Acidophilic bacterium R9XR-4 and application thereof

Abstract

The application belongs to the technical field of microorganisms, and discloses an acidophilic bacterium R9XR-4 and application thereof. The bacterium is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO:M 20261069. The application provides a microbial inoculant containing the bacterium. Experiments show that the bacterium can significantly activate the expression of a rice reporter gene PR1pro::nLuc and induce the root system active oxygen burst of rice, and has good plant immune activation characteristics. In a pot experiment, the bacterium can reduce the disease index of cabbage gray mold and root rot and reduce the GFP fluorescence area caused by TuMV virus of tobacco. Field experiments further prove that the bacterium can reduce the incidence and disease index of lettuce sclerotial disease. The R9XR-4 strain provided by the application can be used for disease control of cruciferous vegetables, solanaceous vegetables and chrysanthemum vegetables and other crops, reduces the use of chemical pesticides, and has good green agricultural application prospects.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology, specifically relating to an acid-eating bacterium (Acidovorax sp.) R9XR-4 and its applications. Background Technology

[0002] Plant diseases are one of the major limiting factors in global agricultural production. They can damage crop photosynthetic tissues, vascular systems, or reproductive organs, leading to stunted growth, reduced fruit set, and in severe cases, yield losses of 30%-100%, resulting in hundreds of billions of dollars in economic losses annually (Oerke 2006, Savary et al 2019). While traditional chemical pesticides have some effectiveness, long-term use can lead to a series of problems such as pathogen resistance, environmental pollution, and pesticide residues. Therefore, developing safe and efficient biological control strategies has become an urgent need to ensure sustainable agricultural production.

[0003] In recent years, the use of beneficial microorganisms such as Bacillus spp., Pseudomonas spp., and Burkholderia spp. for biocontrol has attracted widespread attention due to their environmental friendliness and low likelihood of resistance development. Existing research confirms that these rhizosphere bacteria can directly antagonize pathogens by producing antimicrobial active substances or indirectly enhance plant disease resistance by activating endogenous immune pathways, thereby achieving effective control of various soil-borne and foliar diseases, as well as various foliar, soil-borne fungal, and bacterial diseases. However, the resource exploration of these biocontrol microorganisms still mainly focuses on a few known genera and species such as Bacillus and Pseudomonas, and different genera and species differ significantly in their immune mechanisms and applicable diseases.

[0004] The genus *Acidovorax* belongs to the class Beta-Proteobacteria and the family Comamonadaceae. It is a highly ecologically differentiated bacterial group. This genus includes a variety of plant pathogens that seriously harm agricultural crops, as well as non-pathogenic environmental microorganisms from soil, water, and clinical samples. For example, *Acidovorax citrulli* (Schaad et al., 1978; Latin and Hopkins, 1995) is the pathogen of bacterial fruit blotch (BBF) in cucurbitaceous crops, causing devastating damage to watermelons, melons, and other crops; *Acidovorax valerianellae* (Gardan et al., 2003; Manceau et al., 2018) is the pathogen of bacterial black spot in lettuce (Valerianella locusta), causing significant yield losses in major European producing areas; *Acidovorax avenae* (Willems et al., 1992) can cause bacterial brown streak in rice, red streak in sugarcane, and leaf blight in maize; *Acidovorax konjaci* (Willems et al., 1992; Hayashi, 1991) is a pathogen of konjac (*Amorphophallus*). Acidovorax konjac is the pathogen of bacterial leaf blight; Acidovorax cattleyae (Willems et al., 1992; Janse, 2018) can cause bacterial brown spot in orchids (Cattleya spp.); Acidovorax anthurii (Gardan et al., 2000; Hseu et al., 2015) is the pathogen of bacterial leaf spot in anthurium (Anthurium spp.); Acidovorax oryzae (Schaad et al., 2009), as a new species separated from A. avenae, is also one of the important pathogens of bacterial brown streak in rice.

[0005] However, *Acidovorax facilis*, the type species of this genus, was initially isolated from the soil environment by Willems et al. (1990) (Schatz and Bovell, 1952). It is not a plant pathogen, and its ecological function differs fundamentally from that of the aforementioned pathogens. Phylogenetic studies have shown that plant pathogens and non-pathogenic environmental species within the *Acidovorax* genus cluster in different branches on the 16S rRNA gene sequence, reflecting significant differentiation in their ecological niches and adaptations (Willems et al., 1992; Wen et al., 1999). Currently, there are no reports indicating that *A. facilis* has the function of inducing plant immune responses or controlling plant diseases.

[0006] Given the significant differences in pathogenicity, host range, ecological niche and phylogeny among different species within the genus *Acidovorax*, those skilled in the art cannot reasonably predict whether a specific strain of *A. facilis* possesses the ability to induce plant immunity or disease control based on the known functions of other strains in the same genus (including the aforementioned pathogens or strains known to have biocontrol functions). Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention provides an acid-loving bacterium (Acidovorax sp.) R9XR-4 and its applications, aiming to expand the application of the Acidovorax genus in the field of plant biocontrol, obtain a broad-spectrum biocontrol strain that has control effects against fungi, viruses and clubroot fungi, and is applicable to a variety of crops such as cruciferous, solanaceous and asteraceous plants, and verify its stable disease control effect and application potential through field trials.

[0008] To solve the above-mentioned technical problems, the present invention provides an acid-eating bacterium (Acidovorax sp.), namely, Acidovorax sp. R9XR-4, which is deposited at the China Center for Type Culture Collection, with accession number CCTCCNO: M 20261069.

[0009] Furthermore, the 16S rRNA gene sequence of the acidophilic bacteria R9XR-4 is shown in SEQ ID NO: 1.

[0010] The present invention also provides a microbial inoculant comprising one or more of the above-mentioned live cells of acidophilic bacteria R9XR-4, fermentation broth or fermentation supernatant, and an agriculturally acceptable carrier.

[0011] Furthermore, the agriculturally acceptable carrier is one or more of a liquid carrier or a solid carrier; the liquid carrier is selected from water and nutrient solution; the solid carrier is selected from diatomaceous earth, starch, wheat bran, talc, and peat moss.

[0012] Another object of the present invention is to provide the application of the above-mentioned acid-producing bacteria R9XR-4 or the above-mentioned microbial agents in inducing plant immune responses.

[0013] The present invention also provides the application of the above-mentioned acid-eating bacteria R9XR-4 or the above-mentioned microbial agents in the prevention and control of plant diseases.

[0014] Furthermore, the plants include one or more of the following: cruciferous vegetables, solanaceous crops, asteraceous vegetables, or grasses.

[0015] Furthermore, the cruciferous vegetable is Chinese cabbage; the solanaceous crop is tobacco; the asteraceous vegetable is lettuce; and the gramineous crop is rice.

[0016] Furthermore, the plant disease includes one or more of fungi, viruses, and clubroot fungi, wherein the gray mold is *Botrytis cinerea*; the fungal disease is *Sclerotinia sclerotiorum*; and the virus is turnip mosaic virus (TuMV).

[0017] The present invention also provides the application of the above-mentioned acid-eating bacteria R9XR-4 or the above-mentioned microbial agents in the preparation of biopesticides.

[0018] The present invention also provides a method for preventing and controlling crop diseases, which involves applying the above-mentioned acid-producing bacteria R9XR-4 or the above-mentioned microbial agents to the crop roots or above-ground parts of the plant to induce an immune response in the crop and reduce diseases caused by fungi, viruses or clubroot bacteria.

[0019] Compared with the prior art, the present invention achieves the following beneficial effects:

[0020] This invention expands the application of the *Acidobacterium* genus in plant biocontrol, providing a novel biocontrol strain with antifungal, antiviral, anticlinal, and multi-crop adaptability characteristics. Simultaneously, this strain activates endogenous immune pathways in plants, enhancing the overall resistance of crops to soil-borne fungal diseases (gray mold, clubroot, sclerotinia) and plant viral diseases (TuMV), reducing the use of chemical pesticides, lowering the risk of pathogen resistance, pesticide residues, and environmental pollution, and providing new microbial resources and technical solutions for green and sustainable disease control in agriculture. Attached Figure Description

[0021] Figure 1 Colony morphology of acid-eating bacteria R9XR-4.

[0022] Figure 2Phylogenetic tree of acidophilic bacteria strain R9XR-4. Phylogenetic tree of 16S rDNA sequences of acidophilic bacteria strain R9XR-4 and similar strains.

[0023] Figure 3 Expression of reporter genes and ROS outbreak in rice roots after treatment with *Acidic bacteria R9XR-4*. A: Comparison of *Acidic bacteria R9XR-4*-treated root *PR1pro::nLuc* with control; B: ROS outbreak in rice roots treated with *Acidic bacteria R9XR-4*. Significance analysis was performed using Student's t-test. (*, 0.01 ≤ P < 0.05; **, 0.001 ≤ P < 0.01; ***, P < 0.001)

[0024] Figure 4 Treatment with the acid-producing bacteria R9XR-4 helped Chinese cabbage resist infection by gray mold and clubroot. A: Phenotypic images of Chinese cabbage treated with R9XR-4 and the control after inoculation with gray mold; B: Disease grade and disease index of Chinese cabbage treated with R9XR-4 and the control after inoculation with gray mold; C: Phenotypic images of Chinese cabbage treated with R9XR-4 and the control after inoculation with clubroot; D: Disease grade and disease index of Chinese cabbage treated with R9XR-4 and the control after inoculation with clubroot. Significance analysis was performed using Fisher's Exact test. (*, 0.01 ≤ P < 0.05; **, 0.001 ≤ P < 0.01; ***, P < 0.001)

[0025] Figure 5 Treatment with acidophilic bacteria R9XR-4 helped tobacco resist TuMV infection. A: Phenotypic images of tobacco treated with acidophilic bacteria R9XR-4 and controls after TuMV inoculation; B: GFP fluorescence area of ​​tobacco treated with acidophilic bacteria R9XR-4 and controls after TuMV inoculation. Significance analysis was performed using Student's t-test. (*, 0.01 ≤ P < 0.05; **, 0.001 ≤ P < 0.01; ***, P < 0.001)

[0026] Figure 6 Sclerotinia sclerotinia disease resistance in field lettuce treated with R9XR-4. A: Symptoms of Sclerotinia sclerotinia disease in field lettuce and phenotypic images of lettuce treated with R9XR-4 and the control; B: Incidence of Sclerotinia sclerotinia disease in lettuce treated with R9XR-4 and the control; C: Disease index of Sclerotinia sclerotinia disease in lettuce treated with R9XR-4 and the control. Significance analysis was performed using Student's t-test. (*, 0.01 ≤ P < 0.05; **, 0.001 ≤ P < 0.01; ***, P < 0.001)

[0027] Information on the preservation of biological materials

[0028] The acid-eating bacterium R9XR-4, classified as Acidovorax sp. R9XR-4, was deposited at Wuhan University, Wuhan, China on May 25, 2026. The depository address is Wuhan University, Wuhan, China, and the depository institution is the China Center for Type Culture Collection (CCTCC). The accession number is CCTCC NO: M 20261069. Detailed Implementation

[0029] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0031] Materials and methods:

[0032] Plant varieties and strains

[0033] Rice: Nipponbare; Cabbage: Shanghai Bok Choy; Tobacco: Benedictine Tobacco; Lettuce: Han Lettuce No. 2.

[0034] R2A liquid medium: Add 3.2g of R2A dry powder to a final volume of 1L with distilled water. For solid medium, add 18g of agar. Sterilize at 121°C for 30 minutes before use.

[0035] The sequence information involved in this invention is as follows:

[0036] Results of 16S rRNA gene sequencing of acidophilic bacteria R9XR-4:

[0037]

[0038] Example 1: Isolation and Identification of Acidic Bacterium R9XR-4

[0039] First, root samples from 4-week-old *Nipponia spp.* plants were placed in a 2 mL centrifuge tube containing 1 mL PBS buffer and a sterile steel ball. The samples were then homogenized using a homogenizer. Bacteria were isolated using the dilution plating method, using 10... -2 and 10 -3 Two dilution gradients were used for plating R2A. The cells of the isolated strain were placed in a mixture of 0.5 mL of 40% glycerol and 0.5 mL of R2A liquid medium and then stored at -80°C.

[0040] The identification of the isolated strains was performed using primers 27F and 1492R to amplify the bacterial 16S rRNA gene for sequencing to determine the genus-level classification of the bacteria. First, the bacterial culture to be tested was cultured in 10 mL centrifuge tubes for 12 h with shaking (shaking conditions: 180 r / min, 28℃) using 2 mL of R2A liquid medium. Then, 6 μL of the bacterial culture was added to 10 μL of Buffer I (25 mM NaOH, 0.2 mM EDTA, pH 12), and lysed at 95℃ for 30 min. After cooling, 10 μL of Buffer II (40 mM Tris-HCl, pH 7.5) was added. PCR was then performed to amplify the target gene, and the quality and size of the PCR products were observed by agarose gel electrophoresis before sequencing. PCR reaction system: 0.5 μL Pfu DNA Polymerase (5 U / μL), 10× Pfu Buffer (with Mg... 2+ 5 μL of the sample, 0.5 μL each of the forward primer 27F and the reverse primer 1492R, 1.5 μL of DNA template, 2 μL of dNTPs, and 15 μL of ddH2O. PCR amplification program: 95℃ pre-denaturation for 5 min, 94℃ denaturation for 30 s, 55℃ annealing for 20 s, 72℃ extension for 20 s, 30 cycles, final extension at 72℃ for 3 min, and incubation at 16℃ for 5 min. 27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT. A phylogenetic tree was constructed using the neighbor-joining method on MEGA with the bacterial 16S sequence and similar sequences.

[0041] Acidovorax strain R9XR-4 (M 20261069) was isolated from the root samples of Nipponbare bacteria, and its 16S rRNA was identified as Acidovorax (SEQ ID NO.1). Phylogenetic tree construction of the 16S rRNA sequence of Acidovorax R9XR-4 with sequences of similar bacteria revealed that strain R9XR-4 clustered with three strains of Acidovora facilis (…). Figure 2 Therefore, the acid-eating bacterium R9XR-4 was identified as Acidovorax sp.

[0042] Example 2: Screening for microorganisms that induce plant immune responses using rice bioluminescence and root ROS burst.

[0043] First, the PR1pro::nLuc reporter gene rice, which had been cultured in tissue culture flasks for 10 days, was removed, its roots were washed, and the roots were cut into 5 mm segments and placed into 96-well plates. 50 μL of R9XR-4 bacterial suspension (OD200) was added to each well of the 96-well plate. 600 =0.2) and 10 mM MgCl2 buffer. After incubation in the dark for 24 h, add 50 μL nLuc reaction solution, and then detect the luminescence intensity using a microplate reader.

[0044] First, remove the rice plants that have been grown in tissue culture bottles for 10 days, wash the roots, and cut the roots into 5 mm segments. Place the segments into 96-well plates, adding 100 μL of sterile water to each well. After incubation overnight, remove the sterile water from the wells and add 100 μL of reaction buffer (40 μM L-012, 40 μg / mL POD, 50 μg / mL Chitin, R9XR-4 bacterial culture: OD). 600 =0.2), the luminescence intensity was detected by an ELISA reader, once every 90 seconds, and each test was repeated 70 times.

[0045] Acidophilus strain R9XR-4 (M 20261069) was isolated from rapeseed roots and identified as belonging to the genus Acidophilus by 16S rRNA. Treatment of rice root samples containing the reporter gene PR1pro::nLuc with Acidophilus R9XR-4 for 24 hours enhanced the expression of nLuc in the roots, indicating that Acidophilus R9XR-4 can activate the expression of the rice PR1 gene. Figure 3 A). Simultaneously, treatment of rice roots with acidophilic bacteria R9XR-4 can activate a surge in rice root ROS (…). Figure 3 (B) These findings indicate that the acidophilus R9XR-4 can activate the immune response in rice.

[0046] Example 3: Acidic bacteria R9XR-4 resists gray mold and clubroot in Chinese cabbage

[0047] To test the potential of acidophilic bacteria R9XR-4 in disease resistance, we conducted a pot inoculation experiment. In a greenhouse, Chinese cabbage was inoculated with acidophilic bacteria R9XR-4 and then sprayed with gray mold to test whether R9XR-4 could help Chinese cabbage resist gray mold infection. The experimental method is as follows: Four weeks after planting, the Chinese cabbage was inoculated with acidophilic bacteria R9XR-4 bacterial solution (OD... 600 =0.6), the control treatment used 10 mM MgCl2 buffer. One day later, the mycelial solution of Botrytis cinerea (OD) was used. 600 =1.5) Spray the inoculated cabbage leaves and culture in a moist environment. After 5 days, the disease incidence on the cabbage leaves is statistically analyzed. Disease index = 100 × Σ(number of diseased plants at each level × representative value at each level) / (total number of plants surveyed × highest level representative value).

[0048] Ten days after sowing Chinese cabbage, inoculate with acidophilic bacteria R9XR-4 bacterial suspension (OD). 600 =0.6), the control treatment used 10 mM MgCl2 buffer. One day later, inoculated with *Plasmodiophora* spores (1×10⁶). 7 (mL), and then inoculate with *Acidobacterium tumefaciens* R9XR-4 bacterial solution once a week for a total of 4 inoculations. Samples were collected 30 days after inoculation with *Plasmodiophora stylosa* spores to observe the disease incidence on the cabbage roots, and the disease index was statistically analyzed.

[0049] Compared to the control, cabbage inoculated with acidophilus R9XR-4 had fewer lesions. Figure 4 A) can significantly reduce the disease index of gray mold in Chinese cabbage by 34.3% ( Figure 4 B). We also tested the effect of acidophilic bacteria R9XR-4 in helping Chinese cabbage resist clubroot disease, and found that the swelling of the roots of Chinese cabbage inoculated with acidophilic bacteria R9XR-4 was reduced ( Figure 4 C), can significantly reduce the disease index of clubroot disease by 32.9% ( Figure 4 D). These findings demonstrate that the acid-producing bacteria R9XR-4 can help cabbage resist infection by pathogens.

[0050] Example 4: Acid-eating bacteria R9XR-4 resists turnip mosaic virus TuMV

[0051] To test the antiviral potential of acidophilic bacteria R9XR-4, we used tobacco and the infectious clone TuMV to test its antiviral ability. The experimental method was as follows: tobacco was inoculated with acidophilic bacteria R9XR-4 culture at 4 weeks gestation (OD200). 600 =0.6), the control treatment used 10 mM MgCl2 buffer. One day later, the Agrobacterium invasive clone TuMV (OD) was... 600=0.8, buffer solution: 10 mM MgCl2, 10 mM MES, 200 μM AS) was injected into tobacco leaves. Five days later, the leaves were inoculated again with *TuMV* R9XR-4 bacterial suspension. Twelve days after TuMV inoculation, GFP fluorescence in the tobacco was observed using a GFP fluorescence excitation lamp to assess the severity of the disease. It was found that treatment with *TuMV* R9XR-4 could alleviate TuMV-induced wilting in tobacco leaves. The fluorescence area in the Mock group (control group) and the *TuMV* R9XR-4 group was 7.63 cm². 2 and 3.20cm 2 Treatment with acidophilic bacteria R9XR-4 reduced the GFP fluorescence area by 58.1% ( Figure 5 These findings demonstrate that the acid-eating bacteria R9XR-4 has the potential to combat viral diseases.

[0052] Example 5: Field disease resistance test of acid-loving bacteria R9XR-4

[0053] To test whether the acidophilic bacteria R9XR-4 could help plants resist pathogen infection in the field, we planted lettuce in a greenhouse, sprayed it with R9XR-4, and then observed the disease incidence. The experimental method was as follows: Lettuce was transplanted into the greenhouse, and two weeks later, the lettuce was sprayed with R9XR-4 bacterial solution (OD2000). 600 =0.5), spray 200 mL per plot, once every two weeks, for a total of 4 sprays. After 100 days, the incidence and disease index of sclerotinia rot in each plot of lettuce are counted. Disease index = 100 × Σ(number of diseased plants at each level × representative value at each level) / (total number of plants surveyed × highest level representative value).

[0054] Lettuce in greenhouses was found to be infected with Sclerotinia sclerotiorum. Statistical analysis showed that the acid-producing bacterium R9XR-4 significantly reduced the incidence and disease index of Sclerotinia sclerotiorum in lettuce. Figure 6 This reduced the incidence rate by 23.7% and the disease index by 28.2%. Figure 6 (B and C). These indicate that acidophilic bacteria R9XR-4 can help lettuce resist infection by Sclerotinia sclerotiorum in the field.

Claims

1. A strain of acid-eating bacterium (Acidovorax sp.) R9XR-4, characterized in that, This strain is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20261069.

2. A microbial inoculant, characterized in that, It comprises one or more of the live cells, fermentation broth or fermentation supernatant of the acid-producing bacteria R9XR-4 as described in claim 1, and an agriculturally acceptable carrier.

3. The microbial agent according to claim 2, characterized in that, The agriculturally acceptable carrier is one or more of a liquid carrier or a solid carrier; the liquid carrier is selected from water and nutrient solution; the solid carrier is selected from diatomaceous earth, starch, wheat bran, talc, and peat moss.

4. The application of the acid-producing bacteria R9XR-4 according to claim 1 or the microbial agent according to claim 2 or 3 in inducing plant immune responses.

5. The application of the acid-producing bacteria R9XR-4 according to claim 1 or the microbial agent according to claim 2 or 3 in the prevention and control of plant diseases.

6. The application according to claim 5, characterized in that, The plants include one or more of the following: cruciferous vegetables, solanaceous crops, asteraceous vegetables, or grasses.

7. The application according to claim 6, characterized in that, The cruciferous vegetable is Chinese cabbage; the solanaceous crop is tobacco; the asteraceous vegetable is lettuce; and the gramineous crop is rice.

8. The application according to claim 5, characterized in that, The plant disease includes one or more of fungi, viruses, and clubroot fungi; the gray mold is Botrytis cinerea; the fungal disease is Sclerotinia sclerotiorum; and the virus is Turnip Mosaic Virus (TuMV).

9. The application of the acid-eating bacteria R9XR-4 according to claim 1 or the microbial agent according to claim 2 or 3 in the preparation of biopesticides.

10. A method for preventing and controlling crop diseases, characterized in that, Applying the acid-producing bacteria R9XR-4 of claim 1 or the microbial agent of claim 2 or 3 to the roots or above-ground parts of crops can induce an immune response in crops and reduce diseases caused by fungi, viruses or clubroots.

Images