Lactobacillus lentus AH123 producing bile salt hydrolase and application thereof

Abstract

The present application relates to the field of microbial technology, and particularly relates to a slow-growing lactobacillus AH123 producing bile salt hydrolase and application thereof. The slow-growing lactobacillus AH123 is preserved in China Center for Type Culture Collection on July 15, 2026, and the preservation number is CCTCC NO: M 20261573, and the classification name is Lentilactobacillus senioris AH123. The slow-growing lactobacillus AH123 provided by the present application can significantly improve the activity of intestinal bile salt hydrolase, reduce liver lipid accumulation, improve serum lipid metabolism and liver function related indexes, and can enhance the intestinal antioxidant defense capacity and repair high-fat induced bacterial community structure disorder. The slow-growing lactobacillus AH123 can be used as a green feed additive for relieving fish liver and intestinal injury induced by high-fat feed.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain of Lactobacillus slow-growing, AH123, that produces bile salt hydrolase and its applications. Background Technology

[0002] Yellow catfish ( Pelteobagrus fulvidraco With its superior meat quality and lack of intramuscular bones, the yellow catfish is a core freshwater intensive aquaculture species in my country, boasting significant economic value. Intensive aquaculture commonly employs high-fat feeds with fat levels of 10%–12% or even higher to enhance growth rates, shorten the aquaculture cycle, and reduce energy consumption from expensive protein sources to control costs. However, the yellow catfish is an omnivorous, predominantly carnivorous fish, naturally adapted to a high-protein, low-sugar, and low-fat diet, limiting its ability to break down and utilize high-fat feeds. Long-term feeding of high-fat feeds can easily lead to abnormal lipid deposition, inducing fatty liver syndrome, causing fatty degeneration and necrosis of hepatocytes, and liver fibrosis, impairing liver metabolism and detoxification functions. Simultaneously, it triggers oxidative stress and inflammatory responses, reducing the fish's immunity and resistance to pathogens, and in severe cases, can lead to large-scale mortality in the farmed population, resulting in significant economic losses.

[0003] While existing microbial regulation methods have shown initial potential in addressing lipid metabolism disorders induced by high-fat diets in fish, significant technical limitations remain. Firstly, the vast majority of reported probiotic strains are not derived from the gut microbiota of the target farmed fish, lacking natural host adaptability and homologous colonization advantages, making it difficult to guarantee their colonization ability and efficacy stability in the gut. Secondly, current research generally focuses on descriptive observations of epiphysiological indicators, lacking a systematic understanding of the underlying molecular mechanisms and targeted intervention strategies. This results in existing methods primarily providing broad-spectrum, passive regulation rather than precise, active signaling pathway remodeling. Therefore, developing a functional microbial agent with both homologous colonization advantages and a clear mechanism of action has become a crucial technical bottleneck that urgently needs to be overcome. Summary of the Invention

[0004] To develop a green microecological preparation that can actively reshape the lipid homeostasis of yellow catfish, this invention provides a strain of slow-growing lactobacillus AH123 that produces bile salt hydrolase and its application.

[0005] The present invention adopts the following technical solution: This invention provides a strain of slow-growing lactobacillus that produces bile salt hydrolase ( Lentilactobacillus senioris Lactobacillus chronicus AH123 was deposited at the China Center for Type Culture Collection (CCTCC) on July 8, 2026, with accession number CCTCC NO: M 20261573, and classified as follows: Lentilactobacillus senioris AH123.

[0006] This invention screens Lactobacillus proliferativeis AH123 from the intestines of healthy yellow catfish, which possesses both highly active bile salt hydrolase secretion capacity and excellent homologous colonization performance. Utilizing the bile salt hydrolase function of this strain in situ in the intestine, it targets and regulates the composition of the host's endogenous bile acid profile, thereby restoring the FXR-mediated bile acid-lipid metabolism signaling network. Ultimately, it achieves a systemic repair involving multiple levels of linkage from "intestinal flora-bile acid metabolism-liver lipid homeostasis," upgrading the traditional single-target intervention strategy to host signaling pathway remodeling mediated by the metabolic function of the screened probiotics. This provides a new pathway for the development of green microecological preparations in aquaculture.

[0007] This invention also provides the application of the aforementioned *Lactobacillus chronicus* AH123 in the preparation of a product that inhibits lipid metabolism disorders in fish. The product is a feed containing *Lactobacillus chronicus* AH123, with a content of 0.9 × 10⁻⁶ *Lactobacillus chronicus* AH123 per gram of feed. 8 CFU ~ 1.1 × 10 8 CFU.

[0008] Furthermore, the lipid metabolism disorder is caused by a high-fat diet.

[0009] Furthermore, the product inhibits lipid metabolism disorders in fish by improving the homeostasis of lipid metabolism and bile acid metabolism in the liver and intestines of fish, improving the antioxidant capacity of the intestines of fish, improving serum lipid metabolism and liver health indicators of fish, and improving the intestinal flora disorder induced by high-fat diets in fish.

[0010] Furthermore, the improvement of lipid metabolism and bile acid metabolism homeostasis in fish liver and intestines includes: reducing fat deposition in fish liver, reducing liver triglyceride and cholesterol levels, and increasing the activity of bile salt hydrolytic enzymes in fish intestines.

[0011] Furthermore, the improvement of the antioxidant capacity of the fish intestine is achieved by increasing the activity of superoxide dismutase, catalase, and reduced glutathione in the fish intestine, and reducing the malondialdehyde content.

[0012] Furthermore, the indicators for improving serum lipid metabolism and liver health in fish are: reducing the levels of low-density lipoprotein cholesterol, alanine aminotransferase (ALT), and aspartate aminotransferase (AST), and increasing the level of high-density lipoprotein cholesterol (HDL).

[0013] Furthermore, the improvement of high-fat diet-induced intestinal flora dysbiosis in fish includes: increasing intestinal flora β-diversity, increasing the presence of *Lactobacillus* spp. in the gut, and... Cetobacterium , Akkermansia or Romboutsia Relative abundance of beneficial bacteria genera.

[0014] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention provides L. senioris The AH123 strain can secrete highly active bile salt hydrolase, which specifically hydrolyzes and removes competitive FXR antagonists (such as taurine-bound bile acids like T-β-MCA) that accumulate excessively in the intestine due to a high-fat diet. By relieving the inhibition of the FXR signaling pathway by antagonistic molecules, it downregulates the bile acid reabsorption gene at the molecular level. asbt , ntcp ) and lipid synthesis genes ( srebp-1c , accα , scd ) expression, while upregulating fatty acid oxidation gene ( ppar α , cpt1 This enables the active remodeling of lipid homeostasis in the body, avoiding negative feedback inhibition caused by exogenous supplementation; L. senioris The AH123 strain was isolated from the intestines of healthy yellow catfish. As a native dominant bacterium, it possesses natural host adaptability and excellent homologous colonization resistance. Furthermore, through whole-genome safety target scanning (VFDB / CARD database) and toxicological confirmation, it has been shown to be non-pathogenic and without the risk of horizontal transfer of drug resistance genes. It also exhibits outstanding safety in heat processing and feed use, perfectly meeting the industrialization needs of low-cost and high-stability green aquatic feed additives.

[0015] This invention L. senioris The AH123 strain can significantly reverse the fatty liver phenotype induced by a high-fat diet: it can significantly reduce the levels of triglycerides and total cholesterol in the liver induced by a high-fat diet, and histopathological examination shows a significant reduction in the area of ​​lipid droplet accumulation in hepatocytes, effectively alleviating the body's lipotoxic load; secondly, in terms of serological indicators, L. senioris The AH123 strain significantly reduced LDL cholesterol, alanine aminotransferase (ALT), and aspartate aminotransferase (AST) levels, while increasing HDL cholesterol levels, thus improving liver health from the dual dimensions of lipid transport and liver function impairment; furthermore, L. senioris The AH123 strain achieved dominant colonization in the gut and significantly increased the activity of intestinal bile salt hydrolases. Targeted metabolomics further revealed that it selectively cleared potential FXR antagonists such as T-β-MCA, TDCA, and THDCA in the gut while retaining agonist levels, precisely reshaping bile acid homeostasis, thereby systematically alleviating hepato-gut damage caused by high-fat stress.

[0016] This invention L. senioris While regulating host metabolism, strain AH123 also exhibits significant gut microbiota remodeling and barrier protection functions: on the one hand, it effectively repairs the gut microbiota structure damage caused by long-term high-fat diet intake, and β-diversity based on principal coordinate analysis shows... L. seniorisAfter intervention with strain AH123, the gut microbiota community structure significantly approached that of the normal control group, and the genus abundance clustering heatmap confirmed that it directionally increased the abundance of Lactobacillus spp. ( Lentilactobacillus ), Cetobacterium , Akkermansia and Romboutsia The relative abundance of beneficial physiological flora reconstructed the stress homeostasis of the gut microbiota; on the other hand, at the level of intestinal barrier function, L. senioris The AH123 strain significantly upregulated tight junction protein genes ( zo1 , occludin ) and bile acid transport-related genes ( fabp6 , slc36a1 The expression of ) was reduced, while the expression of inflammatory factor genes () was downregulated. nfkb , tnfa At the transcriptional level, it enhances intestinal defense capabilities from both physical and immune barrier dimensions. Combined with its significant improvement in intestinal antioxidant capacity (reducing the oxidative stress marker malondialdehyde, increasing the activity of superoxide dismutase, catalase, and reduced glutathione), it achieves a comprehensive effect of alleviating high-fat stress in fish through multi-level synergistic relief from "microbial community structure-metabolic regulation-barrier immunity-antioxidation".

[0017] Information on the Preservation of Biological Materials AH123, referred to in this application as L. senioris AH123 was deposited on July 8, 2026, at the China Center for Type Culture Collection (CCTCC), accession number CCTCC NO: M 20261573. The address of the depository is Wuhan University, Wuhan, China, 430072, China. The classification name is... Lentilactobacillus senioris AH123. Attached Figure Description

[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0019] Figure 1 The BSH content in the intestines of yellow catfish in different treatment groups.

[0020] Figure 2 The figures show the triglyceride (TG) and total cholesterol (TC) content in the livers of yellow catfish in different treatment groups; in the figure, A represents the triglyceride (TG) content and B represents the total cholesterol (TC) content.

[0021] Figure 3Images of yellow catfish liver stained with Oil Red O and statistical results of relative staining area are shown in the figures. In the figures, A represents the Con group, B represents the HL group, C represents the LS group, and D represents the statistical results of relative staining area.

[0022] Figure 4 To detect gut microbiota using strain-specific primers via qPCR L. senioris Relative abundance of AH123.

[0023] Figure 5 To investigate the effects of different treatment groups on the relative expression levels of genes related to lipid and bile acid metabolism in the liver of yellow catfish.

[0024] Figure 6 The effects of different treatment groups on the expression of genes related to the intestinal FXR signaling axis, bile acid transport, and physical barriers in yellow catfish.

[0025] Figure 7 To compare the β-diversity of gut microbiota community structure in yellow catfish under different treatment groups based on principal coordinate analysis (PCoA).

[0026] Figure 8 Cluster heatmap showing the influence of different treatment groups on the relative abundance of gut microbiota genera in yellow catfish. Figure 9 To investigate the effects of different treatment groups on the content of specific FXR-stimulating and antagonistic bile acids in the intestine of yellow catfish. Detailed Implementation

[0027] The specific embodiments of the present invention are described in detail below, but it should be understood that the scope of protection of the present invention is not limited to the specific embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Unless otherwise specified, the experimental methods described in the embodiments of the present invention are conventional methods, and the materials and reagents used in the following embodiments are commercially available unless otherwise specified.

[0028] Example 1: Isolation and identification of strains.

[0029] 1. Strains Isolation Yellow catfish fry purchased from unpolluted aquaculture waters were anesthetized and their bodies were disinfected by wiping with 75% alcohol. The intact intestines were then harvested, and the contents were squeezed into sterile centrifuge tubes. Three times the volume of sterile PBS was added to the centrifuge tubes for dilution, and the mixture was vortexed for 1 minute and then ground for 2 minutes using a sterile disposable tissue homogenizer. PBS was then serially diluted (10⁻⁶ ppm). 1 10 2 and 10 3The liquid culture was then plated on MRS solid medium and bile salt-tolerant strain selection medium (MRS solid medium supplemented with 0.5% sodium tauride deoxycholate (w / v), 0.37% calcium chloride (w / v), and 0.2% sodium thioglycolate (w / v)). The plates were incubated at 32°C for one week, with colony growth observed every 24 hours. Plates with colony counts between 10 and 200 were selected. Single colonies of different morphologies were picked and numbered based on their phenotype (morphology, size, color, edge characteristics, and elevation). These were then inoculated into MRS liquid medium using the three-zone streak isolation method and anaerobically cultured at 32°C for 2 ± 1 days. The uniformity of colony morphology was observed. For plates with inconsistent colony morphology, single colonies were picked and streaked again until pure cultures with consistent morphological characteristics were obtained. Select the above-mentioned pure cultured single bacteria, inoculate them into MRS liquid medium, and incubate at 32℃ until the OD600 value of the bacterial solution reaches between 0.8 and 0.2, thus obtaining the purified strain.

[0030] The isolated strain formed small, milky-white colonies in the bile salt-tolerant strain selection medium, with no obvious odor and Gram-positive staining, indicating that it can utilize TCA (taurocholic acid).

[0031] 2. Strain identification The strain was identified and sequenced by Nanjing Qingke Biotechnology Co., Ltd., and the results showed that the strain was related to... Lentilactobacillus senioris strain 9897 (MW084825.1) showed the highest homology, therefore the strain was named... Lentilactobacillus senioris AH123, referred to in this invention as... L. senioris AH123 strain.

[0032] 3. Comparison of bile salt hydrolase gene sequences Will L. senioris The AH123 strain was sent to Shanghai Meiji Biotechnology Co., Ltd. for sequencing. Analysis revealed... L. senioris Strain AH123 carries the functional bile salt hydrolase (BSH) gene, with the following sequence: SEQ ID NO.1.

[0033] Example 2: L. senioris Application of strain AH123.

[0034] 1. Experimental Design The 500 yellow catfish used in this invention were purchased from Zhou's Aquaculture Farm in Huzhou, Zhejiang Province. All fish were temporarily housed in dechlorinated filtered water free of Cu pollution and fed commercial feed for 14 days to acclimatize. During this period, an oxygen pump system continuously aerated the static water to ensure water quality and fish health. After the acclimatization period, 270 yellow catfish of similar size (2.65±0.25 g) were randomly assigned to 12 blue plastic buckets (180 L) and divided into three treatment groups: a control group (Con) fed with control feed, a high-fat group (HL) fed with high-fat feed, and a high-fat group fed with 1×10⁻⁶ tbsp feed. 8 CFU / g L. senioris AH123 strain group (LS) was supplemented with 1×10 per gram of high-fat diet. 8 CFU L. senioris Solid bacteria strain AH123 were used to feed the fish for 9 weeks (average daily intake of 0.11 g / fish / day), with three biological replicates in each treatment group. During the experiment, yellow catfish were fed twice daily (9:00 AM and 2:00 PM) until they showed obvious signs of satiation. One hour after feeding, uneaten feed was collected by siphoning, dried, weighed, and the feed intake was calculated. One hour after the last feeding each day, 80% of the water was replaced to maintain water quality freshness and stability. A 12-hour light and 12-hour dark cycle was used during the experimental period to simulate the natural diurnal rhythm. In addition, key physicochemical indicators of the water were continuously monitored and maintained within appropriate ranges using a YSI ProQuatro multi-parameter water quality monitor (Xylem, USA). The actual measured values ​​were: pH 7.95±0.04, dissolved oxygen 7.32±0.30 mg / L, and temperature 25.82±1.00℃.

[0035] Twenty-four hours after the last feeding, six fish were randomly selected from each experimental group. After being anesthetized by immersion in 60 mg / L tricaine mesylate (MS-222), their body weight (±0.01 g) and body length (±0.1 cm) were measured. Blood was collected via the tail vein using a heparin sodium anticoagulant syringe. Whole blood samples were incubated on ice at 4°C for 30 min, then centrifuged at 2500 g at 4°C for 10 min. The separated serum was aliquoted and stored at −80°C for later use.

[0036] Twenty-four hours after the last feeding, an ice-based dissection was performed. The body cavity of each group of yellow catfish was opened along the midline of the abdomen, and the liver and intestinal tissues were aseptically removed. After precise weighing, the tissues were divided into two portions: one portion was immediately fixed in pre-cooled 4% paraformaldehyde phosphate buffer (0.1 M PBS, pH 7.4) for 24 hours for hematoxylin-eosin (H&E) staining pathological analysis; the other portion was homogenized with physiological saline at a ratio of 1:9 (w:v) for liver and intestinal tissues. The homogenate was homogenized in an ice bath at 10,000 r / min for 1 min, and then centrifuged at 3500 g for 10 min at 4℃. The supernatant of the liver and intestinal tissues was collected for subsequent analysis.

[0037] Table 1 Feed Formulation Fish meal 300 300 Fermented soybean meal 250 250 flour 180 180 gluten 80 80 corn oil 10 30 fish oil 10 30 Soy lecithin 20 20 Multi-dimensional premix 15 15 Multi-mineral premix 15 15 Lysine 10 10 Methionine 10 10 Sodium alginate 15 15 Carboxymethyl cellulose 59.5 19.5 <![CDATA[CaHPO4·2H2O]]> 20 20 betaine 5 5 antioxidants 0.5 0.5 total 1000 1000 Note: Fermented soybean meal was purchased from Haining Liuwang Feed Raw Material Co., Ltd. Multivitamin premix (mg / kg): α-Tocopherol, 80; Retinyl acetate, 40; Cholecalciferol, 0.1; Vitamin K, 15; Niacin, 165; Vitamin B2, 22; Vitamin B6, 40; Thiamine nitrate, 45; D-calcium pantothenate, 102; Folic acid, 10; Vitamin B12, 0.9; Fiber sugar, 450; Vitamin C, 150; Sodium menadione bisulfite, 15; Thiamine, 5; Choline chloride, 320; Para-aminobenzoic acid, 50. Multi-mineral premix (mg / kg): Na₂SiO₃, 0.4; CaCO₃, 544.9; NaH₂PO₄·H₂O, 200; KH₂PO₄, 200; MgSO₄·7H₂O, 10; MnSO₄·H₂O, 4; CuCl₂·2H₂O, 2; ZnSO₄·7H₂O, 12; FeSO₄·7H₂O, 12; NaCl, 12; KI, 0.1; CoCl₂·6H₂O, 0.1; Na₂MoO₄·2H₂O, 0.5; AlCl₃·6H₂O, 1; KF, 1. Antioxidants are 1% ethoxyquin (EQ), 12.5% ​​butylated hydroxytoluene (BHT), and the remainder is silica as a carrier.

[0038] 2. Intestinal BSH activity detection The enzyme-linked immunosorbent assay (ELISA) kit was purchased from Shanghai Xuanya Biotechnology Co., Ltd. (product number: BSH, XY-D6937). The BSH activity in the intestinal tissue supernatant was detected according to the instructions of the ELISA kit (BSH, product number XY-D6937).

[0039] The results show that ( Figure 1 The BSH content in the LS group was significantly higher than that in the HL group, and although there was no significant difference compared to the Con group, the content was still relatively increased, indicating that compared to ordinary feed and high-fat feed, L. seniorisThe AH123 strain can significantly enhance intestinal BSH activity.

[0040] 3. Intestinal antioxidant activity detection The following kits were used by Nanjing Jiancheng Biotechnology Research Institute (SOD kit No. A001-1-2, CAT kit No. A007-1-1, GSH kit No. A005-1-2, MDA kit No. A003-1-2, TP kit No. A045-4-2). The activities of catalase (CAT), reduced glutathione (GSH), superoxide dismutase (SOD), and malondialdehyde (MDA) in intestinal tissue supernatant were measured.

[0041] As shown in Table 1, compared with the Con group, the SOD and CAT activities and GSH and MDA contents in the intestines of yellow catfish in the HL group were significantly increased. P <0.05), while adding 1×10 8 CFU / g L. senioris The LS group of strain AH123 significantly alleviated the increase in SOD and CAT activity and GSH and MDA content caused by high-fat feeding, with SOD, CAT and GSH levels even significantly lower than the control group. P <0.05).

[0042] Table 1. Antioxidant intestinal markers in different treatment groups SOD (U / mg) <![CDATA[84.09 ± 0.87 b ]]> <![CDATA[95.98 ± 1.88 a ]]> <![CDATA[73.76 ± 1.08 c ]]> CAT (U / mg) <![CDATA[95.62 ± 2.19 b ]]> <![CDATA[121.87 ± 4.57 a ]]> <![CDATA[50.75 ± 3.49 c ]]> MDA (nmol / mg) <![CDATA[2.53 ± 0.28 b ]]> <![CDATA[3.43 ± 0.18 a ]]> <![CDATA[2.56 ± 0.46 b ]]> GSH (U / mg) <![CDATA[4.61 ± 0.39 b ]]> <![CDATA[5.39 ± 0.12 a ]]> <![CDATA[3.35 ± 0.60 c ]]> 4. Liver antioxidant test The activities of catalase (CAT), reduced glutathione (GSH), superoxide dismutase (SOD) and malondialdehyde (MDA) in liver tissue supernatant were measured. The same kit was used to detect intestinal antioxidant activity.

[0043] As shown in Table 2, compared with the control group (Con), the activities of SOD and CAT, as well as the contents of GSH and MDA in the liver of yellow catfish in the high-fat group (HL) were significantly increased. P <0.05), while adding 1×10 8 CFU / g L. senioris The LS group of strain AH123 significantly alleviated the elevation of the above indicators caused by high-fat feeding, with SOD and GSH levels significantly lower than those in the control group. P <0.05), CAT activity and MDA content were slightly lower than in the high-fat group, but there was no significant difference compared with the control group. P >0.05).

[0044] Table 2. Liver antioxidant indices in different treatment groups SOD (U / mg) <![CDATA[132.59 ± 1.28 b ]]> <![CDATA[142.09 ± 6.14 a ]]> <![CDATA[103.04 ± 1.24 c ]]> CAT (U / mg) <![CDATA[46.34 ± 6.35 b ]]> <![CDATA[51.96 ± 3.19 a ]]> <![CDATA[44.02 ± 2.32 b <!-- 6 -->]]> MDA (nmol / g) 2.08 ± 0.53 2.86 ± 0.95 2.33 ± 0.27 GSH (U / mg) <![CDATA[2.20 ± 0.03 b ]]> <![CDATA[3.79 ± 0.20 a ]]> <![CDATA[1.93 ± 0.07 c ]]> 5. Measurement of serum indicators related to liver health The serum levels of low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), alanine aminotransferase (ALT) activity, and aspartate aminotransferase (AST) activity were detected using reagent kits from Nanjing Jiancheng Bioengineering Institute (ALT kit number C009-2-1, AST kit number C010-2-1, HDL-C kit number A112-1-1, and LDL-C kit number A113-1-1).

[0045] As shown in Table 3, compared with the control group (Con), the high-fat group (HL) of yellow catfish had significantly higher levels of LDL-C, ALT, and AST, and significantly lower levels of HDL-C. P <0.05). And adding 1×10 8 CFU / g L. senioris The LS group of strain AH123 significantly alleviated the changes in the above indicators caused by high-fat feeding, with LDL-C, ALT, and AST levels significantly lower than those in the high-fat group. P <0.05, HDL-C levels were significantly higher in the high-fat group ( P <0.05). The above results indicate that... L. senioris The AH123 strain can significantly reduce lipid metabolism and liver health indicators.

[0046] Table 3. Serum markers related to liver health in different treatment groups LDL-C (mmol / L) <![CDATA[0.26 ± 0.06 c ]]> <![CDATA[0.71 ± 0.06 a ]]> <![CDATA[0.48 ± 0.12 b ]]> HDL-C (mmol / L) <![CDATA[4.05 ± 0.87 b ]]> <![CDATA[3.28 ± 0.43 b ]]> <![CDATA[5.52 ± 0.84 a ]]> ALT (U / L) 215.36 ± 2.29 251.20 ± 9.40 196.81 ± 44.40 AST (U / L) <![CDATA[69.71 ± 2.87 b ]]> <![CDATA[126.23 ± 11.60 a ]]> <![CDATA[49.62 ± 2.62 c ]]> 6. Determination of total cholesterol (TC) and triglyceride (TG) levels in the liver TC and TG in liver tissue supernatant were detected using kits from Nanjing Jiancheng Bioengineering Institute (TC kit catalog number A111-1-1, TG kit catalog number A110-1-1).

[0047] Depend on Figure 2 As shown in A and B, the TC and TG contents of the HL group were significantly higher than those of the Con group, while the TC and TG contents of the LS group were significantly lower than those of the HL group, indicating that... L. senioris The AH123 strain can significantly reduce triglyceride and cholesterol levels in the liver.

[0048] 7. Liver oil red O staining Frozen liver tissue was cut into 0.5 cm × 0.5 cm × 0.5 cm pieces, placed on an ice tray, and completely covered with OCT embedding medium. The pieces were then frozen in a cryostat for 15 min until the embedding medium completely solidified and turned white (-20°C). After freezing, the tissue was fixed on the microtome, and the section thickness was adjusted (4 μm to 8 μm) for sectioning. The sections were then attached to glass slides and immediately immersed in formaldehyde fixative for 1 min. After fixation, the sections were frozen and stored at -20°C for later use. The sections were then thawed at 25°C and washed three times with distilled water for 5 min each time. Oil Red O stock solution and distilled water were mixed at a 3:2 ratio, allowed to stand for 10 min, and then filtered through a 0.45 μm microporous membrane to obtain the working solution. After washing with distilled water, the sections were first washed with 60% isopropanol, then stained with Oil Red O working solution for 10 min. The sections were then differentiated in 60% isopropanol for 10 s and washed with distilled water. Next, stain the nuclei with Harris hematoxylin for 5 minutes, wash with tap water, differentiate with 1% hydrochloric acid alcohol for 5 seconds, rinse with tap water, return to blue with 0.6% ammonia solution, and rinse thoroughly with running water. Finally, shake off the water from the sections, mount with glycerol gelatin, and observe and photograph under a microscope as soon as possible.

[0049] Depend on Figure 3 As shown in A~D, compared with the Con and LS groups, the lipid droplet accumulation area in the HL group was significantly increased, while the lipid droplet deposition area in the LS group was reduced compared with the HL group, indicating that... L. senioris The AH123 strain can significantly reduce lipid deposition in the liver.

[0050] 8. L. senioris Colonization of strain AH123 in the intestine of yellow catfish and its effect on hepato-intestinal gene expression Genes related to gut and liver health were selected for q-PCR validation. Primer sequence information is as follows:

[0051] accα -F:GGGGTTTTCACGCTGCTTC, SEQ ID NO.2; accα -R: GGTTCTGATTGGGTCGTCCTG, SEQ ID NO.3; cyp27a1 -F: GTTTGCCCAGGTGACAAGAT, SEQ ID NO.4; cyp27a1 -R: GTGAAAATGTGTGGGGGCTCT, SEQ ID NO.5; cyp7a1 -F: ACCCAAGTCATGGCTACACC, SEQ ID NO.6; cyp7a1-R:GTCTTGTCTCCGTCCAGCTC,SEQ ID NO.7; scd -F:TAAAGACTGCCGTCGTGTCC,SEQ ID NO.8; scd -R:ATCTCTGCATCTTTATCCACTCC,SEQ ID NO.9; fgf19 -F:CAAGACATGCTGTTTGCCGT,SEQ ID NO.10; fgf19 -R:TGCGAATCTCCACCAAACTGTA,SEQ ID NO.11; fxr -F:AACCAGCCATGTTCAGGTTC,SEQ ID NO.12; fxr -R:GGAGAGCATGTTCCTCTTGC,SEQ ID NO.13; hsl -F: ATGCAGGAGATGCTCCACAG, SEQ ID NO.14; hsl -R:GGAGAGCATGTTCCTCTTGC,SEQ ID NO.15; ntcp -F:GCAGCATCACCTTAGGAGCA,SEQ ID NO.16; ntcp -R: TGGATGTTTTGACAGCCGGT, SEQ ID NO.17; lxr -F:CATCGGGCTACCTTAAGTCCA,SEQ ID NO.18; lxr -R:ACCCGAATGGCTTCCTAACA,SEQ ID NO.19; taut -F:TCAGCCTGGTTTTGACTCTGG,SEQ ID NO.20; taut -R:GCTCGAGGCAAAATGACACG,SEQ ID NO.21; pparα -F:CGAGGATGGGGATGCTGGTG,SEQ ID NO.22; pparα -R:CGTCTGGGTGGTTCGTCTGC,SEQ ID NO.23; cdo1 -F: TGATTCCATTGGCCTGCACC, SEQ ID NO.24; cdo1 -R:GCATTGCTGGAAAGGAGGAC,SEQ ID NO.25; shp -F:CGAAAAGAACCGAGAGCAAC,SEQ ID NO.26; shp -R:ACAGAACCTCCCTGAGAGCA,SEQ ID NO.27; csad -F:TACTGGGCCTTTCCTCAGGT,SEQ ID NO.28; csad -R: TCGAGTAGTGGCTCTCCTGT, SEQ ID NO.29; srebp1c -F:CTGGGTCATCGCTTCTTTGTG,SEQ ID NO.30; srebp1c -R:TCCTTCGTTGGAGCTTTTGTCT,SEQ ID NO.31; baat -F:ACCATTAAGCCACCATGCCC,SEQ ID NO.32; baat -R: AGCAGATGAATTCTTACTGGCCTGC, SEQ ID NO.33; zo1 -F:CAGAAGATTCAGCGCAAGGC,SEQ ID NO.34; zo1 -R:ATCACCGTCTCCTCCATTGC,SEQ ID NO.35; fabp6 -F:GCAGTTTGGAACCCACAACC,SEQ ID NO.36; fabp6 -R:CTTACAGGTGGGCATGTTGGT,SEQ ID NO.37; asbt -F:TGTATCAGGTGGCTTCGCTG,SEQ ID NO.38; asbt -R: CTGCAAGAGCCTCCCTAACC, SEQ ID NO.39; slc36a1 -F: CCTTCTTGGTCTGTTGGGCT, SEQ ID NO.40; slc36a1 -R: GACCTGAAAGGTGCCACTGT, SEQ ID NO.41; nfkb -F: ATGAGGACGATGAGACGGGA, SEQ ID NO.42; nfkb -R: GAGTTGCACGAAGACCGAGA, SEQ ID NO.43; tnfa -F: GTCCATATGAGCCACACCGT, SEQ ID NO.44; tnfa -R: GTAGATAGCGCCGAACCAGT, SEQ ID NO.45; occludin -F: AGACAAACGCTCGTTCACCA, SEQ ID NO.46; occludin -R: AGACAAACGCTCGTTCACCA, SEQ ID NO. 47.

[0052] 8.1 Abundance of BSH bacteria in the gut (qPCR validation) Total RNA extraction was performed according to the instructions of the Mini BEST Universal RNA Extraction Kit (9767) from Shanghai Nuoning Biotechnology Co., Ltd. Using the extracted total RNA as a template, PrimeScript was used... TM Reverse transcription was performed using the RTreagent Kit with gDNA Eraser (Perfect Real Time) (RR047Q). Genomic DNA removal was prepared according to the system in Table 4, incubated at 42°C for 2 min, and stored at 4°C. Reverse transcription was prepared according to the system in Table 5, incubated at 37°C for 15 min, heated at 85°C for 5 s, and the products were stored at -20°C. Real-time quantitative PCR was performed using TB Green® Premix Ex Taq. TMThe (Tli RNaseH Plus) kit (Takara) was used on a CFX96 Real-Time PCR Detection System (Bio-Rad), and the reaction mixture was prepared according to Table 6. The PCR reaction program was: 95℃ pre-denaturation for 30 s; 95℃ denaturation for 3 s; 60℃ annealing for 30 s, for a total of 40 cycles.

[0053] Table 4 Genomic DNA Elimination Reaction System 5 x gDNA Eraser Buffer 2.0 μL gDNA Eraser 1.0 μL total RNA 1 μg <![CDATA[RNase Free ddH2O]]> Add to 10 μL Table 5 Reverse Transcription System Reaction solution from Step 1 10.0 μL Prime Script RT Enzyme MixⅠ 1.0 μL RT Prime Mix 1.0 μL 5x Prime Script Buffer 2 (for Real Time) 4.0 μL <![CDATA[RNase Free ddH2O]]> Add to 20 μL Table 6. Real-time PCR reaction system TB Green Premix Ex Taq (Tli RNaseH Plus) (2X) 12.5 μL PCR Forward Primer (10 μM) 0.5 μL PCR Reverse Primer (10 μM) 0.5 μL RT reaction solution (cDNA solution) 2.0 μL <![CDATA[RNase Free ddH2O]]> Add to 25 μL Depend on Figure 4 It can be seen that the abundance of BSH bacteria was highest in the LS group and significantly higher than that in the HL group. L. senioris The AH123 strain can preferentially colonize the gut.

[0054] 8.2 Liver gene expression Results of liver-related gene expression ( Figure 5 The data showed that, compared to the HL group, the LS group... fxr , shp , fgf19 , hsl and taut Gene expression levels were significantly elevated, while cyp27a1 , lxr , srebp1c , scd , ntcp and csad The expression shows the opposite trend, indicating that L. senioris The AH123 strain can significantly activate the FXR signaling pathway in the liver, inhibit lipid synthesis, and promote the expression of lipid oxidation genes. 8.3 Intestinal gene expression Results of gut-related gene expression ( Figure 6 The data showed that, compared to the HL group, the LS group... fxr , shp , fgf19 , fabp6 , slc36a1 , zo1 , occludin and taut Gene expression levels were significantly elevated, while asbt , nfkb and tnfa The expression shows the opposite trend, indicating that L. seniorisThe AH123 strain can significantly activate the expression of the FXR signaling pathway in the gut, upregulate the expression of tight junction genes, and downregulate the expression of inflammatory genes.

[0055] 9. Intestinal flora analysis Gut microbiota were sequenced using 16S rDNA gene sequencing by Shanghai Meiji Biotechnology Co., Ltd., and gut microbiota diversity was analyzed using the β-diversity analysis module of the Meiji Biotechnology Cloud Platform. Results showed ( Figure 7 The main explanatory components PCoA1 and PCoA2 accounted for 50% and 23% of the total variance, respectively. The gut microbiota composition of the Con group and the LS group was similar, indicating that... L. senioris The AH123 strain can improve gut microbiota dysbiosis caused by high-fat diets.

[0056] Based on the relative abundance ranking of microorganisms, this invention selects the top 20 abundant characteristic species to construct a heatmap for community structure analysis. Figure 8 Intergroup comparisons showed that, compared with the HL group, the LS group had a higher potential for probiotics. Lactobacillus , Cetobacterium , Akkermansi a and Romboutsia The increase in abundance further illustrates L. senioris The AH123 strain can improve gut microbiota dysbiosis caused by high-fat diets.

[0057] 10. Intestinal bile acid metabolism Intestinal contents were collected 5±1 h after the last feeding in all treatment groups and frozen at -80℃.

[0058] 10.1 Sample Pretreatment and Metabolite Extraction Accurately weigh 50 mg of intestinal contents into a centrifuge tube and operate on ice throughout the process. Add 500 μL of 80% methanol aqueous solution pre-cooled to -20°C as the extraction solvent. Add grinding beads and extract using a shaker for 20 min. Then centrifuge at 4°C and 20,000 rcf for 15 min to induce protein precipitation. Transfer the supernatant to a new centrifuge tube. Centrifuge again at 4°C and 20,000 rcf for 15 min and collect the supernatant for later use.

[0059] 10.2 Sample Derivatization Reactions Take 60 μL of the sample supernatant prepared above, and add 20 μL of 3-nitrophenylhydrazine (3-NPH) solution, 20 μL of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) solution, and 20 μL of internal standard mixed solution (containing isotopically labeled short-chain fatty acids: 5 μg / mL of acetic acid-d4, propionic acid-d5, butyric acid-d7, and valeric acid-d9 in methanol solution); after vortex mixing, place in a water bath sonicator and sonicate at a frequency of 40 kHz and a power of 250 W for 15 min, and then place in a 30℃ water bath to react in the dark for 1 h; after the reaction, centrifuge at 4℃ and 20000 rcf for 15 min, and take the supernatant into a sample vial for analysis by ultra-high performance liquid chromatography-tandem mass spectrometry (UPLC-MS / MS).

[0060] 10.3 Ultra-high performance liquid chromatography (UPLC) analysis conditions The target analytes were separated using liquid chromatography. An octadecylsilane-bonded silica column was used, with a column temperature of 40℃ and an injection volume of 5 μL. Mobile phase A was an aqueous solution containing 0.1% formic acid (v / v), and mobile phase B was a mixture of acetonitrile and isopropanol (7:3 v / v). Elution was performed according to a preset gradient elution program. The specific program was as follows: mobile phase A was 0.01% formic acid aqueous solution, and mobile phase B was acetonitrile; the elution gradient was set as follows: 0 min to 2 min, maintaining 15% B; 2 min to 12 min, the B phase ratio linearly increased from 15% to 50%; 12 min to 14 min, the B phase increased to 100% and held until 16 min; 16 min to 16.1 min, the B phase decreased to 15%; 16.1 min to 20 min, maintaining 15% B to equilibrate the column; the flow rate was set to 0.35 mL / min, and the column temperature was set to 40℃.

[0061] 10.4 Tandem Mass Spectrometry (MS / MS) Detection Conditions Quantitative analysis was performed using a triple quadrupole mass spectrometer in multiple reaction monitoring (MRM) mode. The ion source was an electrospray ionization (ESI) source in negative ion mode. - The main mass spectrometry parameters were set as follows: spray voltage (IS) -4500V, ion source temperature (TEM) 350℃, sheath gas 55 Arb, auxiliary gas (Aux Gas) 10 Arb, and sweep gas (Sweep Gas) 0 Arb.

[0062] 10.5 Qualitative and Quantitative Calculations Absolute quantification was performed using the internal standard method. Qualitative identification of target bile acids was achieved by comparing retention times and MRM fragment ions with standard methodologies. Calibration curves were constructed by fitting the concentration values ​​of a series of concentration gradient standards on the x-axis and the ratio of the peak area of ​​the standards to the peak area of ​​the internal standard on the y-axis, and then the absolute content (ng / g) of each bile acid in the sample was calculated.

[0063] Figure 9 The results of targeted metabolomics (bile acids) revealed that L. senioris The intervention targeted the clearance of potential FXR antagonists (such as taurine-bound bile acids like T-β-MCA, TDCA, THDCA, and THCA) accumulated in the liver; while the levels of FXR agonists (CA, CDCA, TCA, and TCDCA) did not increase significantly.

[0064] The above results indicate that the present invention provides L. senioris The AH123 strain regulates the gut microbiota, reshapes bile acid homeostasis, and reduces liver fat deposition, thus alleviating liver and intestinal damage caused by high-fat stress.

[0065] Although preferred embodiments of the invention have been described, those skilled in the art, once they have learned the basic inventive concept, can make other changes and modifications to these embodiments.

[0066] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from its spirit and scope. Therefore, if these modifications and variations fall within the scope of the claims of this invention and their equivalents, this invention also intends to include these modifications and variations.

Claims

1. A strain of slow-growing lactobacillus that produces bile salt hydrolase ( Lentilactobacillus senioris AH123, characterized in that, The *Lactobacillus slow-growing* AH123 was deposited at the China Center for Type Culture Collection (CCTCC) on July 8, 2026, with accession number CCTCC NO: M 20261573, and classified as follows: Lentilactobacillus senioris AH123.

2. The application of the *Lactobacillus slow-growing* AH123 according to claim 1 in the preparation of products that inhibit lipid metabolism disorders in fish, characterized in that... The product is a feed containing *Lactobacillus chronicus* AH123, with a content of 0.9 × 10⁻⁶ *Lactobacillus chronicus* AH123 per gram of feed. 8 CFU ~ 1.1 × 10 8 CFU.

3. The application according to claim 2, characterized in that, The lipid metabolism disorder is caused by a high-fat diet.

4. The application according to claim 2, characterized in that, The product inhibits lipid metabolism disorders in fish by improving the homeostasis of lipid metabolism and bile acid metabolism in the liver and intestines of fish, improving the antioxidant capacity of the intestines of fish, improving serum lipid metabolism and liver health indicators of fish, and improving the intestinal flora disorder induced by high-fat diets.

5. The application according to claim 4, characterized in that, The improvement of lipid metabolism and bile acid metabolism homeostasis in fish liver and intestines is achieved by reducing fat deposition in the liver, reducing triglyceride and cholesterol levels in the liver, and increasing the activity of bile salt hydrolytic enzymes in the intestines of fish.

6. The application according to claim 4, characterized in that, The improvement of the antioxidant capacity of fish intestines is achieved by increasing the activity of superoxide dismutase, catalase, and reduced glutathione in the fish intestines, and by reducing the content of malondialdehyde.

7. The application according to claim 4, characterized in that, The indicators for improving serum lipid metabolism and liver health in fish are: reducing low-density lipoprotein cholesterol, alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, and increasing high-density lipoprotein cholesterol (HDL) levels.

8. The application according to claim 4, characterized in that, The improvement of high-fat diet-induced intestinal flora dysbiosis in fish is achieved by: increasing intestinal flora β-diversity, increasing the presence of *Lactobacillus* spp. in the gut, and... Cetobacterium , Akkermansia or Romboutsia Relative abundance of beneficial bacteria genera.

Images