotide sequence of claim 2.

5. A recombinant bacterium, characterized in that, The recombinant bacteria contain the polynucleotide sequence of claim 2 or the recombinant expression vector of claim 4.

6. A vaccine, characterized in that, The vaccine is prepared using the recombinant protein of claim 1 as an antigen.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the vaccine of claim 6 and a pharmaceutically acceptable carrier.

8. The use of the recombinant protein of claim 1, the recombinant expression vector of claim 4, the recombinant bacteria of claim 5, the vaccine of claim 6, or the pharmaceutical composition of claim 7 in the preparation of articles inhibiting Clostridium perfringens.

9. The use of the recombinant protein of claim 1, the recombinant expression vector of claim 4, the recombinant bacteria of claim 5, the vaccine of claim 6, or the pharmaceutical composition of claim 7 in the preparation of a medicament for the prevention and / or treatment of intestinal damage in chickens.

10. The application according to claim 9, characterized in that, The intestinal injury in the chicken was necrotizing enteritis.

Images