Pseudomonas koreensis, isolation and screening method thereof, and application thereof

Abstract

The present application relates to the field of microbial technology, and particularly relates to a Pseudomonas koreensis, a separation and screening method and application thereof. Pseudomonas koreensis L158, Pseudomonas koreensis L158 is preserved in China Center for Type Culture Collection, and the preservation number is CCTCC NO: M 2026392. Pseudomonas koreensis The separation and screening method of L158 comprises the following steps: preparing a rhizosphere microbial suspension; and separating and screening the Pseudomonas koreensis from the rhizosphere microbial suspension by using a FACS-iChip in-situ culture technology. The present application provides the Pseudomonas koreensis with multiple growth-promoting effects, and solves the problem of single growth-promoting function of the existing growth-promoting strains.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain of Pseudomonas kansui and its isolation, screening method, and application. Background Technology

[0002] Plant growth-promoting rhizobacteria (PGPR) are microbial communities found in the rhizosphere soil of plants that stimulate the growth of host plants. In agricultural production, PGPR mainly promotes crop growth through the following mechanisms: first, phosphorus solubilization, which involves secreting organic acids, protons, and phosphatases to convert insoluble inorganic and organic phosphorus in the soil into available phosphorus that can be absorbed by plants; second, potassium solubilization, which involves releasing potassium ions through metabolic activities to activate soil potassium minerals; and third, the production of plant hormones (such as auxin IAA), which promote root development. Utilizing PGPR to prepare microbial inoculants has become an important means of reducing dependence on chemical fertilizers and achieving green agricultural development.

[0003] Although existing microbial inoculants can activate soil nutrients to some extent, they still have the following objective shortcomings in practical applications: (1) Poor functional singularity and poor synergy Existing growth-promoting bacterial strains often have relatively limited functions. While many known strains exhibit good phosphorus-solubilizing abilities, they often perform poorly or show no significant effect in potassium-solubilizing experiments. This single function limits their application in comprehensively infertile soils and cannot simultaneously meet the crop's needs for multiple nutrients such as phosphorus and potassium.

[0004] (2) Imbalance in metabolic products Existing strains have difficulty synthesizing various functional metabolites in a balanced manner during metabolism: they can only achieve inorganic phosphorus dissolution, and the conversion efficiency of organic phosphorus is low, indicating that their ability to secrete related enzyme systems is weak and they cannot effectively utilize organic phosphorus sources in the soil; or they can only synthesize hormone-like substances, with a low level of siderophore synthesis and an imbalance in the secretion ratio of various growth-promoting metabolites, making it difficult to simultaneously achieve multiple functions such as nutrient activation, crop signal regulation and stress buffering.

[0005] (3) Environmental adaptability and colonization ability are uncertain. Many high-efficiency strains screened in laboratories are prone to problems such as decreased activity and difficulty in colonization in complex field soil environments due to pH, temperature, and competition from other microorganisms. This results in unstable growth-promoting effects in actual fields, making it difficult to achieve the same level as in the laboratory.

[0006] In summary, although existing technologies have provided several strains that can solubilize phosphorus or potassium, there is still a lack of a multifunctional growth-promoting strain that combines efficient phosphorus solubilization and potassium solubilization, has balanced metabolites, and is highly adaptable to the environment. Summary of the Invention

[0007] To address the problems existing in the prior art, the present invention aims to provide a strain of Pseudomonas aeruginosa, its isolation and screening method, and its application, so as to solve the problem of the single growth-promoting function of existing growth-promoting strains, as well as the problems of unbalanced metabolites, poor environmental adaptability, and poor colonization ability of existing strains.

[0008] The technical solution of the present invention is as follows: This invention provides a strain of *Pseudomonas kansui*, wherein *Pseudomonas kansui* is... Pseudomonas Korean L158, the aforementioned Pseudomonas koreensis L158 is deposited at the China Center for Type Culture Collection, accession number: CCTCC NO: M 2026392.

[0009] The Korean Pseudomonas strain provided by this invention Pseudomonas koreensis L158, possessing multiple metabolic pathways, overcomes the limitations of single functions: in soil nutrient activation, it exhibits extremely strong dual organic / inorganic phosphorus-solubilizing ability (inorganic phosphorus release up to 139.240 mg / L) and potassium-solubilizing activity (promoting the decomposition of insoluble potassium minerals and increasing available potassium content); in physiological regulation and stress buffering, it can efficiently synthesize multiple functional metabolites (IAA secretion up to 25.240 μg / mL, gibberellin secretion up to 15.313 μg / mL, and siderophore activity up to 66.953%). This strain forms a multi-synergistic growth-promoting mechanism involving soil nutrient activation, crop development signal activation, and rhizosphere microenvironment stress buffering, enabling it to comprehensively and multidimensionally reshape the crop rhizosphere microecology. Meanwhile, this invention provides a *Pseudomonas aeruginosa* strain from Korea. Pseudomonas koreensis L158 can still achieve rapid, efficient and stable rhizosphere colonization in complex field habitats such as degraded farmland, acidified soil, and soil with continuous cropping obstacles, as well as rapidly, efficiently and stably promote the reconstruction of rhizosphere microecology. It has an extremely stable effect on rice seedling growth, aboveground biomass accumulation and final yield, and has successfully overcome the common industry problem of the degradation of the effect of growth-promoting bacteria from the laboratory to the field.

[0010] In summary, the Korean Pseudomonas strain provided by this invention Pseudomonas koreensis L158 possesses multiple metabolic pathways and relies on a synergistic growth-promoting mechanism involving soil nutrient activation, crop development signal activation, and rhizosphere microenvironment stress buffering. It also exhibits dual organic / inorganic phosphorus-solubilizing and potassium-solubilizing activities, and can efficiently synthesize IAA, gibberellin, and siderophores. It can stably colonize the rhizosphere and reshape the rhizosphere microecology in complex field environments such as degraded farmland and soils with continuous cropping obstacles. When applied to rice, it can improve seedling growth, increase biomass, and stably increase yield. It solves the problem of the single growth-promoting function of existing growth-promoting strains, as well as the problems of unbalanced metabolites, poor environmental adaptability, and poor colonization ability of existing strains.

[0011] The present invention also provides a method for isolating and screening the above-mentioned Pseudomonas kansui, comprising the following steps: S1. Prepare a rhizosphere microbial suspension; S2. Using FACS-iChip in situ culture technology, Pseudomonas koreanum was isolated and screened from rhizosphere microbial suspension.

[0012] Based on the FACS-iChip high-throughput in-situ culture technology, this invention overcomes the limitations of traditional culture methods in obtaining and culturing microorganisms, deeply exploring and reconstructing soil microbial "dark matter" resources ("dark matter" refers to microbial groups in the environment that can be detected by molecular means but are difficult to obtain in live pure cultures using traditional culture methods). Traditional culture methods can only isolate a very small proportion of conventional microorganisms, limiting the discovery of highly efficient functional strains. This invention develops and integrates the FACS-iChip high-throughput in-situ culture technology based on flow cytometry sorting, precisely implanting individual active soil microorganisms into in-situ simulated habitats. This achieves large-scale, high-throughput, in-situ precise capture and purification culture of complex soil microbial resources, providing a core material basis for subsequent targeted breeding of native original functional strains with excellent ecological adaptability.

[0013] Furthermore, the separation and screening method specifically includes the following steps: S1. Mix the soil and PBS buffer, centrifuge, collect the supernatant, filter, and obtain a rhizosphere microbial suspension. S2. Add thiazolium orange solution and propidium iodide solution to the rhizosphere microbial suspension, incubate in the dark, and obtain a labeled rhizosphere microbial suspension. Individual viable microorganisms that are thiazole orange positive and propidium iodide negative were isolated from the labeled rhizosphere microbial suspension. A single live microorganism is placed in a single well of the isolation chip, culture medium is added, and the isolation chip is sealed to obtain a sealed isolation chip. Rice was planted in root boxes filled with rice soil and kept submerged. When the rice reached the heading stage, the sealed isolation chip was buried in the rice rhizosphere soil for in-situ culture to obtain the cultured isolation chip. Single colonies were picked from the cultured isolation chip and inoculated into the culture medium and cultured to the logarithmic phase to obtain the fermentation broth; The fermentation broth was tested to obtain the growth-promoting functional indicators of the strains, and Pseudomonas aeruginosa was obtained by screening based on the growth-promoting functional indicators.

[0014] Furthermore, in S1: the ratio of the soil to PBS buffer is 1g:10mL; In S2: The incubation in the dark was carried out at room temperature for 15 minutes. The volume ratio of the rhizosphere microbial suspension, thiazole orange solution, and propidium iodide solution is 100:1:1. In each well of the isolation chip, the amount of culture medium is 50% of the volume of a single well; The flooding conditions include: forming a shallow water layer of 2-3 cm on the soil surface; The in situ culture was conducted at a temperature of 28°C for 4 weeks. The culture medium is LB liquid medium.

[0015] Furthermore, the indicators of reproductive function include IAA secretion, gibberellin secretion, phosphate solubility, and siderophore activity.

[0016] Furthermore, based on the IAA secretion amount greater than 5 mg / L, gibberellin secretion amount greater than 0.5 mg / L, phosphorus solubility greater than 10 mg / L, and siderophore activity greater than 10%, *Pseudomonas aeruginosa* was screened to obtain Korean *Pseudomonas*.

[0017] The present invention also provides the application of the above-mentioned Pseudomonas kansui or the Pseudomonas kansui isolated by the above-mentioned isolation and screening method in crop cultivation.

[0018] Furthermore, the crop is rice.

[0019] The present invention also provides the application of the above-mentioned Pseudomonas kansui or the above-mentioned isolation and screening method of Pseudomonas kansui in at least one of crop growth promotion, disease resistance and yield increase.

[0020] Furthermore, the crop growth promotion includes: promoting soil nutrient activation, promoting crop development signal activation, and promoting rhizosphere microenvironment stress buffering; The promotion of soil nutrient activation includes promoting the dissolution of inorganic phosphorus, the hydrolysis of organic phosphorus, and the decomposition of potassium minerals; The activation of crop development-promoting signals includes the promotion of IAA secretion and gibberellin secretion; The method of promoting the buffering of rhizosphere microenvironment stress includes enhancing siderophore activity; The disease resistance includes resistance to rice false smut.

[0021] The beneficial effects of this invention are: The Korean Pseudomonas strain provided by this invention Pseudomonas koreensisL158, possessing multiple metabolic pathways, overcomes the limitations of single functions: in soil nutrient activation, it exhibits extremely strong dual organic / inorganic phosphorus-solubilizing ability (inorganic phosphorus release up to 139.240 mg / L) and potassium-solubilizing activity (promoting the decomposition of insoluble potassium minerals and increasing available potassium content); in physiological regulation and stress buffering, it can efficiently synthesize multiple functional metabolites (IAA secretion up to 25.240 μg / mL, gibberellin secretion up to 15.313 μg / mL, and siderophore activity up to 66.953%). This strain forms a multi-synergistic growth-promoting mechanism involving soil nutrient activation, crop development signal activation, and rhizosphere microenvironment stress buffering, enabling it to comprehensively and multidimensionally reshape the crop rhizosphere microecology. Meanwhile, this invention provides a *Pseudomonas aeruginosa* strain from Korea. Pseudomonas koreensis L158 can still achieve rapid, efficient and stable rhizosphere colonization in complex field habitats such as degraded farmland, acidified soil, and soil with continuous cropping obstacles, as well as rapidly, efficiently and stably promote the reconstruction of rhizosphere microecology. It has an extremely stable effect on rice seedling growth, aboveground biomass accumulation and final yield, and has successfully overcome the common industry problem of the degradation of the effect of growth-promoting bacteria from the laboratory to the field.

[0022] The method for isolating and screening *Pseudomonas aeruginosa* of this invention, based on FACS-iChip high-throughput in situ culture technology, overcomes the limitations of traditional culture methods in obtaining and culturing microorganisms, and deeply explores and reconstructs soil microbial "dark matter" resources ("dark matter" refers to microbial groups in the environment that can be detected by molecular means but are difficult to obtain in live pure culture using traditional culture methods). Traditional culture methods can only isolate a very small proportion of conventional microorganisms, limiting the discovery of highly efficient functional strains. This invention develops and integrates FACS-iChip high-throughput in situ culture technology based on flow cytometry sorting, which precisely implants single active soil microorganisms into in situ simulated habitats, achieving large-scale, high-throughput, in situ precise capture and purification culture of complex soil microbial resources, providing a core material basis for subsequent targeted breeding of native original functional strains with excellent ecological adaptability.

[0023] Korean Pseudomonas ( Pseudomonas koreensis L158's classification naming: Pseudomonas Korean L158, Pseudomonas koreensis L158 was deposited at the China Center for Type Culture Collection (CCTCC) on March 9, 2026, with accession number CCTCC NO: M 2026392; address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. Attached Figure Description

[0024] Figure 1 This is a schematic diagram of the FACS-iChip in situ culture technology. Figure 2 for Pseudomonas koreensis The phylogenetic tree of L158; Figure 3 The graph shows the results of inorganic phosphorus concentration, where B. pumilus represents the control group of the type strain and L158 represents the experimental group. Figure 4 The graph shows the results of organophosphorus concentrations, where B. pumilus represents the control group of the type strain and L158 represents the experimental group. Figure 5 The graph shows the potassium ion concentration results, where B. pumilus represents the control group of the type strain and L158 represents the experimental group. Figure 6 The graph shows the results of IAA secretion, where B. pumilus represents the control group of the type strain and L158 represents the experimental group. Figure 7 The graph shows the results of gibberellin secretion, where B. pumilus represents the control group of the type strain and L158 represents the experimental group. Figure 8 The graph shows the results of siderophore activity, where B. pumilus represents the control group of the type strain and L158 represents the experimental group. Figure 9 The graph shows the results of the measurement of root length and plant height of rice seedlings. In the graph, CK represents the blank control group, L158 represents the experimental group, and B. pumilus represents the control group of the type strain. Figure 10 The graph shows the results of the biomass measurement of rice seedlings, where CK represents the blank control group, L158 represents the experimental group, and B. pumilus represents the control group of the type strain. Figure 11 The image shows the seedling height of rice seedlings. In the image, the control group represents the control group, B. pumilus represents the first treatment group, and L158 represents the second treatment group. Figure 12 The image shows the root length of rice seedlings. In the image, the control group represents the control group, B. pumilus represents the first treatment group, and L158 represents the second treatment group. Figure 13 The image shows the phenotypic diagrams of rice seedlings, where control represents the control group, B. pumilus represents the first treatment group, and L158 represents the second treatment group. Figure 14 The graph shows the disease rate of rice, where the control group represents the control group and L158 represents the second treatment group. Figure 15 This is a chart showing the percentage of disease occurrence levels in rice, where the control group represents the control group and L158 represents the second treatment group. Figure 16The image shows rice at maturity, with the control group representing the control group and L158 representing the second treatment group. Detailed Implementation

[0025] The present invention will be further described in detail below through embodiments, but in no way is the invention limited.

[0026] Korean Pseudomonas (Korean Pseudomonas) in the following examples Pseudomonas koreensis L158 can be cultured on LB broth at 30°C, and then transferred to slant agar for short-term preservation at 4°C. For long-term preservation, the bacterial culture can be mixed with an equal volume of diluted glycerol, placed in centrifuge tubes, and frozen at -20°C. This strain was deposited on March 9, 2026, at the China Center for Type Culture Collection (CCTCC), accession number: CCTCCNO: M 2026392; deposit address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province; classification and nomenclature: Pseudomonas Korean L158.

[0027] The LB liquid culture medium used in the following examples was purchased from the Zhejiang University Materials and Chemicals Procurement Management Platform, manufacturer: Beijing Solarbio Technology Co., Ltd., item number: L8291-250g; the MKB liquid culture medium was purchased from the Zhejiang University Materials and Chemicals Procurement Management Platform, manufacturer: Hebei Nika Biotechnology Co., Ltd., item number: MD193B; the Monkina inorganic phosphorus culture medium was purchased from Taobao, manufacturer: Guangdong Zhongshan Bai Microbial Technology Co., Ltd., item number: BW1271; the Monkina organic phosphorus culture medium was purchased from Taobao, manufacturer: Guangdong Zhongshan Bai Microbial Technology Co., Ltd., item number: BW1002; the potassium-solubilizing bacteria liquid culture medium was purchased from the Zhejiang University Materials and Chemicals Procurement Management Platform. The following products were purchased from the Zhejiang University Materials and Chemicals Procurement Management Platform: MM5080-250g (manufacturer: Hangzhou Chentong Biochemical Technology Co., Ltd.); Thiazole orange (TO) solution was purchased from the Zhejiang University Materials and Chemicals Procurement Management Platform, Sangon Biotech (Shanghai) Co., Ltd., A456136-0001 (manufacturer: Sangon Biotech (Shanghai) Co., Ltd.); Propidium iodide (PI) solution (1mg / ml) was purchased from the Zhejiang University Materials and Chemicals Procurement Management Platform, Beijing Solarbio Technology Co., Ltd., C0080-10*1mL (manufacturer: Beijing Solarbio Technology Co., Ltd.); PBS buffer was purchased from the Zhejiang University Materials and Chemicals Procurement Management Platform, Shanghai Yuanye Biotechnology Co., Ltd., R28329-500mL (manufacturer: Shanghai Yuanye Biotechnology Co., Ltd.).

[0028] Example 1

[0029] The isolation, screening, and identification of Pseudomonas aeruginosa in Korea includes the following steps: (1) Sample collection: Paddy soil was collected from a paddy field in Jiaxing City, Zhejiang Province (30°50′8.74″N, 120°43′3.68″E). The basic physicochemical properties of this paddy soil are as follows: The pH value was 6.76 (the soil-to-water ratio was 1:2.5 when the pH was measured); the organic matter content was 54.4 g / kg; the clay content was 36.3% and the silt content was 45.3%.

[0030] (2) Isolation and screening of rice growth-promoting strains: Take 5g of rice soil, add 50mL of PBS buffer, vortex and centrifuge to remove large particles, collect the supernatant; filter the supernatant through a 300-mesh filter to obtain a rhizosphere microbial suspension with a total microbial cell concentration of 10. 6 cells / mL; like Figure 1 As shown, FACS-iChip in situ culture technology was used to isolate and screen rice growth-promoting bacteria from rhizosphere microbial suspensions: The rhizosphere microbial suspension was labeled using the thiazole orange / propidium iodide (TO / PI) double staining method: 5 μL of thiazole orange solution and 5 μL of propidium iodide solution were added to 500 μL of rhizosphere microbial suspension and incubated in the dark for 15 min at room temperature to obtain the labeled rhizosphere microbial suspension. Microbial activity was distinguished based on cell membrane integrity: TO can penetrate intact cell membranes and emit green fluorescence after binding nucleic acids; PI cannot penetrate intact cell membranes, but can only enter cells with damaged cell membranes and emit orange-red fluorescence after binding nucleic acids. Using a flow cytometer with fluorescence gating set by an excitation light source, active microbial populations of TO-positive (green fluorescence) and PI-negative (no orange-red fluorescence) were selected from labeled rhizosphere microbial suspensions. The fluorescence sorting capability of the flow cytometer was then used to sort individual active microorganisms from the active microbial populations into the independent culture wells of a 384-well isolation chip. Each well was supplemented with LB liquid culture medium accounting for 50% of the well volume, and the 384-well isolation chip was sealed with a sterile membrane to obtain a sealed 384-well isolation chip. Seeds of the rice variety "Zhongzao 39" (Oryza sativa L.) were surface-sterilized, sown, and after germination and two weeks of cultivation, a healthy rice seedling was selected and planted in a root box containing 300g of rice soil. The seedlings were kept submerged, with a 2-3cm shallow water layer on the soil surface, and then placed in a greenhouse environment. The greenhouse conditions included: temperature 30℃, relative humidity 70%, 12 hours of light (9 am to 9 pm) and 12 hours of darkness (9 pm to 9 am the next day). When the rice reached the heading stage, a sealed 384-well isolation chip was transferred and buried in the rice rhizosphere soil, and then in situ cultured at 28℃ for 4 weeks (e.g., ...). Figure 1 The isolated chip after culture was removed, and a single colony was picked and inoculated into LB liquid medium and cultured to the logarithmic phase to achieve purification and obtain fermentation broth. The IAA secretion, gibberellin secretion, phosphorus solubility (inorganic phosphorus), and siderophore production capacity (siderophore activity) of the fermentation broth were measured. When the IAA secretion was greater than 5 mg / L, the gibberellin secretion was greater than 0.5 mg / L, the phosphorus solubility (inorganic phosphorus) was greater than 10 mg / L, and the siderophore activity was greater than 10%, the strain in the fermentation broth was a screened positive strain, namely a rice growth-promoting strain.

[0031] (3) Identification of rice growth-promoting strains: Identification was performed by amplifying the 16S rDNA nucleotide sequence of positive strains: Genomic DNA was extracted from the positive strain. Forward primer 27F (SEQ ID NO.1, AGAGTTTGATCCTGGCTCAG) and reverse primer 1522R (SEQ ID NO.2, GGTTACCTTGTTACGACTT) were selected as the 16S rDNA primers. Using the genomic DNA of the positive strain as a PCR template, the 16S rDNA gene of the positive strain was specifically amplified, and the PCR amplification products were recovered. Sequencing of the PCR amplification products yielded the following results: SEQ ID NO.3, 16S rDNA gene sequence of the positive strain:

[0032] The 16S rDNA gene sequencing results of positive strains were compared with the sequences of closely related type strains in the NCBI and LPSN databases. Global sequence alignment was performed using PairwiseAligner in the Biopython package, and common region pruning was performed on the alignment results, retaining only clearly defined nucleotide sites shared by all sequences. Uncorrected nucleotide p-distances were calculated based on the common sequence regions, and a phylogenetic tree was constructed using the Neighbor-Joining method. A bootstrap repeat test was performed 1000 times. The results are as follows: Figure 2 As shown. Based on sequence alignment and phylogenetic analysis, the positive strain was identified as Pseudomonas koreensis L158.

[0033] Example 2

[0034] The procedure for determining the nutrient conversion capacity of Pseudomonas aeruginosa in Korea is as follows: In Example 1 Pseudomonas koreensis L158 was inoculated into LB liquid medium for activation and cultured with shaking at 30℃ and 180 r / min for 24 h to obtain... Pseudomonas koreensis L158 strain seed liquid Pseudomonas koreensis The concentration of viable bacteria in the seed culture of strain L158 was 1.5 × 10⁻⁶. 9 CFU / mL.

[0035] The model strain *Bacillus pumilu* was inoculated into LB liquid medium for activation. The medium was then cultured with shaking at 30℃ and a rotation speed of 180 rpm for 24 h to obtain a seed culture of *Bacillus pumilu*. The concentration of viable cells in the *Bacillus pumilu* seed culture was 1.5 × 10⁻⁶. 9 CFU / mL.

[0036] Experimental group: Based on the volume of LB liquid medium, inoculate at a rate of 2%. Pseudomonas koreensis Seed culture of strain L158 was inoculated into LB liquid medium and incubated at 30°C with shaking at 140 rpm. -1 After overnight shaking culture under the specified conditions, the bacterial suspension was obtained. The absorbance value (OD) of the bacterial suspension was [value missing]. 600 =1; Control group of the model strain: The seed culture of the model strain *Bacillus pumilu* was inoculated into LB liquid medium at a volume of 2%, and incubated at 30°C with shaking at 140 rpm. -1After overnight shaking culture under the specified conditions, the bacterial suspension was obtained. The absorbance value (OD) of the bacterial suspension was [value missing]. 600 =1; 1 mL of bacterial suspension from the experimental group and the control group of the model strain were respectively transferred to different culture media, including Mongolica inorganic phosphorus medium (for measuring inorganic phosphorus release), Mongolica organic phosphorus medium (for measuring organic phosphorus release), and potassium-solubilizing bacteria liquid medium (for measuring potassium release). The culture media were incubated at 30 °C and shaken at 120 rpm. -1 Under the specified conditions, the culture was carried out with shaking, with three replicates per group. After 24 hours of shaking culture, samples were taken. The bacterial suspension was centrifuged, and the supernatant was collected. The concentrations of inorganic phosphorus in the *Montagne chinensis* inorganic phosphorus medium, organic phosphorus in the *Montagne chinensis* organic phosphorus medium, and potassium ions in the potassium-solubilizing bacteria liquid medium were determined using the supernatant. The concentrations of inorganic phosphorus in the *Montagne chinensis* inorganic phosphorus medium and organic phosphorus in the *Montagne chinensis* organic phosphorus medium were determined using the molybdenum-antimony colorimetric method, while the concentration of potassium ions in the potassium-solubilizing bacteria liquid medium was determined using flame atomic absorption spectrometry. The results for the inorganic phosphorus concentration in the *Montagne chinensis* inorganic phosphorus medium are shown below. Figure 3 As shown, the organic phosphorus concentration in the Monkina organic phosphorus medium is as follows: Figure 4 As shown, the potassium ion concentration in the liquid culture medium of potassium-solubilizing bacteria is as follows: Figure 5 As shown, by Figure 3 , Figure 4 and Figure 5 It was found that after 24 hours of cultivation, the concentration of inorganic phosphorus in the experimental group reached 139.240 ± 0.360 mg·L⁻¹. -1 The concentration of organophosphorus compounds was 5.647 ± 0.258 mg·L⁻¹. -1 The potassium ion concentration was 1.10 ± 0.056 mg·L. -1 Compared with the type strain Bacillus pumilus, Pseudomonas Korean All L158 strains showed significant phosphorus solubilization and phosphorus removal capabilities (P<0.05).

[0037] Example 3

[0038] The procedure for determining the plant hormone secretion capacity of *Pseudomonas aeruginosa* in Korea is as follows: In Example 1 Pseudomonas koreensis L158 was inoculated into LB liquid medium for activation and cultured with shaking at 30℃ and 180 r / min for 24 h to obtain... Pseudomonas koreensis L158 strain seed liquid Pseudomonas koreensis The concentration of viable bacteria in the seed culture of strain L158 was 1.5 × 10⁻⁶. 9 CFU / mL.

[0039] The model strain *Bacillus pumilu* was inoculated into LB liquid medium for activation. The medium was then cultured with shaking at 30℃ and a rotation speed of 180 rpm for 24 h to obtain a seed culture of *Bacillus pumilu*. The concentration of viable cells in the *Bacillus pumilu* seed culture was 1.5 × 10⁻⁶. 9 CFU / mL.

[0040] Measurement of IAA and gibberellin secretion: Experimental group: Based on the volume of LB liquid medium, inoculate at a rate of 2%. Pseudomonas koreensis L158 strain seed culture was transferred to a solution containing 200 mg·L⁻¹ -1 In LB liquid medium containing tryptophan, at a temperature of 30°C and a shaking speed of 120 r·min -1 The cells were cultured under shaking conditions for 24 hours. After 24 hours, samples were taken, centrifuged to remove bacterial cells, and the supernatant was collected to determine the amount of IAA and gibberellin secreted. The amount of IAA secreted was determined by the Salkowski colorimetric method, and the amount of gibberellin secreted was determined by the sulfuric acid colorimetric method. Control group of the model strain: Based on the volume of LB liquid medium, 2% of the seed culture of the model strain Bacillus pumilu was inoculated into a medium containing 200 mg·L⁻¹ of LB liquid medium. -1 In LB liquid medium containing tryptophan, at a temperature of 30°C and a shaking speed of 120 r·min -1 The cells were cultured under shaking conditions for 24 hours. After 24 hours, samples were taken, centrifuged to remove bacterial cells, and the supernatant was collected to determine the amount of IAA and gibberellin secreted. The amount of IAA secreted was determined by the Salkowski colorimetric method, and the amount of gibberellin secreted was determined by the sulfuric acid colorimetric method. Each group has 3 parallel pairs.

[0041] Determination of siderophore activity: Experimental group: Based on the volume of MKB liquid culture medium, inoculum was prepared at a rate of 2%. Pseudomonas Korean The seed culture of strain L158 was transferred to MKB liquid medium and cultured at 30°C with a shaking speed of 120 rpm. -1 The samples were cultured under shaking conditions for 24 hours. After the samples were centrifuged to remove the bacterial cells, and the supernatant was collected for testing. Control group of model strain: Based on the volume of MKB liquid medium, 2% of the seed culture of the model strain Bacillus pumilu was transferred to MKB liquid medium and inoculated at 30℃ with a shaking speed of 120 r·min. -1 The samples were cultured under shaking conditions for 24 hours. After the samples were centrifuged to remove the bacterial cells, and the supernatant was collected for testing. Blank control group: MKB liquid culture medium without inoculation, at a temperature of 30℃ and a shaking speed of 120 r·min. -1 The samples were cultured under shaking conditions for 24 hours. After the samples were centrifuged to remove the bacterial cells, and the supernatant was collected for testing. Each group has 3 parallel pairs.

[0042] Siderophore activity was determined by the CAS detection method. The absorbance (As) of the experimental group supernatant and the absorbance (Ar) of the control group supernatant were measured at 630 nm. The formula for calculating siderophore activity is shown in equation (I): Siderophore activity (%) = (Ar-As) / Ar × 100% (I) In Equation (I), when calculating the ferrocarrier activity in the supernatant of the experimental group, As represents the absorbance value of the supernatant of the experimental group at 630 nm, and Ar represents the absorbance value of the supernatant of the blank control group at 630 nm. When calculating the siderophore activity in the supernatant of the control group of the model strain, As represents the absorbance value of the supernatant of the control group of the model strain at 630 nm, and Ar represents the absorbance value of the supernatant of the blank control group at 630 nm.

[0043] The results of IAA secretion are as follows: Figure 6 As shown, the results of gibberellin secretion are as follows: Figure 7 As shown, the results of siderophore activity are as follows: Figure 8 As shown, by Figure 6 , Figure 7 and Figure 8 It was found that the IAA secretion level in the experimental group was 25.240±0.150 μg / mL, the gibberellin secretion level was 15.313±0.955 μg / mL, and the siderophore activity reached 66.953%; compared with the model strain Bacillus pumilus, Pseudomonas koreensis The secretion of growth-promoting substances and siderophore activity of strain L158 were significantly increased (P<0.05).

[0044] Example 4

[0045] The procedure for determining the effect of *Pseudomonas koreanum* on rice seedling growth is as follows: In Example 1 Pseudomonas koreensis L158 was inoculated into LB liquid medium for activation and cultured with shaking at 30℃ and 180 r / min for 24 h to obtain... Pseudomonas koreensis L158 strain seed liquid Pseudomonas koreensis The concentration of viable bacteria in the seed culture of strain L158 was 1.5 × 10⁻⁶. 9 CFU / mL.

[0046] The model strain *Bacillus pumilu* was inoculated into LB liquid medium for activation. The medium was then cultured with shaking at 30℃ and a rotation speed of 180 rpm for 24 h to obtain a seed culture of *Bacillus pumilu*. The concentration of viable cells in the *Bacillus pumilu* seed culture was 1.5 × 10⁻⁶. 9 CFU / mL.

[0047] Based on the volume of LB liquid medium, inoculate at a rate of 2%. Pseudomonas koreensis The seed culture of strain L158 was inoculated into LB liquid medium and cultured overnight at 28°C with shaking at 180 rpm to obtain the culture broth. The culture broth was then diluted with sterile water to a bacterial concentration of 10. 8 CFU / mL, as Pseudomonas koreensis The bacterial suspension of L158 is ready for use.

[0048] Based on the volume of LB liquid medium, 2% of the seed culture of the model strain *Bacillus pumilu* was inoculated into LB liquid medium. The medium was then cultured overnight at 28°C with shaking at 180 rpm to obtain the culture broth. The culture broth was then diluted with sterile water to a bacterial concentration of 10-1. 8 CFU / mL was prepared as a bacterial suspension for the model strain Bacillus pumilus.

[0049] Rice seeds (Oryza sativa subsp. indica, cv. 93-11) with plump and uniform grains were selected for the experiment. The rice seeds were first treated with 95% ethanol for 30 seconds, followed by surface disinfection with a 2.5% (v / v) sodium hypochlorite (NaClO) solution for 3-5 minutes. Finally, they were rinsed seven times with sterile deionized water to remove residual disinfectant. The disinfected seeds were then germinated on sterile, moist filter paper in an artificial climate incubator at 30℃, 70% relative humidity, and a light-dark ratio of 16h:8h. Moisture was maintained to keep the filter paper moist. Germinating seedlings with uniform growth were transferred to 96-well plates for hydroponic experiments.

[0050] Hydroponic experiment in the experimental group: Seedlings germinating in 96-well plates were cultured using 2 mL of Hoagland nutrient solution. Simultaneously, 5% of the Hoagland nutrient solution was added as an inoculum. Pseudomonas KoreanL158 bacterial suspension, 16 replicates per treatment, were cultured in an artificial climate incubator under the conditions of day / night temperature of 28 / 25℃, relative humidity of 70%, and photoperiod of 16 / 8h (day / night). After 8 days, the root length, plant height and biomass of rice seedlings were measured. Hydroponic experiment of the model strain control group: 2 mL of Hoagland nutrient solution was used to culture seedlings germinating in 96-well plates. At the same time, a bacterial suspension of the model strain Bacillus pumilus was added at a 5% inoculum volume based on the volume of Hoagland nutrient solution. Each treatment was replicated 16 times. The seedlings were cultured in an artificial climate incubator with a day / night temperature of 28 / 25℃, a relative humidity of 70%, and a photoperiod of 16 / 8h (day / night). After 8 days, the root length, plant height (seedling height), and biomass of the rice seedlings were measured. Hydroponic experiment with blank control group: Seedlings germinating in 96-well plates were cultured with 2 mL of Hoagland nutrient solution and 0.1 mL of sterile water were added. Each treatment was replicated 16 times and cultured in an artificial climate incubator with day / night temperature of 28 / 25℃, relative humidity of 70%, and photoperiod of 16 / 8h (day / night). After 8 days, the root length, plant height (seedling height) and biomass of rice seedlings were measured.

[0051] The results of the measurement of root length and plant height of rice seedlings are as follows: Figure 9 As shown in the figure, the biomass measurement results of rice seedlings are as follows: Figure 10 As shown. By Figure 9 and Figure 10 It is known that under hydroponic conditions, rice seeds undergo... Pseudomonas koreensis Inoculation with strain L158 and the type strain B. pumilus significantly promoted seedling growth and dry biomass accumulation. Regarding morphological development, inoculation... Pseudomonas koreensis Both L158 and B. pumilus significantly increased rice seedling height (11.86±0.68 cm and 10.78±0.70 cm, respectively), and were significantly higher than the blank control group (CK, seedling height 8.85±1.27 cm; P<0.05); Regarding root development, Pseudomonas koreensis Strain L158 exhibited superior growth-promoting properties, with a root length (4.81±0.24 cm) significantly exceeding that of B. pumilus (4.23±0.36 cm) and the CK treatment (3.77±0.29 cm). Regarding dry weight biomass accumulation, Pseudomonas koreensisThe L158 strain exhibited the most significant promoting effect, with its aboveground dry weight (8.01±0.16 mg) significantly higher than that of the *B. pumilus* strain (7.36±0.37 mg) and the CK treatment (6.41±0.58 mg). Simultaneously, its underground dry weight (4.53±0.65 mg) was also significantly superior to that of the *B. pumilus* strain (3.81±0.36 mg) and the CK treatment (3.33±0.27 mg). These results indicate that, compared to the model strain *B. pumilus*, the Korean *Pseudomonas* strain selected in this invention has a more pronounced promoting effect. Pseudomonas koreensis L158 exhibits superior and balanced rhizosphere growth-promoting effects in promoting root elongation and increasing overall plant dry matter accumulation, laying a solid phenotypic foundation for its subsequent application in field seedling cultivation.

[0052] Example 5

[0053] The steps for the field application of *Pseudomonas Koreanis* are as follows: 1. Seedling raising experiment In Example 1 Pseudomonas koreensis L158 was inoculated into LB liquid medium for activation and cultured with shaking at 30℃ and 180 r / min for 24 h to obtain... Pseudomonas koreensis L158 strain seed liquid Pseudomonas koreensis The concentration of viable bacteria in the seed culture of strain L158 was 1.5 × 10⁻⁶. 9 CFU / mL; to 500mL Pseudomonas koreensis Add 20L of water to the seed culture of strain L158 to obtain Pseudomonas Korean L158 bacterial suspension; the model strain Bacillus pumilu was inoculated into LB liquid medium for activation and cultured with shaking at 30℃ and 180 r / min for 24 h to obtain the Bacillus pumilu seed culture. The concentration of viable bacteria in the Bacillus pumilu seed culture was 1.5 × 10⁻⁶. 9 CFU / mL; Add 20L of water to 500mL of seed culture of Bacillus pumilu to obtain the bacterial culture of Bacillus pumilu.

[0054] The seedling raising experiment employed a full-factor randomized block design, including three treatment groups: a control group (no microbial inoculation), a first treatment group (inoculated with a single type strain of B. pumilus), and a second treatment group (inoculated with...). Pseudomonas Korean The experiment involved three treatments (using strain L158), with three biological replicates for each treatment (i.e., three seedling trays per treatment). The experiment lasted for 30 days, and the main observation indicators included root growth and seedling height.

[0055] The steps of the seedling raising experiment are as follows: A rice seedling substrate with a pH of 4.5 and the property of "forming a clump when squeezed in the hand but crumbling when dropped" was selected. This rice seedling substrate was purchased from Jilin Laibei Agricultural Technology Co., Ltd. Before seedling cultivation, the newly built greenhouse seedbeds must be leveled and compacted. The seedbeds must meet the standards of depth, levelness, straightness, dryness, cleanliness, compactness, and firmness. Among these, depth means a thawing depth of at least 30cm; levelness means a compactness of at least 10m². 2 The height difference of the inner bed surface should not exceed 0.5cm; Straight: The edges should be neat and consistent, and the brick path in the middle and around the edges should be straight, with an error of no more than 0.5cm per 10 linear meters; Dry: It should meet the dry soil standard for dry fields; Clean: The bed surface should be clean, free of stones with a diameter greater than 0.5cm, and free of grass roots or other debris with a length greater than 5cm; Crushed: The soil on the bed surface should be finely crushed, with no soil clods with a diameter greater than 0.5cm; Firm: The top layer should be firm while the bottom layer should be loose, with a consistent level of firmness, and no footprints when stepped on. Choose sunny weather to sun-dry rice seeds in batches for 3 days to improve seed germination vigor and kill pathogens on the seed surface, thus obtaining sun-dried rice seeds. The sun-dried rice seeds were coated with a seed coating agent (the total concentration of methyl methacrylate and fludioxonil in the seed coating agent was 63 g / L). After coating, the seeds were air-dried for 3 days. After the seed coating agent solidified, the coated rice seeds were obtained and stored in bags for soaking. The ratio of compound fungicide to sun-dried rice seeds was 300 g: 100 kg. To prevent bakanae disease, coated rice seeds were soaked in batches using Mengxiu. The soaking time for each batch was 7 days, with a total accumulated temperature of 100℃, to obtain soaked rice seeds. Apply fungicide and mole cricket repellent to the seedbed, and then lay a mesh cloth on the seedbed; Sowing (April 10): Place the rice seedling substrate in the seedling tray, place the seedling tray on the seedbed (the seedling tray is above the mesh cloth), and sow the soaked rice seeds evenly into the rice seedling substrate. After sowing, water the seedling tray thoroughly and ensure that there is no water accumulation in the seedbed. Cover the seedling tray with non-woven cloth. Emergence (April 15): After rice seedlings emerge, wait for them to stand upright. Once the seedlings have stood upright, remove the non-woven fabric. If the seedlings turn yellow, apply an appropriate amount of nitrogen fertilizer (urea) at a rate of 30g / m². 2 After fertilizing, wash the seedlings with clean water. After the seedlings emerge, water them in the morning when there is no water leakage or when they wilt or clump together after sunrise. Water each tray of rice with 1.0L of water to ensure that the moisture content of the rice seedling substrate is 70%~80% and there is no water accumulation. After watering, ventilate normally. To control damping-off disease in rice at the 1.5-leaf and 2.5-leaf stages, spray the rice with hymexazol (31% active ingredient content) and cyazofamid (30% active ingredient content). After application, rinse with clean water. Use 0.5L of clean water per rice tray. When the rice seedlings reach the 3-leaf stage, the amount of watering needs to be increased to 1.5L per tray of rice. Keep the rice seedling substrate moist and ensure normal ventilation after watering. First application of fungicide (April 29): [The text abruptly ends here, likely due to an incomplete sentence or missing information.] Pseudomonas koreensis L158 bacterial solution was sprayed onto 200 trays of rice in the second treatment group, and Bacillus pumilu bacterial solution was sprayed onto 200 trays of rice in the first treatment group. The control group was not inoculated with microorganisms. Second application of fungicide (May 12): Pseudomonas koreensis L158 bacterial solution was sprayed onto 200 trays of rice in the second treatment group, and Bacillus pumilu bacterial solution was sprayed onto 200 trays of rice in the first treatment group. The control group was not inoculated with microorganisms. One week before transplanting (when the seedlings have been cultivated), ventilate and harden the seedlings daily from 5:30 to 7:00 to ensure that there is no dripping water or obvious humidity inside the greenhouse; Five days before transplanting, apply a top dressing of ammonium sulfate (for the purpose of transplanting), at a rate of 50g / m². 2 ; After the rice seedlings were cultivated, root growth indicators such as seedling height and root length were measured, and phenotypic photos of the seedling population were taken. The results are as follows: Seedling height results are as follows: Figure 11 As shown, by Figure 11 It was found that the plant height (seedling height) of rice seedlings in the second treatment group was significantly increased compared with that in the control group (P=0.037).

[0056] The root length of rice seedlings is as follows Figure 12 As shown, by Figure 12 It was found that the root length of rice seedlings in the second treatment group was significantly increased (P=2.2e-06).

[0057] Phenotypic photos of rice seedlings, as shown Figure 13 As shown, by Figure 13 Know, vaccination Pseudomonas koreensis The seedling population of L158 visually exhibits characteristics of well-developed root system, strong stems and green leaves.

[0058] comprehensive Figure 11 , Figure 12 and Figure 13 It is known that, compared with the control group and the first treatment group of the model strain B. pumilus, inoculation with strain L158 showed a significant growth-promoting effect on rice seedlings, and this indicates that... Pseudomonas koreensisWith its balanced and efficient phosphorus-solubilizing, potassium-solubilizing, and growth-promoting substance secretion activities, strain L158 can improve the quality of rice seedlings and cultivate robust seedlings with "well-developed root systems, strong stems, and green leaves," demonstrating extremely broad application prospects in the development of rice microbial agents.

[0059] 2. Field direct seeding experiment In Example 1 Pseudomonas koreensis L158 was inoculated into LB liquid medium for activation and cultured with shaking at 30℃ and 180 r / min for 24 h to obtain... Pseudomonas koreensis L158 strain seed liquid Pseudomonas koreensis The concentration of viable bacteria in the seed culture of strain L158 was 1.5 × 10⁻⁶. 9 CFU / mL; to 500mL Pseudomonas koreensis Add 20L of water and 8mL of organosilicon adjuvant to the seed culture of strain L158 to obtain... Pseudomonas koreensis L158 bacterial agent.

[0060] The experimental area is located in Lianshan Village, Daixi Town, Wuxing District, Huzhou City. Geographical coordinates: Longitude: 119.989°; Latitude: 30.629°; Altitude: 20.6 meters; Demonstration area: 600 mu (approximately 40 hectares); Previous non-grain use type: This experimental area was originally a nursery, but the topsoil was lost due to mechanical leveling operations, resulting in non-grain soil. Soil conditions: The soil type is sandy yellow clay paddy field (paddy field). It is a typical "non-grain" remediated paddy field with extremely low fertility. Testing showed that its soil organic matter was only 7.33 g / kg, total nitrogen 0.57 g / kg, available nitrogen 6.4 mg / kg, available phosphorus 4.8 mg / kg, and available potassium 54.6 mg / kg.

[0061] The experimental area was divided into a control group (no microorganisms inoculated) and a second treatment group (inoculated). Pseudomonas Korean L158 strain), each group requires 20 mu of land; The specific steps of the direct seeding experiment in the field are as follows: Direct seeding was employed, with rice seeds of the variety "Jiayou 9370" sown directly into the experimental area. Fertilizer management was conducted according to Huzhou City local standard DB3305 / T 152-2020 "Technical Specifications for Single-Season Rice One-Time Fertilization," water management according to DB33 / T 992-2015 "Technical Specifications for Direct-Seeded Rice Production," and pest and disease control for rice planthoppers, rice leaf rollers, and sheath blight was carried out according to Huzhou City local standard DB3305 / T 175-2020 "Technical Specifications for Green Pest Control in Rice." On the 8th day after direct seeding (excluding the day of direct seeding), a spray was applied to the rice in the second treatment group. Pseudomonas koreensis L158 microbial agent, application rate is 5L / mu.

[0062] Data on rice false smut in the control group and the second treatment group were measured one month before rice harvest: Three survey plots were randomly set up in the fields of the second treatment group and the control group. Each plot in the second treatment group continuously surveyed 145 rice clumps, with a total of 650 panicles. Each plot in the control group continuously surveyed 141 rice clumps, with a total of 619 panicles. The presence of rice false smut fungal balls on a panicle indicated disease. Rice clumps containing diseased panicles were considered diseased clumps. The number of surveyed clumps, the number of diseased clumps, the number of surveyed panicles, and the number of diseased panicles were recorded. The disease clump rate was calculated using formula (II), and the diseased panicle rate was calculated using formula (III). Cluster incidence rate (%) = Number of clusters / Number of clusters surveyed 100% (II) Disease incidence rate (%) = Number of diseased ears / Number of ears surveyed 100% (III) The disease incidence of rice false smut is shown in Table 1 and... Figure 14 As shown.

[0063] Table 1. Disease incidence of rice false smut.

[0064] From Table 1 and Figure 14 It is known that, compared with the uninoculated treatment, the incidence of disease clusters in rice after inoculation with strain L158 decreased from 32.62% to 19.31%, and the incidence of diseased panicles decreased from 12.78% to 5.22%.

[0065] To scientifically control rice false smut and facilitate field surveys and disease assessment, a grading standard for rice false smut is established based on the number of fungal balls per panicle: Grade 0 indicates no disease, meaning no fungal balls are found on the rice; Grade 1 indicates 1 fungal ball; Grade 2 indicates 2-5 fungal balls; Grade 3 indicates 6-10 fungal balls; Grade 4 indicates 11-15 fungal balls; and Grade 5 indicates 16 or more fungal balls. The disease index is calculated using the formula shown in equation (IV): Disease index = (IV) In equation (IV), The number of ears with disease at level i. Let N be the representative value of the i-th level of the disease, and N be the number of ears of grain surveyed. The value of i can be 0, 1, 2, 3, 4 or 5.

[0066] The results of the percentage of occurrence levels of rice false smut are shown in Table 2 and Figure 15 As shown.

[0067] Table 2. Percentage of Rice False Fissure Occurrence Levels

[0068] The disease severity index is divided into five levels: none, mild, moderate, severe, and extremely severe, based on scores of 0, 0.1–5.0, 5.1–15.0, 15.1–30.0, and >30.0. (See Table 2 and...) Figure 15 It is known that the incidence of rice false smut has decreased from moderate to mild.

[0069] At the rice maturity stage (see actual photos of rice at maturity) Figure 16 (As shown), rice was harvested and the rice grain yield was measured: Following the rice yield measurement method, three representative points were selected in the fields of both the second treatment group and the control group for small-scale manual harvesting and yield measurement. The total harvested area of ​​the three points in the second treatment group was 26.29 square meters, and the total harvested area of ​​the three points in the control group was 13.95 square meters. After harvesting, the rice was spread out to dry, threshed, impurities removed, weighed, and its moisture content measured. In the second treatment group, the wet grain weight was 26.4 kg, with a moisture content of 27.2%. Converted to a standard moisture content of 14.5%, the dry grain weight was 22.48 kg, translating to a yield of 570.1 kg / mu. In the control group, the wet grain weight was 13.8 kg, with a moisture content of 30.1%. Converted to a standard moisture content of 14.5%, the dry grain weight was 11.28 kg, translating to a yield of 539.1 kg / mu. The second treatment group yielded 5.75% more than the control group. Therefore, it can be concluded that… Pseudomonas koreensis Inoculation with strain L158 further increased rice grain yield, with a 5.75% increase compared to the control group. On a per-unit-area basis, this yield increase is approximately equivalent to an additional 465 kg / ha of grain output. Based on current global rice market prices, this translates to an economic benefit of approximately US$181 / ha.

[0070] Depend on Figure 14 , Figure 15 and Figure 16 It is known that in field trials, Pseudomonas koreensis Inoculation with strain L158 can reduce the incidence of rice false smut and increase rice grain yield.

[0071] In conclusion, Pseudomonas koreensis Strain L158 not only exhibits growth-promoting potential under field conditions but also shows some inhibitory effect on rice diseases. Consistent with the reduction in disease incidence, Pseudomonas koreensis Inoculation with strain L158 also increased rice plant height and maintained high root vigor throughout the field growing season. These results indicate that strain L158 exhibits good growth-promoting, disease-resistant, and yield-increasing potential at different developmental stages and under complex field conditions.

[0072] In summary, this invention provides this strain of Pseudomonas aeruginosa, its isolation and screening method, and its application, which have the following advantages: The Korean Pseudomonas strain provided by this invention Pseudomonas koreensis L158, possessing multiple metabolic pathways, overcomes the limitations of single functions: in soil nutrient activation, it exhibits extremely strong dual organic / inorganic phosphorus-solubilizing ability (inorganic phosphorus release up to 139.240 mg / L) and potassium-solubilizing activity (promoting the decomposition of insoluble potassium minerals and increasing available potassium content); in physiological regulation and stress buffering, it can efficiently synthesize multiple functional metabolites (IAA secretion up to 25.240 μg / mL, gibberellin secretion up to 15.313 μg / mL, and siderophore activity up to 66.953%). This strain forms a multi-synergistic growth-promoting mechanism involving soil nutrient activation, crop development signal activation, and rhizosphere microenvironment stress buffering, enabling it to comprehensively and multidimensionally reshape the crop rhizosphere microecology. Meanwhile, this invention provides a *Pseudomonas aeruginosa* strain from Korea. Pseudomonas koreensis L158 can still achieve rapid, efficient and stable rhizosphere colonization in complex field habitats such as degraded farmland, acidified soil, and soil with continuous cropping obstacles, as well as rapidly, efficiently and stably promote the reconstruction of rhizosphere microecology. It has an extremely stable effect on rice seedling growth, aboveground biomass accumulation and final yield, and has successfully overcome the common industry problem of the degradation of the effect of growth-promoting bacteria from the laboratory to the field.

[0073] This invention, based on FACS-iChip high-throughput in-situ culture technology, overcomes the limitations of traditional culture methods in obtaining and culturing microorganisms, deeply exploring and reconstructing soil microbial "dark matter" resources ("dark matter" refers to microbial groups in the environment that can be detected by molecular means but are difficult to obtain in live pure cultures using traditional culture methods). Traditional culture methods can only isolate a very small proportion of conventional microorganisms, limiting the discovery of highly efficient functional strains. This invention develops and integrates FACS-iChip high-throughput in-situ culture technology based on flow cytometry sorting, precisely implanting single active soil microorganisms into in-situ simulated habitats. This achieves large-scale, high-throughput, in-situ precise capture and purification culture of complex soil microbial resources, providing a core material basis for subsequent targeted breeding of native original functional strains with excellent ecological adaptability.

Claims

1. A strain of *Pseudomonas kwangsiensis*, characterized by: The Korean Pseudomonas is Pseudomonas koreensis L158, the aforementioned Pseudomonas koreensis L158 is deposited at the China Center for Type Culture Collection, accession number: CCTCC NO: M 2026392.

2. The method for isolating and screening *Pseudomonas aeruginosa* as described in claim 1, characterized in that, Includes the following steps: S1. Prepare a rhizosphere microbial suspension; S2. Using FACS-iChip in situ culture technology, Pseudomonas koreanum was isolated and screened from rhizosphere microbial suspension.

3. The separation and screening method according to claim 2, characterized in that, The separation and screening method specifically includes the following steps: S1. Mix the soil and PBS buffer, centrifuge, collect the supernatant, filter, and obtain a rhizosphere microbial suspension. S2. Add thiazolium orange solution and propidium iodide solution to the rhizosphere microbial suspension, incubate in the dark, and obtain a labeled rhizosphere microbial suspension. Individual viable microorganisms that are thiazole orange positive and propidium iodide negative were isolated from the labeled rhizosphere microbial suspension. A single live microorganism is placed in a single well of the isolation chip, culture medium is added, and the isolation chip is sealed to obtain a sealed isolation chip. Rice was planted in root boxes filled with rice soil and kept submerged. When the rice reached the heading stage, the sealed isolation chip was buried in the rice rhizosphere soil for in-situ culture to obtain the cultured isolation chip. Single colonies were picked from the cultured isolation chip and inoculated into the culture medium and cultured to the logarithmic phase to obtain the fermentation broth; The fermentation broth was tested to obtain the growth-promoting functional indicators of the strains, and Pseudomonas aeruginosa was obtained by screening based on the growth-promoting functional indicators.

4. The separation and screening method according to claim 3, characterized in that, In S1: the ratio of soil to PBS buffer is 1g:10mL; In S2: The incubation in the dark was carried out at room temperature for 15 minutes. The volume ratio of the rhizosphere microbial suspension, thiazole orange solution, and propidium iodide solution is 100:1:

1. In each well of the isolation chip, the amount of culture medium is 50% of the volume of a single well; The flooding conditions include: forming a shallow water layer of 2-3 cm on the soil surface; The in situ culture was conducted at a temperature of 28°C for 4 weeks. The culture medium is LB liquid medium.

5. The separation and screening method according to claim 3, characterized in that, The indicators of reproductive function include IAA secretion, gibberellin secretion, phosphorus solubility, and siderophore activity.

6. The separation and screening method according to claim 5, characterized in that, Korean Pseudomonas was obtained by screening based on the following criteria: IAA secretion greater than 5 mg / L, gibberellin secretion greater than 0.5 mg / L, phosphate solubility greater than 10 mg / L, and siderophore activity greater than 10%.

7. The application of *Pseudomonas aeruginosa* as described in claim 1 or *Pseudomonas aeruginosa* isolated by the isolation and screening method according to any one of claims 2 to 6 in crop cultivation and / or soil improvement.

8. The application according to claim 7, characterized in that, The crop in question is rice.

9. The use of *Pseudomonas aeruginosa* as described in claim 1 or *Pseudomonas aeruginosa* isolated by the isolation and screening method according to any one of claims 2 to 6 in at least one of crop growth promotion, disease resistance and yield increase.

10. The application according to claim 9, characterized in that, The crop growth promotion includes: promoting soil nutrient activation, promoting crop development signal activation, and promoting rhizosphere microenvironment stress buffering; The promotion of soil nutrient activation includes promoting the dissolution of inorganic phosphorus, the hydrolysis of organic phosphorus, and the decomposition of potassium minerals; The activation of crop development-promoting signals includes the promotion of IAA secretion and gibberellin secretion; The method of promoting the buffering of rhizosphere microenvironment stress includes enhancing siderophore activity; The disease resistance includes resistance to rice false smut.

Images