A preparation method of NKG2D-CAR-IL7-TIL for enhancing tumor killing activity

Abstract

The application provides an engineered tumor infiltrating lymphocyte (TIL) co-expressing a NKG2D chimeric antigen receptor (NKG2D-CAR) and interleukin-7 (IL-7). The NKG2D-CAR-IL7-TIL cell prepared by the application has a specific killing ability of targeting NKG2D ligand positive tumor cells, and at the same time, the cell proliferation and survival ability is enhanced through the sustained expression of the cell membrane combined IL-7, and the anti-tumor effect is significantly improved.

Description

Technical Field

[0001] This invention relates to the field of anti-tumor cell therapy technology, specifically to a method for preparing engineered tumor-infiltrating lymphocytes (NKG2D-CAR-IL7-TIL) and their application in tumor treatment. Background Technology

[0002] Traditional tumor-infiltrating lymphocyte (TIL) therapy suffers from numerous technical limitations, severely restricting its widespread clinical application. First, the in vitro expansion efficiency of TILs is extremely low, typically requiring 3-4 weeks to obtain the required number of cells for treatment, with limited expansion folds that fail to meet clinical needs. Second, both in vitro expansion and in vivo maintenance of TILs are highly dependent on the addition of high concentrations of exogenous interleukin-2 (IL-2). This not only leads to abnormal expansion of regulatory T cells, thus suppressing anti-tumor immune responses, but also causes life-threatening side effects such as capillary leakage syndrome and hypotension during reinfusion therapy due to the combined systemic administration of high-dose IL-2. Furthermore, while traditional TIL therapy exhibits tumor specificity, its recognition ability relies on the diversity of T cell receptors, making it difficult to achieve highly efficient targeting of specific tumor antigens. Additionally, the short survival time of reinfused cells in vivo hinders the formation of long-term anti-tumor immune memory.

[0003] While chimeric antigen receptor T-cell (CAR-T) technology can endow T cells with specific targeting capabilities, it still faces challenges in the treatment of solid tumors, such as tumor microenvironment suppression and insufficient T-cell infiltration. The persistence and therapeutic efficacy of traditional CAR-T cells in solid tumors are limited. Interleukin-7 (IL-7) possesses unique biological advantages, promoting T-cell proliferation without leading to regulatory T-cell expansion. It is particularly beneficial for the activation and survival of CD8+ T cells, significantly prolonging T-cell survival time in vivo. However, systemic administration of IL-7 still raises safety concerns. Summary of the Invention

[0004] The core innovation of this invention, NKG2D-CAR-IL7-TIL, lies in integrating the specific targeting capability of CAR, the natural tumor homing characteristics of TIL, and the survival-promoting function of IL-7 to form a synergistic therapeutic system. By introducing the NKG2D-CAR structure, TIL cells are not only endowed with the ability to precisely recognize and kill NKG2D ligand-positive tumor cells, but also significantly enhanced T cell activation intensity, overcoming the deficiency of insufficient targeting in traditional TIL therapy. This product uses genetic engineering technology to enable TIL cells to continuously express cell membrane-bound IL-7, achieving autocrine growth signal support and eliminating dependence on exogenous high-concentration IL-2. Cell membrane-bound IL-7 can exert its effects locally, avoiding the toxic reactions caused by systemic cytokine release, significantly improving treatment safety. Furthermore, flow cytometry is used to directly detect and sort NKG2D-CAR-IL7-TIL positive cells, ensuring high-purity, high-quality products. This innovative design fundamentally solves multiple technical bottlenecks in traditional TIL therapy in terms of expansion efficiency, targeting specificity, safety, and durability, providing a breakthrough solution for immunotherapy of solid tumors.

[0005] Therefore, the present invention provides an engineered tumor-infiltrating lymphocyte (TIL) that co-expresses NKG2D chimeric antigen receptor (NKG2D-CAR) and interleukin-7 (IL-7).

[0006] In some embodiments, the NKG2D-CAR includes an extracellular domain, a hinge region, a transmembrane domain, and an intracellular domain, wherein the intracellular domain includes a co-stimulatory domain and / or a signal transduction domain, and preferably the chimeric antigen receptor further includes a signal peptide, a small molecule tag (preferably Strep II), a self-cleaving peptide, or a combination thereof.

[0007] In some implementations, the hinge region is derived from the hinge of IgG or the extracellular region of CD8α / CD28.

[0008] In some implementations, the transmembrane domain is derived from CD4, CD8α, CD28, or CD3ζ.

[0009] In some implementations, the co-stimulatory domain is derived from the CD28 receptor family (CD28, ICOS) or the tumor necrosis factor receptor family (4-1BB, OX40, CD27).

[0010] In some embodiments, the signal transduction domain is the T cell receptor TCR / CD3ζ chain or the immunoglobulin Fc receptor FcεRIγ chain.

[0011] In a preferred embodiment, the NKG2D-CAR includes the human NKG2D extracellular domain (amino acid residues 78-216), CD8α hinge region, CD28 transmembrane region, intracellular signaling domain, and CD3ζ signaling domain.

[0012] In some embodiments, the amino acid sequence of the NKG2D-CAR is encoded by SEQ ID No. 1; and / or the amino acid sequence of the IL-7 is encoded by SEQ ID No. 2.

[0013] The NKG2D-CAR sequence is shown in SEQ ID No. 1: The IL7 sequence is shown in SEQ ID No. 2: ATGGCCCTGCCTGTGACCGCTCTGCTGCTGCCTCTTGCTCTGCTGCTGCATGCTGCTAGACCTGATTGCGACATTGAGGGCAAAGACGGCAAGCAGTACGAGAGCGTGCTGATGGTGAGCATCGACCAGCTGCTGGACAGCATGAAGGAGATCGGCAGCAACTGCCTGAACAACGAGTTCAAC TTCTTCAAGAGACACATCTGCGACGCCAACAAGGAGGGCATGTTCCTGTTCAGAGCCGCCAGAAAGCTGAGACAGTTCCTGAAGATGAACAGCACCGGCGACTTCGACCTGCACCTGCTGAAAGTGAGCGAGGGCACAACAATCCTGCTGAACTGCACCGGCCAGGTGAAGGGCAGAAAACCC GCTGCTCTGGGAGAAGCCCAACCCACAAAAAGCCTGGAGGAAAATAAGAGCCTGAAGGAGCAGAAGAAGCTGAACGACCTGTGCTTCCTGAAGAGACTGCTGCAGGAGATCAAGACCTGCTGGAACAAGATCCTGATGGGCACCAAGGAGCACACCACCACCCCTGCTCCTAGACCTCCTACA CCTGCTCCTACAATTGCCAGCCAGCCCCTGTCTCTGAGGCCCGAAGCCTGTAGACCTGCTGCTGGAGGCGCTGTGCATACAAGAGGACTGGATTTCGCCTGCGACATCTACATCTGGGCCCCCCTGGCTGGAACATGTGGAGTGCTTCTGCTGAGCCTGGTGATTACACTGTACTGCTGATAA (732 bp) In some implementations, the NKG2D-CAR and IL-7 are directly connected (fused expression) or connected via a connector.

[0014] In some embodiments, the connector includes a self-cleaving peptide, preferably including P2A, T2A, E2A, and F2A, with P2A being the most preferred.

[0015] In some implementations, the engineered tumor-infiltrating lymphocytes express the sequence shown in SEQ ID No. 3.

[0016] The NKG2D-CAR-IL7 fusion sequence is shown in SEQ ID No. 3: In some implementations, the engineered TIL is derived from an NKG2D ligand-positive tumor. The NKG2D ligand may be selected from the group consisting of MICA, MICB, ULBP1, ULBP2, ULBP3, ULBP4, ULBP5, and ULBP6.

[0017] In some implementations, the engineered TIL is derived from NKG2D ligand-positive tumors, preferably hematologic malignancies and solid tumors, including lung cancer, liver cancer, colorectal cancer, breast cancer, gastric cancer, ovarian cancer, osteosarcoma, pancreatic cancer, prostate cancer, melanoma, glioma / glioblastoma, bladder cancer, cervical cancer, esophageal cancer, head and neck squamous cell carcinoma, kidney cancer, endometrial cancer, and acute myeloid leukemia (AML).

[0018] In some implementations, the engineered tumor-infiltrating lymphocytes co-express NKG2D-CAR and IL-7 via vectors selected from the following: lentiviral vectors, transposon vectors, retroviral vectors, DNA vectors, plasmids, RNA vectors, adenovirus vectors, adenovirus-associated vectors, and the CRISPR / Cas9 system.

[0019] In a preferred embodiment, the engineered tumor-infiltrating lymphocytes co-express NKG2D-CAR and IL-7 via a lentiviral vector.

[0020] Another aspect of the present invention provides a method for preparing engineered tumor-infiltrating lymphocytes according to the present invention, comprising the following steps: (1) Prepare a recombinant lentivirus containing a target gene, wherein the target gene contains a nucleic acid sequence encoding an NKG2D chimeric antigen receptor (NKG2D-CAR) and a nucleic acid sequence encoding interleukin-7 (IL-7); (2) Tumor-infiltrating lymphocytes (TILs) were isolated from tumor tissue and cultured in a medium containing interleukin-2 (IL-2) until the logarithmic growth phase; (3) Transfect the recombinant lentivirus obtained in step (1) into TIL cells cultured in step (2) in the logarithmic growth phase; (4) Use flow cytometry to sort a double-positive cell population that simultaneously expresses NKG2D-CAR and IL-7; (5) The double-positive cell population obtained in step (4) is expanded and cultured in an amplification medium containing IL-2 and interleukin-10 (IL-10) to obtain the engineered tumor-infiltrating lymphocytes.

[0021] In some embodiments, the concentration of IL-2 in the culture medium is from 100 to 10,000 IU / mL (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, or 10000 IU / mL), and / or the concentration of IL-10 is from 100 to 10,000 IU / mL. ng / mL (e.g., 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1500, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000 or 10000 ng / mL).

[0022] In a preferred embodiment, the sorted double-positive cells are expanded and cultured in a culture medium containing 1000 IU / mL IL-2 and 3200 ng / mL IL-10.

[0023] In another aspect, the present invention provides the use of engineered tumor-infiltrating lymphocytes according to the present invention or engineered tumor-infiltrating lymphocytes prepared by the method of the present invention in the preparation of antitumor drugs.

[0024] In a preferred embodiment, the antitumor drug is a drug targeting the following NKG2D ligand-positive tumors: hematologic malignancies and solid tumors, including lung cancer, liver cancer, colorectal cancer, breast cancer, gastric cancer, ovarian cancer, osteosarcoma, pancreatic cancer, prostate cancer, melanoma, glioma / glioblastoma, bladder cancer, cervical cancer, esophageal cancer, head and neck squamous cell carcinoma, kidney cancer, endometrial cancer, and acute myeloid leukemia (AML).

[0025] The NKG2D-CAR-IL7-TIL cells prepared by this invention have the ability to specifically kill NKG2D ligand-positive tumor cells. At the same time, the continuous expression of cell membrane-bound IL-7 synergistically enhances cell proliferation and survival, significantly improving the anti-tumor effect. Attached Figure Description

[0026] Figure 1 Image showing the ELISA results of IL-7 secreted by TIL, a transgenic liver cancer cell source. Figure 2 Number of TIL cells obtained by different culture methods; Figure 3 The fold expansion of TIL cells obtained by different culture methods; Figure 4 Figures showing the results of TIL killing target cells obtained by different culture methods; Figure 5 Image showing the ELISA results of IL-7 secreted by transgenic TILs derived from colorectal cancer; Figure 6 Number of TIL cells obtained by different culture methods; Figure 7 The fold expansion of TIL cells obtained by different culture methods; Figure 8 The results of TIL killing target cells obtained by different culture methods are shown in the figure. Detailed Implementation

[0027] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0028] Unless otherwise indicated, the terms used herein have their general technical meanings as understood by those skilled in the art.

[0029] In this invention, the singular articles “a” and “the” cover a plurality of indicators unless the context clearly indicates otherwise. All references cited herein are incorporated herein by reference in their entirety.

[0030] The use of "comprising" or "including" in this invention is an open-ended description that includes all specified components or steps described, as well as other specified components or steps that do not materially affect the description.

[0031] The term "and / or" as used in this invention encompasses all combinations of items connected by the term, and should be considered as if each combination had been individually listed herein. For example, "A and / or B" includes "A", "A and B", and "B". As another example, "A, B and / or C" includes "A", "B", "C", "A and B", "A and C", "B and C", and "A and B and C".

[0032] As used in this article, the term "CRISPR / Cas9 system" is a commonly used and highly efficient gene editing technology consisting of the Cas9 endonuclease and sgRNA (guide RNA). The sgRNA specifically recognizes the target gene sequence, guiding Cas9 to cut the DNA double strand, inducing non-homologous end joining (NHEJ) or homologous recombination (HDR) in the cell, thereby achieving gene knockout, insertion, or site-directed mutation.

[0033] As used herein, the term "chimeric antigen receptor (CAR)" is a protein that specifically recognizes a target antigen, such as a target antigen on a cancer cell. When bound to a target antigen, a CAR can activate immune cells to attack and destroy cells carrying that antigen (such as cancer cells). CARs can also incorporate costimulatory or signal transduction domains to increase their potency. Typically, chimeric antigen receptors contain extracellular, transmembrane, and intracellular domains.

[0034] As used in this article, the term "NKG2D" refers to a member of the C-type lectin-like receptor family encoded by the Klrk1 gene, primarily expressed on the surface of natural killer cells (NK cells), NKT cells, and some γδT cells. This molecule plays a crucial role in the clearance of infected or cancerous cells by recognizing MICA, MICB, and ULBP-1 to ULBP-6 family ligands. NKG2D ligands are expressed in various tumor types, including pancreatic cancer, gastric cancer, bladder cancer, cervical cancer, esophageal cancer, head and neck squamous cell carcinoma, and acute myeloid leukemia (AML), among other hematologic malignancies and solid tumors.

[0035] Tumor-infiltrating lymphocytes (TILs), as a personalized adoptive cell transfer therapy (ACT), have shown great clinical potential in the treatment of solid tumors. However, traditional TIL therapy is limited by multiple factors: on the one hand, traditional methods rely on high concentrations of IL-2 for in vitro expansion and in vivo maintenance of T cell function, which can easily cause severe systemic toxicity and may lead to T cell exhaustion and functional suppression; on the other hand, natural TILs have weak targeting and insufficient survival ability in the tumor microenvironment, making it difficult to further improve their persistence and anti-tumor efficacy in vivo, thus limiting their efficacy and widespread application. To further improve the targeting, expansion efficiency, and anti-tumor effect of TILs, this invention proposes a novel method for preparing NKG2D-CAR-IL7-TIL.

[0036] The NKG2D-CAR-IL7-TIL is a genetically engineered process that introduces a chimeric antigen receptor (CAR) targeting the NKG2D ligand and the interleukin-7 (IL-7) gene into tumor-infiltrating lymphocytes. The NKG2D-CAR enables specific recognition and killing of tumor cells expressing the NKG2D ligand in the tumor microenvironment, while membrane-bound IL-7 is constitutively expressed and continuously secreted, providing autocrine proliferation signals to TIL cells. This synergistic effect with continuously added low-dose exogenous IL-2 promotes cell proliferation.

[0037] Specifically, the preparation method of the present invention includes the following steps: 1) Prepare a recombinant lentivirus containing the target gene, wherein the target gene includes the NKG2D-CAR sequence and the constitutively expressed IL-7 sequence; 2) Isolate infiltrating lymphocytes from tumor tissue, add IL-2, and culture the cells to the logarithmic growth phase; 3) The recombinant lentivirus was added to infiltrating lymphocytes in the logarithmic growth phase. After culturing for 2-4 days, the cells were collected and subjected to double labeling staining with NKG2D and IL-7 flow cytometry antibodies. 4) Use flow cytometry to sort NKG2D-CAR and IL-7 double-positive cell populations to ensure that functional transgenic TIL cells are obtained; 5) The sorted double-positive cells were expanded and cultured under the conditions of 1000 IU / mL IL-2 and 3200 ng / mL IL-10. The multiple signal synergistic effects of exogenous IL-2, IL-7 secreted by the cell's own constitutive type and exogenous IL-10 were utilized to achieve efficient expansion and functional maintenance of TIL cells.

[0038] The key innovative highlights of this invention include at least two points: First, NKG2D, as an activating receptor, can recognize multiple stress-inducible ligands (such as the MICA, MICB, and ULBP families) highly expressed on the surface of most epithelial-derived tumor cells (such as lung cancer, liver cancer, colorectal cancer, breast cancer, gastric cancer, and ovarian cancer), giving NKG2D-CAR-TIL a broad-spectrum anti-tumor ability, overcoming the limitation of traditional CAR-T cells that only target a single antigen, and significantly expanding its applicability. Second, an optimized cytokine combination culture strategy: after obtaining a double-positive cell population through flow cytometry, a synergistic culture protocol of IL-2 and IL-10 is used in the subsequent expansion culture stage. Specifically, a low concentration of 1000 IU / mL of IL-2 is continuously added to maintain the basic proliferation signal of T cells, while 3200 ng / mL of IL-10 is innovatively added to maintain their survival ability. This culture protocol significantly enhances the adaptability and survival ability of TIL cells in the immunosuppressive tumor microenvironment while ensuring rapid cell expansion.

[0039] This invention introduces an NKG2D-CAR structure, enabling TILs to specifically recognize and kill various epithelial-derived tumor cells with high NKG2D ligand expression, such as liver cancer and colorectal cancer. A flow cytometry-based double-positive cell screening system ensures functional consistency of the final product cells. Furthermore, a synergistic culture strategy combining IL-2, autocrine cell membrane-bound IL-7, and IL-10 significantly enhances T cell survival and anti-tumor function while maintaining cell proliferation efficiency.

[0040] The NKG2D-CAR-IL7-TIL cells prepared by the method provided in this invention exhibit 5-10 times higher in vitro expansion efficiency compared to traditional methods and demonstrate stronger tumor-targeting killing activity. During reinfusion therapy, the required IL-2 infusion dose is significantly reduced, alleviating treatment-related toxicity and improving clinical safety.

[0041] In a further preferred embodiment of the present invention, the NKG2D-CAR sequence includes an extracellular domain, a transmembrane region, and an intracellular signaling domain (such as CD3ζ and co-stimulatory molecules CD28 or 4-1BB), and the IL-7 sequence is a codon-optimized sequence. The recombinant lentivirus is prepared by cloning the target gene into a lentiviral vector and transfecting it into HEK-293T cells.

[0042] This invention also covers the use of the NKG2D-CAR-IL7-TIL in the preparation of anti-NKG2D ligand-positive tumor therapeutic drugs.

[0043] Through the above methods, this invention not only significantly improves the targeting and killing power of TILs, but also ensures the functional uniformity of cell products through an innovative double-positive flow cytometry sorting system. Combined with a culture strategy of continuous IL-2 supply, cell membrane-bound IL-7 autocrine secretion, and IL-10 synergy, it provides a new generation of efficient, safe, and highly adaptable and durable solutions for adoptive cell therapy of solid tumors.

[0044] Preferably, the NKG2D-CAR sequence is shown in SEQ ID No:1; the IL7 sequence is shown in SEQ ID No:2; and the NKG2D-CAR-IL7 fusion sequence is shown in SEQ ID No:3.

[0045] In practical applications, the constructed NKG2D-CAR-P2A-IL7 fusion expression sequence was systematically optimized: using the well-known NKG2D-CAR sequence as the molecular basis, a P2A self-cleaving peptide linker was used to link it to a codon-optimized IL-7 sequence. The codon optimization of the IL-7 sequence included, but was not limited to: adopting human codon usage preferences, adjusting the GC content to a suitable level, constructing a stable mRNA secondary structure, eliminating repetitive sequences, cryptic splicing sites, and unnecessary restriction enzyme sites, while preventing the depletion of the cellular tRNA library. Specifically, the introduction of the P2A linker enabled efficient dissociation of NKG2D-CAR and IL-7 at the translational level, ensuring that both functional proteins could fold independently and correctly and maintain their complete biological activity. Through this optimized design, the co-expression efficiency of NKG2D-CAR and IL-7 in TIL cells was significantly improved, laying a solid foundation for obtaining high-quality double-positive cell products.

[0046] The present invention further proposes that the recombinant lentivirus in step 1) is prepared by the following method: obtaining and optimizing the synthesis of NKG2D-CAR sequence, IL7 sequence and NKG2D-CAR-IL7 fusion sequence, inserting the sequences into a lentiviral vector, then transfecting HEK-293T cells for virus preparation and amplification, and obtaining recombinant lentivirus after culture.

[0047] The present invention further proposes that, in step 2), cell culture is carried out in a culture environment coated with recombinant human fibrin and CD3 antibody.

[0048] Furthermore, in step 3), when the recombinant lentivirus is added to infiltrating lymphocytes cultured in the logarithmic growth phase, polybrene is added simultaneously, which can significantly improve the infection efficiency of retroviruses on cells.

[0049] This invention provides a preferred embodiment, the preparation method of which includes the following steps: 1) Preparation of recombinant lentivirus containing the target gene: wherein the target gene includes the NKG2D-CAR sequence, the IL7 sequence and the NKG2D-CAR-IL7 fusion sequence; Specifically, the process involves obtaining and optimizing the synthesis of the NKG2D-CAR sequence, IL7 sequence, and NKG2D-CAR-IL7 fusion sequence, ligating these sequences into a lentiviral vector, transfecting HEK-293T cells for virus preparation and amplification, and then culturing the cells to obtain recombinant lentivirus. The NKG2D-CAR sequence can be based on a known functional NKG2D-CAR sequence. Codon optimization of the IL-7 sequence includes, but is not limited to: adopting human codon usage preferences, adjusting the GC content appropriately, constructing a stable mRNA secondary structure, eliminating repetitive sequences, hidden splicing sites, and unnecessary restriction enzyme sites, while preventing the depletion of the tRNA library in the cell.

[0050] Preferably, the NKG2D-CAR sequence is shown in SEQ ID No:1; the IL7 sequence is shown in SEQ ID No:2; and the NKG2D-CAR-IL7 fusion sequence is shown in SEQ ID No:3.

[0051] 2) After digesting the tumor tissue, a single-cell suspension containing infiltrating lymphocytes was obtained; the cultured single-cell suspension was treated with IL-2 to isolate and purify tumor-infiltrating lymphocytes; then, IL-2 was added to the purified infiltrating lymphocytes in a culture environment coated with recombinant human fibrin and CD3 antibody, and the cells were cultured until they reached the logarithmic growth phase; 3) The recombinant lentivirus was added to infiltrating lymphocytes in the logarithmic growth phase, and Polybrene was added at the same time. After culturing for 2-4 days, the cells were collected and double-labeled with NKG2D and IL-7 flow cytometry antibodies. 4) Use flow cytometry to sort NKG2D-CAR and IL-7 double-positive cell populations to ensure that functional transgenic TIL cells are obtained; 5) The sorted double-positive cells were expanded and cultured under conditions containing IL-2 and 3200 ng / mL IL-10. The multiple signaling synergistic effects of exogenous IL-2, constitutively secreted IL-7 and exogenous IL-10 were utilized to achieve efficient expansion and functional maintenance of TIL cells.

[0052] Furthermore, the present invention proposes that the tumor tissue is selected from lung tumor tissue and intestinal tumor tissue.

[0053] The preparation method provided by this invention can be widely used in the preparation of antitumor therapeutic agents.

[0054] The preparation method provided by this invention involves isolating infiltrating lymphocytes from tumor tissue, seeding them into culture dishes coated with recombinant human fibrin and CD3 antibodies, adding IL-2, culturing to the logarithmic growth phase, and then stably transfecting TIL cells with lentivirus containing the NKG2D-CAR-P2A-IL7 fusion gene. After culturing for approximately 72 hours, double-positive cell sorting using NKG2D and IL-7 flow cytometry antibodies is performed to obtain functionally intact NKG2D-CAR-IL7-TIL cells. The sorted cells are further expanded and cultured under conditions containing IL-2 and IL-10, and harvested after reaching a certain fold increase. This method endows TIL cells with specific targeted killing ability through NKG2D-CAR, while providing autocrine growth signals through constitutive expression of IL-7, reducing dependence on exogenous high concentrations of IL-2 in the later stages of culture; it also reduces the number of cells to be reinfused. When TIL is reinfused into patients, the infusion of high-dose IL-2 can also be reduced. Only an appropriate concentration of IL-2 needs to be maintained to support cell proliferation and activity in the body, effectively avoiding the systemic toxicity of high-concentration IL-2 infusion. In addition, the membrane-bound IL-7 used in this invention can exert its effects locally, avoiding the toxic reactions caused by the release of systemic cytokines, and significantly improving the safety of treatment.

[0055] In a preferred embodiment, the present invention provides a method for preparing NKG2D-CAR-IL7-TIL with enhanced tumor-killing activity, as detailed below: 1) Preparation of recombinant lentiviruses containing the target gene: Specifically, the NKG2D-CAR sequence, IL7 sequence, and NKG2D-CAR-IL7 fusion sequence were obtained and optimized, the sequences were ligated into a lentiviral vector, and then transfected into HEK-293T cells for virus preparation and amplification. After culture, recombinant lentivirus was obtained. The NKG2D-CAR sequence is shown in SEQ ID No:1; the IL7 sequence is shown in SEQ ID No:2; and the NKG2D-CAR-IL7 fusion sequence is shown in SEQ ID No:3.

[0056] 2) After digesting the tumor tissue, a single-cell suspension containing infiltrating lymphocytes was obtained; the cultured single-cell suspension was treated with IL-2 to isolate and purify tumor-infiltrating lymphocytes; then, IL-2 was added to the purified infiltrating lymphocytes in a culture environment coated with recombinant human fibrin and CD3 antibody, and the cells were cultured until they reached the logarithmic growth phase; 3) The recombinant lentivirus was added to infiltrating lymphocytes in the logarithmic growth phase, and Polybrene was added at the same time. After culturing for 2-4 days, the cells were collected and double-labeled with NKG2D and IL-7 flow cytometry antibodies. 4) Use flow cytometry to sort NKG2D-CAR and IL-7 double-positive cell populations to ensure that functional transgenic TIL cells are obtained; 5) The sorted double-positive cells were expanded and cultured under conditions containing IL-2 and 3200 ng / mL IL-10, utilizing the synergistic effect of multiple signaling pathways involving exogenous IL-2, constitutively secreted IL-7, and exogenous IL-10. Specifically, Figure 2 , Figure 3 (Non-small cell lung cancer TIL) and Figure 6 , Figure 7 (Colorectal cancer TILs) demonstrated a synergistic effect in cell number and expansion: The transgenic IL-7 group and the transgenic NKG2D-CAR-IL-7 group (both IL-2+IL-7 treatment groups) showed significantly higher cell numbers and expansion rates than the IL-2 or IL-7 alone treatment groups; regarding target cell killing, although the function of IL-7 is generally considered to be mainly promoting T cell proliferation and survival, Figure 4 and Figure 8 It was confirmed that, compared with NKG2D-CAR, co-expression of NKG2D-CAR and IL7 significantly enhanced the killing effect on the target tumor cell lines, demonstrating that co-expression of IL7 has a synergistic effect on the tumor killing activity of NKG2D-CAR.

[0057] The invention is further illustrated in the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention. All chemicals used in the following reactions are commercially available products unless otherwise specified.

[0058] Example 1: Construction of lentiviral expression vectors for NKG2D-CAR, IL7, and NKG2D-CAR-IL7 genes 1. Construction of plasmids containing NKG2D-CAR or IL7 or NKG2D-CAR-IL7 genes The CDS sequence of IL7 was downloaded from NCBI, and then codon optimization was performed to enhance its expression. These optimization methods included, but were not limited to: adopting human codon usage preferences, adjusting the GC content appropriately, constructing a stable mRNA secondary structure, eliminating repetitive sequences, hidden splicing sites, and unnecessary restriction enzyme sites, while preventing the depletion of the cellular tRNA library. The NKG2D-CAR sequence could be designed using conventional methods in the art, for example, containing the human NKG2D extracellular domain (amino acid residues 78-216), CD8α hinge region, CD28 transmembrane region and intracellular signaling domain, and CD3ζ signaling domain, and synthesized after codon optimization. The sequences of the NKG2D-CAR, IL-7, and NKG2D-CAR-IL7 genes are shown in SEQ ID Nos. 1 to 3, respectively. The optimized sequences were directly used for gene synthesis, and the double-digested pLenti expression plasmids were ligated into the XbaI and SmaI restriction sites (pLenti-Guide, see 2017-nature protocols-Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening, Nature Protocols volume 12, pages 828-863 (2017)). The plasmids that were verified by restriction enzyme digestion and sequencing were named pLenti-NKG2D-CAR, pLenti-IL7, and pLenti-NKG2D-CAR-IL7, respectively. NKG2D-CAR and IL7 were linked by P2A. P2A is a self-cleaving polypeptide sequence that can mediate a skipping reaction in ribosomes during translation, enabling the co-expression of multiple proteins. P2A enables protein translation to be independent of the 5' cap structure of messenger RNA-mediated initiation mechanism, allowing for the continuous translation of multiple functional proteins on a single RNA strand. Therefore, it can ensure that both NKG2D-CAR and IL7 can be correctly expressed as independent active proteins.

[0059] 2. Lentiviral preparation and titer determination The pLenti plasmid, pLP1 vector, pLP2 vector, and pLP-VSVG vector containing the NKG2D-CAR, IL7, and NKG2D-CAR-IL7 genes obtained in the above steps were used (vector reference: Song LP, Li YP, Wang N, Li WW, RenJ, Qiu SD, Wang QY, Yang GX. NT4(Si)-p53(N15)-antennapedia induces cell death in a human hepatocellular carcinoma cell line. World J Gastroenterol 2009; 15(46): 5813-5820 [PMID: 19998502 DOI: [10.3748 / wjg.15.5813]) The plasmids were purified separately and transfected into HEK-293T cells at a density of about 70% using Lipo2000 at a certain ratio. After 16 hours, the medium was replaced with complete medium. After 48 hours and 72 hours of culture, the supernatant of the culture medium was collected and filtered through a 0.45 μm filter. The obtained filtrate was the original solution of recombinant lentivirus.

[0060] Recombinant lentivirus was concentrated using the Lentivirus Concentration Solution (YEASEN, 41101ES50) lentivirus concentration kit.

[0061] Subsequently, lentivirus titer was determined, and HEK-293T cells were seeded into 24-well plates at 1×10⁶ cells per well. 5 The cells were cultured overnight at 37°C. The virus stock solution was resuspended in DMEM medium, with 10 μL of virus stock solution in the first well. Then, 10-fold serial dilutions were performed, with 100 μL of medium-virus mixture added to each well. Each dilution was used in triplicate. After culturing at 37°C in a 5% CO2 incubator for 24 h, the virus-containing DMEM medium was replaced with virus-free DMEM complete medium, and the cells were cultured for another 48 h. The proportion of transgene-positive cells was detected by flow cytometry, and the virus titer was calculated. The sum of the total number of cells in the three replicate wells was calculated, and the averages were denoted as A (average number of fluorescent cells in the second-to-last visible fluorescent well) and B (average number of fluorescent cells in the penultimate visible fluorescent well).

[0062] Lentiviral titer calculation formula: Lentiviral titer (TU / ml) = (A + B) 10) Virus load in 1000 / 2 / A wells.

[0063] Example 2: Preparation of TIL cells for non-small cell lung cancer 1. Tissue pretreatment: The tumor tissue specimen collection tubes, reagents, and operating instruments were wiped with 75% ethanol and then placed in a biosafety cabinet. Inside the biosafety cabinet, the tumor tissue specimen collection bottle was opened, and the tumor tissue (non-small cell lung cancer, from patients enrolled in clinical trials) was cleaned and treated to remove blood vessels, capsules, and other necrotic tissue.

[0064] 2. Tissue digestion: 1) The tumor tissue was minced into a near-meat-like state in the tissue enzymatic hydrolysate, and then suspended in the tissue enzymatic hydrolysate. The suspension was transferred to a centrifuge tube and placed in an electric thermostatic shaker. The temperature was set at 37°C, the shaking frequency at 150 rpm / min, and the time was 30-60 min for constant temperature digestion.

[0065] 2) Take 40 mL of the termination protection solution and put it into a 50 mL centrifuge tube for later use. Place a 70 μm filter screen at the mouth of the 50 mL centrifuge tube and prepare a 5 mL disposable syringe for later use.

[0066] 3) Remove the centrifuge tube from the shaker and gradually add it to the filter screen from the previous step using a pipette. Grind and filter the filter with a grinding rod while grinding and rinsing, and collect the single-cell suspension.

[0067] 4) Centrifuge the single-cell suspension collected in 3) at 500g for 8 min and discard the supernatant. Resuspend the cell pellet in 10 mL of X-VIVO-15 medium (Lonza), take a sample for counting, and centrifuge all remaining cells at 500g for 8 min.

[0068] 3. Plate culture Centrifugation can remove residual proteins from cell suspensions. Based on the counting results, the cells were then cultured in a CO2 incubator at 37°C with 5% CO2.

[0069] 4. Isolation and purification of TIL cells (S1 stage) 1) Medium change and well expansion: Observe the cells under a microscope in a B+A grade culture room every day. If there are no obvious adherent cells, change the medium every other day. If the number of lymphocytes does not gradually increase or the number of cancer cells does not decrease, continue to change the medium. If the lymphocyte density increases significantly and cell clusters appear, the well expansion operation is required. After the operation is completed, place the well in a 37°C, 5% CO2 incubator for culture.

[0070] 2) Collection: Cells are collected after culturing for no more than 10 days. Cell counts and viability are assessed, and cells are either cryopreserved or proceed to the S2 stage based on the count results. The S1 stage of culture removes tumor cells, fibroblasts, and other contaminating cells unrelated to TILs. Daily microscopic observation of cell growth is used to determine subsequent processing steps. Observation indicators include changes in the number of lymphocytes, tumor cells, and other cells, as well as the degree of lymphocyte segregation.

[0071] 5. Rapid expansion culture of TIL cells (S2 phase) 1) Day 0: Pre-coating: Add 1-5 μg / mL CD3 antibody (TAKARA) + 10-15 μg / mL recombinant human fibrin (RN) to the culture flask and coat at 4°C. Before use, aspirate the coating solution and wash 2-3 times with PBS. Take 2×10⁻⁶ [units of measurement missing]. 7 TIL cell transfer culture flasks were placed in a CO2 cell incubator at 37°C and 5% CO2. The cells were divided into five groups, with each group initially containing 2 × 10⁶ cells. 7 indivual.

[0072] 2) Day 1: Add CTS immune cell serum substitute (Gibco) to each group. Groups 1, 3, 4, and 5 are given 1000 IU / mL IL-2 (Tetracycline Biotech), and group 2 is given 25 ng / mL IL-7 (Dongkang Biotech). From day 2 to day 4, observe the cells under a microscope and take samples for counting. If the number of TIL cells gradually increases, fluid replacement is required to maintain the cell density at approximately 1×10⁻⁶. 6 / mL, and after completion, place in a CO2 cell culture incubator at 37°C and 5% CO2.

[0073] 3) Day 2: Recombinant lentivirus transfection. On the second day, the recombinant lentivirus containing the NKG2D-CAR, IL7, and NKG2D-CAR-IL7 gene sequences prepared in Example 1 was added to TIL cells in the third, fourth, and fifth logarithmic growth phases, respectively, along with 8 μg / ml polybrene. Three days after transfection, NKG2D or IL7 flow cytometry antibodies were added for labeling and sorting to obtain purified TIL-positive cells.

[0074] 4) Day 14: Collect the supernatant to detect the secretion of cytokine IL-7 (IL-7 Human ELISA Kit, Invitrogen, Cat.:#EHIL7X5).

[0075] like Figure 1As shown, compared to the control group, both IL7 transgenic experimental groups produced large amounts of IL-7. The transgenic IL-7 and NKG2D-CAR-IL7 produced 35320.8 pg / mL and 33349.5 pg / mL of IL-7, respectively. The first group received 1000 IU / mL IL-2 after each medium change, while the second group received 25 ng / mL IL-7.

[0076] 5) Days 23–25: Continue culturing for 10–12 days under conditions of 1000 IU / mL IL-2 and 3200 ng / mL IL-10, at which point the cell count should reach the infusion quantity. Count the cells in each group and detect the fold increase.

[0077] like Figure 2 and Figure 3 As shown, the transgenic method of the present invention can significantly increase the expansion fold of TIL cells, with both the IL7 and NKG2D-CAR-IL7 groups reaching 1900-fold.

[0078] 6. Assay of TIL cell killing function 1) Human hepatocellular carcinoma HepG2 cells (National Biomedical Experimental Cell Resource Bank) in the exponential growth phase were stained with trypan blue and counted; 9000 target cells / 100 μL were added to each well of a 96-well plate and incubated overnight at 37°C in a 5% CO2 incubator to allow them to adhere; 2) Add effector cells (TILs harvested in step 5 above, which are HLA-matched TILs) to the target cell wells at an effector-to-target ratio of 2.5:1 and 5:1, and prepare corresponding numbers of TILs cultured alone as controls; the negative control group uses PBMCs as target cells; then transfer to a 37°C, 5% CO2 incubator and incubate for 24 h. 3) After 24 hours, aspirate 100 μL of supernatant and add 20 μL / well of MTS reagent (3-(4,5-dimethylthiazolyl-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazonium inner salt; Abcam) to the wells. 4) Incubate at 37°C in a 5% CO2 incubator in the dark for 0.5–4 hours; 5) Use an ELISA reader (synergy HT, Coretech (Beijing) Technology Co., Ltd.) to detect the absorbance at 490 nm; 6) Calculate the kill rate at each effective target ratio using the following formula.

[0079] Cytotoxicity (%) = 1 - (OD co-incubation group - ODTIL culture alone group) / (OD tumor cell negative control group - OD blank control group) × 100%.

[0080] Results analysis: such as Figure 4 As shown, PBMCs from healthy individuals, which exhibit no specific killing effect, served as the negative control group, with a theoretical specific killing effect of 0. Regardless of whether the E:T ratio was 2.5:1 or 5:1, the NKG2D-CAR-IL7-TIL group showed the strongest killing effect, achieving over 96% killing efficiency at E:T=5:1 and approximately 85% at E:T=2.5:1. These results indicate that, compared to TIL cells cultured with ordinary IL-2 or IL-7, transgenic NKG2D-CAR-IL7-TIL cells possess a stronger ability to synergistically kill target cells.

[0081] Example 3: Preparation of colorectal cancer TIL cells The processing and digestion of colorectal cancer tissue (colorectal cancer, from patients enrolled in the clinical trial), the isolation and purification of TIL cells, and the procedures for the expansion culture stage were all the same as in Example 2. The sorting of transgenic positive cells during the expansion culture stage and the detection of IL7 expression were also performed using an ELISA kit.

[0082] The results are as follows Figure 5 As shown, the transgenic TIL derived from colorectal cancer also secretes high levels of IL-7. Compared to the control group, the transgenic IL-7 and NKG2CD-CAR-IL-7 produced 36627.9 pg / mL and 35651.6 pg / mL of IL-7, respectively.

[0083] After the entire S2 phase is completed, the number and fold increase of cells are detected.

[0084] The results are as follows Figure 6 and Figure 7 As shown, the transgenic IL-7 and NKG2D-CAR-IL-7 groups had the highest TIL cell count, both reaching 2.8 × 10⁻⁶. 10 The number of patients was more than 1,000 times greater than the initial number of inoculations. All groups met the cell therapy infusion dose requirements.

[0085] The killing effect of the prepared colorectal cancer TIL cells was also tested. The colorectal cancer tumor cell line used was HCT116 (National Biomedical Experimental Cell Resource Bank). Similarly, the effector cells TIL and the target cell line were HLA matched.

[0086] Depend on Figure 8 It can be seen that the NKG2D-CAR-IL7-TIL cells cultured by the transgenic method of this invention have the strongest killing activity, which is significantly higher than that of the traditional method, fully demonstrating that this method is an effective way to improve the killing activity of TIL cells.

[0087] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. An engineered tumor-infiltrating lymphocyte that co-expresses NKG2D chimeric antigen receptor (NKG2D-CAR) and interleukin-7 (IL-7).

2. The engineered tumor-infiltrating lymphocytes according to claim 1, wherein the NKG2D-CAR comprises an extracellular domain, a hinge region, a transmembrane domain, and an intracellular domain, wherein the intracellular domain comprises a co-stimulatory domain and / or a signal transduction domain.

3. The engineered tumor-infiltrating lymphocytes according to claim 2, wherein: 1) The chimeric antigen receptor further comprises a signal peptide, a small molecule tag, a self-cleaving peptide, or a combination thereof; 2) The hinge region is derived from the hinge of IgG or the extracellular region of CD8α / CD28; 3) The transmembrane domains are derived from CD4, CD8α, CD28, or CD3ζ; 4) The co-stimulatory domain is derived from the CD28 receptor family or the tumor necrosis factor receptor family; and / or 5) The signal transduction domain is the T cell receptor TCR / CD3ζ chain or the immunoglobulin Fc receptor FcεRIγ chain.

4. The engineered tumor-infiltrating lymphocytes according to claim 1, wherein: 1) The NKG2D-CAR includes the extracellular domain of human NKG2D, namely amino acid residues 78-216, the CD8α hinge region, the CD28 transmembrane region, and the intracellular signaling domain and CD3ζ signaling domain; and / or 2) The NKG2D-CAR and IL-7 are directly connected or connected through a connector, wherein the connector includes a self-cleaving peptide, which includes P2A, T2A, E2A and F2A.

5. The engineered tumor-infiltrating lymphocytes according to claim 1, wherein the amino acid sequence of the NKG2D-CAR is encoded by SEQ ID No. 1; and / or wherein the amino acid sequence of the IL-7 is encoded by SEQ ID No.

2.

6. The engineered tumor-infiltrating lymphocytes according to claim 1, which express the sequence shown in SEQ ID No.

3.

7. The engineered tumor-infiltrating lymphocytes according to claim 1, wherein the engineered TILs are derived from NKG2D ligand-positive tumors, including hematologic malignancies and solid tumors, selected from lung cancer, liver cancer, colorectal cancer, breast cancer, gastric cancer, ovarian cancer, osteosarcoma, pancreatic cancer, prostate cancer, melanoma, glioma / glioblastoma, bladder cancer, cervical cancer, esophageal cancer, head and neck squamous cell carcinoma, kidney cancer, endometrial cancer, and acute myeloid leukemia (AML).

8. Engineered tumor-infiltrating lymphocytes according to any one of claims 1-7, wherein NKG2D-CAR and IL-7 are co-expressed via a vector selected from the following: lentiviral vectors, transposon vectors, retroviral vectors, DNA vectors, plasmids, RNA vectors, adenovirus vectors, adenovirus-associated vectors, and the CRISPR / Cas9 system.

9. A method for preparing engineered tumor-infiltrating lymphocytes according to any one of claims 1-8, comprising the following steps: (1) Prepare a recombinant lentivirus containing a target gene, wherein the target gene contains a nucleic acid sequence encoding an NKG2D chimeric antigen receptor (NKG2D-CAR) and a nucleic acid sequence encoding interleukin-7 (IL-7); (2) Tumor-infiltrating lymphocytes (TILs) were isolated from tumor tissue and cultured in a medium containing interleukin-2 (IL-2) until the logarithmic growth phase; (3) Transfect the recombinant lentivirus obtained in step (1) into TIL cells cultured in step (2) in the logarithmic growth phase; (4) Use flow cytometry to sort a double-positive cell population that simultaneously expresses NKG2D-CAR and IL-7; (5) The double-positive cell population obtained in step (4) is expanded and cultured in an amplification medium containing IL-2 and interleukin-10 (IL-10) to obtain the engineered tumor-infiltrating lymphocytes.

10. The use of engineered tumor-infiltrating lymphocytes according to any one of claims 1-8, or engineered tumor-infiltrating lymphocytes prepared by the method according to claim 9, in the preparation of antitumor drugs.

Images