Mesenchymal stem cell-derived engineered hybrid vesicles, and methods of making and using the same

Abstract

The present application relates to the field of vesicle delivery, and provides a mesenchymal stem cell source engineered hybrid vesicle and a preparation method and application thereof, the mesenchymal stem cell source engineered hybrid vesicle is obtained by fusing mesenchymal stem cell source extracellular vesicle and A549 cell membrane.The present application fuses hUCMSCs source EV and non-small cell lung cancer NSCLC cell (A549) membrane, obtains hybrid vesicle with homologous targeting ability, and through optimizing electroporation conditions, let-7a-5p is efficiently loaded in hybrid vesicle, and engineering hybrid vesicle MSC-EVs-H-let is obtained.The engineering vesicle keeps good stability, and significantly improves tumor targeting delivery efficiency and anti-tumor efficiency.

Description

Technical Field

[0001] This invention relates to the field of vesicle delivery, and more specifically, to an engineered hybrid vesicle of mesenchymal stem cell origin, its preparation method, and its application. Background Technology

[0002] Lung cancer is the leading cause of cancer death worldwide, with non-small cell lung cancer (NSCLC) accounting for approximately 85% of cases. The 5-year survival rate for these patients has long hovered between 10% and 23%. Drug resistance to targeted and immunotherapies, along with the lack of tumor specificity in traditional chemotherapy, are the main reasons for treatment failure. Therefore, developing novel, highly effective, and low-toxicity targeted therapy strategies is a crucial bottleneck that urgently needs to be overcome in the clinical diagnosis and treatment of NSCLC.

[0003] Human umbilical cord-derived mesenchymal stem cells (hUCMSCs) are ideal drug delivery vehicles due to their excellent tumor tropism and immunomodulatory functions. Their paracrine core effector molecules—extracellular vesicles (EVs)—can protect loaded bioactive molecules (such as miRNAs, siRNAs, and proteins) from degradation and target them to recipient cells. However, EVs derived from natural hUCMSCs suffer from insufficient tumor targeting specificity and low loading efficiency, severely hindering their clinical translation. How to improve the tumor targeting and therapeutic efficacy of MSC-EVs through engineering modification is a key technical problem that urgently needs to be solved in the field of tumor nanomedicine.

[0004] Furthermore, although natural MSC-EVs are rich in various functional miRNAs (such as tumor suppressor miRNAs like let-7a-5p), their endogenous loading capacity is limited, making it difficult to achieve highly effective therapeutic levels. In existing technologies, exogenous loading of miRNAs via electroporation and other methods often compromises the integrity and stability of the vesicles. Therefore, developing an engineered vesicle preparation method that can both preserve and enhance the tumor targeting of MSC-EVs and efficiently and stably load therapeutic miRNAs has significant clinical application value. Summary of the Invention

[0005] The purpose of this invention is to provide an engineered hybrid vesicle derived from mesenchymal stem cells and its preparation method, which solves the problems of insufficient tumor targeting specificity and low loading efficiency of existing hUCMSCs-derived EVs. The engineered hybrid vesicles can efficiently and stably load therapeutic miRNAs.

[0006] Another object of the present invention is to provide an application of engineered hybrid vesicles derived from mesenchymal stem cells.

[0007] The embodiments of the present invention are achieved through the following technical solutions:

[0008] An engineered hybrid vesicle derived from mesenchymal stem cells was obtained by fusing extracellular vesicles derived from mesenchymal stem cells with the membrane of A549 cells.

[0009] Preferably, the engineered hybrid vesicle comprises: E-cadherin, CD44, and CD47.

[0010] Preferably, the engineered heterozygous vesicles include CD9, CD81, and TSG101.

[0011] The application of the engineered hybrid vesicles described herein as a let-7a-5p delivery vector.

[0012] The application of the engineered hybrid vesicles in the preparation of a therapeutic drug for non-small cell lung cancer.

[0013] Preferably, the non-small cell lung cancer treatment includes engineered hybrid vesicles derived from mesenchymal stem cells and let-7a-5p.

[0014] Preferably, engineered hybrid vesicles derived from mesenchymal stem cells are loaded with let-7a-5p via electroporation.

[0015] Preferably, the voltage of the electroporation process is 650-950V and the number of pulses is 5-10.

[0016] A method for preparing the engineered hybrid vesicles involves mixing extracellular vesicles derived from mesenchymal stem cells with A549 cell membranes, followed by ultrasonic treatment, water bath treatment, and centrifugation to obtain engineered hybrid vesicles.

[0017] Preferably, the extraction process of the A549 cell membrane includes: adding A549 cells to a membrane protein extraction buffer, followed by a lysis step, an ultrasonic disruption step, and a first centrifugation step to obtain a supernatant; the supernatant is then subjected to a second centrifugation step to obtain the A549 cell membrane;

[0018] Extracellular vesicles derived from mesenchymal stem cells were extracted from the supernatant of mesenchymal stem cells using differential ultracentrifugation.

[0019] The present invention has at least the following beneficial effects:

[0020] This invention fuses EVs derived from hUCMSCs with the membrane of NSCLC cells (A549) to obtain hybrid vesicles with homologous targeting capabilities. By optimizing electroporation conditions, let-7a-5p is efficiently loaded into these vesicles, resulting in engineered hybrid vesicles MSC-EVs-H-let. These engineered vesicles significantly improve tumor-targeted delivery efficiency and anti-tumor efficacy while maintaining good stability. Attached Figure Description

[0021] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation on the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0022] Figure 1 The image shows the morphological observation and multi-directional differentiation capacity identification results of hUCMSCs.

[0023] Figure 2 Figure showing the results of flow cytometry detection of surface markers in hUCMSCs;

[0024] Figure 3 Morphological diagrams of MSC-EVs and MSC-EVs-H;

[0025] Figure 4 Particle size distribution diagrams for MSC-EVs and MSC-EVs-H;

[0026] Figure 5 The expression results of CD9, CD81, TSG101 and Calnexin in MSC-EVs and MSC-EVs-H are shown in the figure.

[0027] Figure 6 The graph shows the test results of Zeta potential values ​​for MSC-EVs and MSC-EVs-H.

[0028] Figure 7 The graph shows the particle size changes of MSC-EVs-H after storage at -80°C for different times.

[0029] Figure 8 This is a schematic diagram of the FRET experiment;

[0030] Figure 9 FRET detection results for DiD and DiI labeled MSC-EVs;

[0031] Figure 10The graph shows the changes in fluorescence intensity of DiI (575 nm) and DiD (670 nm) under different concentrations of A549 cell membrane treatment.

[0032] Figure 11 Co-location analysis diagram for DiO / DiD-MSC-EVs-H;

[0033] Figure 12 Confocal microscopy images of fused vesicles and physical mixtures;

[0034] Figure 13 This is a quantitative analysis diagram of the yellow fluorescence signal;

[0035] Figure 14 The diagram shows the protein composition analysis of MSC-EVs, A549 cell membrane, and MSC-EVs-H.

[0036] Figure 15 This is a graph showing the results of Western blot analysis.

[0037] Figure 16 Figure 1 shows the proliferation results of A549 cells after treatment in the NC group, MSC-EVs group, and MSC-EVs-H group.

[0038] Figure 17 Figure 1 shows the results of Transwell assay to detect the migration and invasion abilities of A549 cells after each treatment group.

[0039] Figure 18 Figure showing the results of Transwell assays to detect the number of migrating and invading A549 cells in each treatment group;

[0040] Figure 19 This is a graph showing the results of the red fluorescence intensity detection.

[0041] Figure 20 The image shows the results of detecting the internalization effect of MSC-EVs-H on A549 cells.

[0042] Figure 21 The figure shows the results of quantitative analysis of the targeting efficiency of MSC-EVs-H by flow cytometry.

[0043] Figure 22 This is a graph showing the results of cell uptake of MSC-EVs-H;

[0044] Figure 23 The figure shows the loading efficiency of let-7a-5p in MSC-EVs-H under different voltage and pulse number conditions detected by qRT-PCR.

[0045] Figure 24 The graph shows the particle concentration detection results of MSC-EVs-H in different treatment groups;

[0046] Figure 25 Particle size distribution of MSC-EVs-H in different treatment groups;

[0047] Figure 26 Morphological images of MSC-EVs-H before and after electroporation;

[0048] Figure 27 Figure showing the uptake of PKH67-labeled MSC-EVs, MSC-EVs-H, and MSC-EVs-H-let after co-incubation with A549 cells;

[0049] Figure 28 Figure showing the results of qRT-PCR detection of let-7a-5p expression in A549 cells after treatment with MSC-EVs-H-let;

[0050] Figure 29 Figure showing the results of in situ hybridization detection of let-7a-5p expression in A549 cells after treatment with MSC-EVs-H-let;

[0051] Figure 30 Figure showing the results of CCK8 assay to detect the effect of MSC-EVs-H-let on the proliferation of A549 cells;

[0052] Figure 31 Figure showing the results of Transwell assays to detect the effects of MSC-EVs-H-let on the migration and invasion abilities of A549 cells;

[0053] Figure 32 Image showing the results of weight changes in subcutaneous xenografts in nude mice;

[0054] Figure 33 This is a graph showing the statistical results of subcutaneous xenograft tumor volume in nude mice. Detailed Implementation

[0055] To make the objectives, methods, and advantages of the embodiments of the present invention clearer, the methods in the embodiments of the present invention will be clearly and completely described. Obviously, the described embodiments are some embodiments of the present invention, but not all embodiments.

[0056] Example 1: An engineered hybrid vesicle derived from mesenchymal stem cells, obtained by fusing extracellular vesicles derived from mesenchymal stem cells with the A549 cell membrane.

[0057] Example 2: The engineered hybrid vesicles include E-cadherin, CD44, and CD47.

[0058] Example 3: The engineered heterozygous vesicles include CD9, CD81 and TSG101.

[0059] Example 4: Application of the engineered hybrid vesicle as a let-7a-5p delivery vector.

[0060] Example 5: Application of the engineered hybrid vesicles in the preparation of a therapeutic drug for non-small cell lung cancer.

[0061] When engineered hybrid vesicles are used in the treatment of non-small cell lung cancer, there are no restrictions on the dosage form of the drug, such as tablets, capsules, and injections. Furthermore, engineered hybrid vesicles can be formulated into pharmaceutical compositions with other components, such as diluents, lubricants, swelling agents, disintegrants, or carriers. Pharmaceutical compositions facilitate the administration of compounds to a living organism to produce a major therapeutic effect. Various techniques for administering compounds exist in the art, including but not limited to oral, injection, inhalation, spray, parenteral, and topical administration.

[0062] The term "carrier" defines a compound that facilitates its incorporation into cells or tissues. For example, dimethyl sulfoxide (DMSO) is a commonly used carrier because it helps many organic compounds take up into the cells or tissues of an organism.

[0063] The term "diluent" defines a compound diluted in water that dissolves a target compound and stabilizes the biologically active form of the compound. In this art, salts dissolved in buffer solutions are used as diluents. A commonly used buffer solution is a phosphate-buffered saline solution because it mimics the salt conditions of human blood. Because buffer salts can control the pH of the solution at low concentrations, buffer dilutions rarely alter the biological activity of the compound.

[0064] In some embodiments, the same substance can be used as a carrier, diluent, or excipient, or have any two or all three functions. Therefore, a single additive in a pharmaceutical composition can have multiple functions.

[0065] The pharmaceutical composition can be prepared using existing technologies, such as conventional methods of mixing, dissolving, granulation, making sugar-coated pills, grinding, emulsifying, encapsulating, embedding, or tableting.

[0066] Example 6: The non-small cell lung cancer treatment drug includes engineered hybrid vesicles derived from mesenchymal stem cells and let-7a-5p.

[0067] Example 7: Engineered hybrid vesicles of mesenchymal stem cell source were loaded with let-7a-5p via electroporation.

[0068] Example 8: The voltage of the electroporation process is 650-950V, and the number of pulses is 5-10.

[0069] Example 9: A method for preparing the engineered hybrid vesicles, wherein extracellular vesicles derived from mesenchymal stem cells and A549 cell membranes are mixed and then subjected to an ultrasonic treatment process, a water bath process, and a centrifugation process to obtain engineered hybrid vesicles.

[0070] Example 10: The extraction process of the A549 cell membrane includes: adding A549 cells to a membrane protein extraction buffer, followed by a lysis step, an ultrasonic disruption step, and a first centrifugation step to obtain a supernatant; the supernatant is then subjected to a second centrifugation step to obtain the A549 cell membrane;

[0071] Extracellular vesicles derived from mesenchymal stem cells were extracted from the supernatant of mesenchymal stem cells using differential ultracentrifugation.

[0072] Application verification test:

[0073] Experimental Example 1: Isolation, Culture, and Identification of Human Umbilical Cord Mesenchymal Stem Cells (hUCMSCs)

[0074] 1.1 Isolation and culture of hUCMSCs

[0075] Umbilical cords from healthy, full-term newborns were collected (with informed consent from the mother and approval from the hospital's ethics committee) and placed in sterile PBS buffer (containing 1% penicillin-streptomycin). In a laminar flow hood, the umbilical cords were cut into 2–3 cm segments, longitudinally dissected, and the umbilical artery and vein removed. Wharton's jelly tissue was then excised. Wharton's jelly was cut into approximately 1 mm³ pieces and evenly spread at the bottom of a culture dish. DMEM / F12 medium (Gibco) containing 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin was added, and the dish was incubated at 37°C in a 5% CO2 incubator. The medium was changed at half capacity every 3 days. After approximately 7–10 days, cells were observed to emerge from around the tissue pieces. When cell confluence reached 80%, cells were passaged using 0.25% trypsin-EDTA digestion. Cells from passages 3–5 were used for subsequent experiments.

[0076] 1.2 Morphological observation of hUCMSCs

[0077] Third-generation hUCMSCs were harvested and their morphology was observed under an inverted phase-contrast microscope. For example... Figure 1 As shown, hUCMSCs grow in a single layer attached to the wall, with a fibroblast-like morphology (long spindle-shaped or fusiform) and arranged in a whorl.

[0078] 1.3 Identification of the multi-lineage differentiation capacity of hUCMSCs

[0079] (1) Osteogenic induction differentiation: Third-generation hUCMSCs were induced to differentiate at a rate of 2×10⁻⁶. 4Cells were seeded per well in 24-well plates. When cell confluence reached 60%–70%, the original culture medium was discarded, and osteogenic induction medium (DMEM / F12 medium containing 10% FBS, 0.1 μmol / L dexamethasone, 50 μmol / L ascorbic acid, and 10 mmol / L β-glycerophosphate) was added. The medium was changed every 3 days. After 21 days of induction, the cells were fixed with 4% paraformaldehyde, stained with Alizarin Red S, and observed under a light microscope for calcium phosphate deposition (appearing as red or orange-red nodules). The results are as follows: Figure 1 As shown, Alizarin Red S staining reveals a large amount of calcium phosphate deposition.

[0080] (2) Adipogenic differentiation: Third-generation hUCMSCs were induced to differentiate at a rate of 2×10⁻⁶. 4 Cells were seeded per well in 24-well plates. When cell confluence reached 100%, adipogenesis induction medium A (DMEM / F12 medium containing 10% FBS, 1 μmol / L dexamethasone, 0.5 mmol / L IBMX, and 10 μg / mL insulin) was added for 3 days of induction. Then, the cells were switched to adipogenesis maintenance medium B (DMEM / F12 medium containing 10% FBS and 10 μg / mL insulin) for 1 day. This alternating induction cycle was repeated for 3 days. Cells were then fixed with 4% paraformaldehyde, stained with Oil Red O, and the lipid droplets (appearing red) were observed under a light microscope. Results are as follows: Figure 1 As shown, Oil Red O staining reveals a large number of red lipid droplets.

[0081] (3) Chondrogenic differentiation: Third-generation hUCMSCs were induced to differentiate at a rate of 2×10⁻⁶. 5 Cells were centrifuged per tube to collect the precipitate, which was then added to chondrogenesis induction medium (DMEM / F12 medium containing 10% FBS, 1% ITS, 100 nmol / L dexamethasone, 50 μg / mL ascorbic acid, and 40 μg / mL proline). The cells were incubated at 37°C in a 5% CO2 incubator for 21 days, with the medium changed every 3 days. After induction, the cell pellet was fixed with 4% paraformaldehyde, embedded in paraffin, sectioned, stained with alexandrite blue, and the proteoglycans (which appeared blue) were observed under a light microscope. Results are as follows: Figure 1 As shown, a large amount of blue proteoglycans can be seen when stained with alexandrite blue.

[0082] The above results demonstrate that the isolated cells have the ability to differentiate into osteoblasts, adipocytes, and chondrocytes, meeting the identification criteria for mesenchymal stem cells.

[0083] 1.4 Flow cytometry detection of hUCMSCs surface markers

[0084] Third-generation hUCMSCs were digested with 0.25% trypsin-EDTA to prepare a single-cell suspension, and after counting, the density was adjusted to 1×10⁻⁶. 6Cells / mL. Fluorescently labeled anti-human CD73-FITC, CD90-PE, CD105-APC, and CD45-FITC antibodies (BD Biosciences) and their corresponding isotype control antibodies were added, and incubated at 4°C in the dark for 30 minutes. After washing twice with PBS, the cells were analyzed by flow cytometry (BD FACSCanto II). Results are as follows: Figure 2 As shown, hUCMSCs highly expressed CD73 (98.63%), CD90 (98.94%), and CD105 (99.28%), and low expressed the hematopoietic stem cell marker CD45 (0.82%), which is consistent with the immunophenotypic characteristics of mesenchymal stem cells.

[0085] Experimental Example 2: Extraction and Identification of MSC-EVs

[0086] Fifth-generation hUCMSCs were harvested. When cell confluence reached 80%–90%, the original culture medium was discarded, and the cells were washed twice with PBS. The culture medium was then replaced with serum-free DMEM / F12 and cultured for another 48 hours. The cell supernatant was collected, and extracellular vesicles (MSC-EVs) were extracted using differential ultracentrifugation.

[0087] Centrifuge at 300×g, 4℃ for 10 minutes to remove cell debris;

[0088] Centrifuge at 2000×g, 4℃ for 20 minutes to remove dead cells;

[0089] Centrifuge at 10000×g, 4℃ for 30 minutes to remove large vesicles and subcellular structures;

[0090] After filtering the supernatant through a 0.22 μm filter membrane, it was centrifuged at 100,000 × g at 4 °C for 70 minutes (Beckman Coulter, Optima XPN-100).

[0091] Discard the supernatant, resuspend the precipitate in PBS, centrifuge again at 100,000×g at 4°C for 70 minutes and wash once.

[0092] The final precipitate was resuspended in a small amount of PBS, aliquoted, and stored at -80°C for later use.

[0093] The protein concentration of MSC-EVs was determined using the BCA protein quantification kit.

[0094] Experimental Example 3: Extraction of A549 Cell Membrane

[0095] A549 cells (human non-small cell lung cancer cell line, purchased from ATCC) cultured to the logarithmic growth phase were collected, washed twice with pre-chilled PBS, and lysed on ice for 30 minutes in pre-chilled membrane protein extraction buffer (containing 250 mM sucrose, 10 mM Tris-HCl, pH 7.4, 1 mM EDTA, and a mixture of 1× protease inhibitors). The cells were then sonicated (100 W, 3 seconds sonication, 5 seconds pause, 10 times in total) and centrifuged at 4°C, 1000×g for 10 minutes to remove nuclei and unlysed cells. The supernatant was centrifuged at 4°C, 10000×g for 20 minutes to precipitate organelles such as mitochondria. The supernatant was further centrifuged at 4°C, 100000×g for 60 minutes (second centrifugation), and the precipitate was the A549 cell membrane component. The precipitate was resuspended in membrane protein extraction buffer, protein concentration was determined by the BCA method, and the cells were aliquoted and stored at -80°C.

[0096] Experimental Example 4: Preparation and Characterization of Heterozygous Vesicles MSC-EVs-H

[0097] 4.1 Preparation of MSC-EVs-H by Ultrasonic Fusion Method

[0098] MSC-EVs (total protein 100 μg) extracted in Example 2 and A549 cell membranes (total protein 100 μg) extracted in Example 3 were mixed in PBS (total volume 1 mL) and placed in an ultrasonic fusion instrument (Sonics, VCX 500) for ultrasonic treatment using the following parameters: amplitude 30%, working for 3 seconds, rest for 5 seconds, for a total of 4 cycles (under ice bath conditions). The ultrasonicated mixture was placed in a 37°C water bath for 30 minutes to recover, and then centrifuged at 4°C, 100,000 × g for 60 minutes. The precipitate was collected, resuspended in PBS and washed once to obtain hybrid vesicle MSC-EVs-H. As a control, a physical mixture of MSC-EVs and A549 cell membranes was prepared using the same method (mixing only, without ultrasonic treatment).

[0099] 4.2 Transmission electron microscopy (TEM) observation of vesicle morphology

[0100] Take 10 μL of MSC-EVs or MSC-EVs-H suspension and add it dropwise onto a copper mesh (200 mesh). Let it stand at room temperature for 2 minutes, then blot away excess liquid with filter paper. Add 10 μL of 2% phosphotungstic acid (pH 7.0) for negative staining for 2 minutes, blot away the stain with filter paper, and allow it to dry at room temperature. Observe and photograph the results under a transmission electron microscope (Hitachi H-7650). Figure 3 As shown, both MSC-EVs and MSC-EVs-H exhibit typical saucer-shaped or spherical vesicle morphology, with uniform size, and their morphology does not change significantly after fusion.

[0101] 4.3 Nanoparticle size and Zeta potential analysis

[0102] Take 1 mL each of MSC-EVs and MSC-EVs-H (protein concentration approximately 50 μg / mL), dilute with PBS to an appropriate concentration, and use a Malvern Zetasizer Nano ZS90 nanoparticle size analyzer to detect particle size distribution and zeta potential. Results are as follows: Figure 4 As shown, the average particle size of MSC-EVs is 116.53 nm, and the average particle size of MSC-EVs-H is 118.03 nm; Figure 6 As shown, the Zeta potentials were -28.69 mV and -29.77 mV, respectively, with no significant difference between the two.

[0103] 4.4 Western blot detection of vesicle marker proteins

[0104] Equal amounts (20 μg) of protein from MSC-EVs, MSC-EVs-H, and A549 cell membrane lysis buffers were subjected to SDS-PAGE electrophoresis, transferred to PVDF membranes, and blocked with 5% skim milk powder at room temperature for 1 hour. Primary antibodies were then added: anti-CD9 (1:1000, Abcam), anti-CD81 (1:1000, Abcam), anti-TSG101 (1:1000, Abcam), anti-Calnexin (1:2000, Abcam), anti-E-cadherin (1:1000, CST), anti-CD44 (1:1000, CST), and anti-CD47 (1:1000, CST). The membranes were incubated overnight at 4°C. The following day, after washing, HRP-labeled secondary antibody (1:5000) was added, and the membranes were incubated at room temperature for 1 hour. ECL chemiluminescence imaging was then performed. Results are as follows: Figure 5 As shown, both MSC-EVs and MSC-EVs-H highly expressed exosome markers CD9, CD81, and TSG101, but did not express the endoplasmic reticulum marker Calnexin, indicating high purity of the extracted vesicles. The results are as follows... Figure 15 As shown, MSC-EVs-H retains the characteristic proteins of A549 cell membrane E-cadherin, CD44 and CD47, while these proteins are absent or expressed at very low levels in MSC-EVs.

[0105] 4.5 Vesicle stability testing

[0106] MSC-EVs-H were aliquoted and stored at -80℃. They were retrieved at 0, 7, 14, and 28 days, and particle size changes were analyzed using a nanoparticle size analyzer. Results are as follows: Figure 7 As shown, the particle size of MSC-EVs-H did not increase significantly after being stored at -80℃ for 28 days, indicating that it has good cryopreservation stability.

[0107] Experimental Example 5: Validation of the fusion effect of MSC-EVs with A549 cell membranes

[0108] 5.1 FRET Experiment

[0109] MSC-EVs (100 μg protein) were labeled with a dual-dye regimen (Invitrogen) using DiD (excitation / emission: 644 / 665 nm) and DiI (excitation / emission: 549 / 575 nm). The labeled MSC-EVs were then divided into two groups: the experimental group received an equal amount of A549 cell membrane (100 μg) and the control group received an equal volume of PBS. Both groups were incubated at 37°C for 30 minutes. Fluorescence intensities at 575 nm (DiI) and 670 nm (DiD) were recorded using a fluorescence spectrophotometer (Hitachi F-7000) at an excitation wavelength of 549 nm. The results are shown below. Figure 9 As shown, in the control group, DiD fluorescence was quenched due to the FRET effect; after the addition of A549 cell membrane, the FRET effect weakened, and DiD fluorescence recovered. Further experiments were conducted using A549 cell membranes at different concentration gradients (0, 25, 50, 100, 200 μg), and fluorescence intensity was measured using the method described above. The results are shown below. Figure 10 As shown, with the increase of A549 cell membrane dosage, the fluorescence at 575 nm (DiI) gradually decreased (due to dilution), while the fluorescence at 670 nm (DiD) gradually increased, confirming that membrane fusion led to the dispersion of fluorescent dyes.

[0110] 5.2 Confocal Microscopy Co-localization Analysis

[0111] MSC-EVs were labeled with DiO (green fluorescence), and A549 cell membranes were labeled with DiD (red fluorescence). The mixture was then sonicated to fuse the cells. 10 μL of the fusion product was added to a glass slide, covered with a coverslip, and observed under a laser confocal microscope (Leica SP8) (DiO excitation / emission: 488 / 501 nm; DiD excitation / emission: 644 / 665 nm). A physical mixture (mixed but not sonicated) was used as a control. Results are as follows: Figure 11-13 As shown, the MSC-EVs-H group showed obvious yellow colocalization signals (green / red overlap), while the physical mixture group only showed scattered green and red signals without obvious colocalization, directly confirming that MSC-EVs successfully fused with the A549 cell membrane.

[0112] Experimental Example 6: Effects of MSC-EVs-H on A549 Cell Function

[0113] A549 cells were divided into three groups: control group (PBS), MSC-EVs group (20 μg / mL), and MSC-EVs-H group (20 μg / mL, based on total protein). Functional analysis was performed 48 hours after treatment.

[0114] 6.1 Cell proliferation detection (CCK-8 assay)

[0115] A549 cells were seeded at 5 × 10³ cells / well in 96-well plates and allowed to adhere overnight before being treated according to the assigned groups. After 48 hours of treatment, 10 μL of CCK-8 solution (Dojindo) was added to each well, and the plates were incubated at 37°C for 2 hours. The absorbance at 450 nm was measured using a microplate reader. The results are as follows: Figure 16 As shown, compared with the control group, there was no significant change in cell proliferation in the MSC-EVs group and the MSC-EVs-H group (P > 0.05), indicating that the heterozygous vesicles themselves are not cytotoxic.

[0116] 6.2 Cell migration and invasion assays (Transwell assay)

[0117] Migration assay: A549 cells were digested and resuspended in serum-free medium, and the density was adjusted to 5 × 10⁶ cells / year. 4 Cells / 200 μL. 200 μL of cell suspension was added to the upper chamber of a Transwell chamber (8 μm pore size, Corning), and 600 μL of medium containing 10% FBS was added to the lower chamber as a chemokine. Simultaneously, vesicles from each group were added to the upper chamber (final concentration 20 μg / mL). After 24 hours of culture, unmigrated cells from the upper chamber were wiped away with a cotton swab. Cells from the lower chamber were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and counted in five randomly selected fields of view under a microscope.

[0118] Invasion test: The upper chamber of the Transwell chamber was pre-lined with Matrigel (BD, 1:8 dilution) and cured at 37°C for 30 minutes. The remaining steps were the same as the migration test.

[0119] The results are as follows Figure 17-18 As shown, compared with the control group, the MSC-EVs-H group significantly inhibited the migration and invasion of A549 cells (P < 0.01), while the MSC-EVs group had no significant effect. These results indicate that hybrid vesicles fused with the A549 cell membrane may enhance cell-vesicle interactions by providing homologous targeting-related proteins, but this effect itself does not inhibit tumor cells, providing a vector basis for subsequent loading of therapeutic miRNAs.

[0120] Experimental Example 7: Homologous Targeting Ability and Cellular Uptake Mechanism of MSC-EVs-H

[0121] 7.1 Homologous targeting capability detection

[0122] A549 cells (NSCLC cells), HBE cells (normal bronchial epithelial cells), and AGS cells (gastric cancer cells) were seeded separately in confocal culture dishes (2×10⁻⁶ cells / mL). 4 MSCs were incubated overnight with 20 μg / mL PKH67-labeled MSC-EVs-H. The cells were then incubated at 37°C for 4 hours. After washing three times with PBS, the cells were fixed with 4% paraformaldehyde, stained with DAPI, and observed under a confocal microscope. Results are as follows: Figures 19-20 As shown, the intensity of green fluorescence detected in A549 cells was significantly higher than that in AGS and HBE cells, indicating that MSC-EVs-H has selective homologous targeting ability for NSCLC cells.

[0123] 7.2 Quantitative analysis of uptake rate by flow cytometry

[0124] A549, HBE, and AGS cells were treated using the same method (incubated with PKH67-labeled MSCs-EVs-H for 4 hours), and cells were collected by trypsin digestion. The proportion of PKH67-positive cells was detected by flow cytometry (BD FACSCalibur). The results are as follows: Figure 21 As shown, the uptake rate of A549 cells was as high as 95.83%, while the uptake rates of AGS and HBE cells were only 5.52% and 10.74%, respectively, further confirming the high homologous targeting specificity of MSC-EVs-H.

[0125] 7.3 Endocytosis Inhibitor Experiment

[0126] To investigate the endocytic pathway of MSC-EVs-H uptake in A549 cells, A549 cells were pretreated for 1 hour with different endocytosis inhibitors: chlorpromazine (10 μg / mL, inhibiting clathrin-mediated endocytosis), genistein (200 μM, inhibiting caveolin-mediated endocytosis), and amiloride (100 μM, inhibiting macropinocytosis). Afterwards, PKH67-labeled MSC-EVs-H were added and co-incubated for 4 hours. Uptake rates were then detected by flow cytometry. Results are as follows: Figure 22 As shown, each inhibitor could inhibit the uptake of MSC-EVs-H by A549 cells to varying degrees (inhibition rates of approximately 40% for chlorpromazine, approximately 35% for genistein, and approximately 50% for amiloride), suggesting that the uptake of MSC-EVs-H may involve multiple endocytic pathways.

[0127] Experimental Example 8: Construction of engineered hybrid vesicles MSC-EVs-H-let and optimization of let-7a-5p loading

[0128] 8.1 LEFT-7A-5P simulant and electroporation loading

[0129] The let-7a-5p mimic (hsa-let-7a-5p mimic, sequence: UGAGGUAGUAGGUUGUAUAGUU) and its negative control (NC mimic) were purchased from RiboBio. MSC-EVs-H (100 μg protein) was resuspended in electroporation buffer (120 mM KCl, 0.15 mM CaCl2, 10 mM K2HPO4 / KH2PO4, 2 mM MgCl2, pH 7.4), and let-7a-5p mimic (final concentration 100 nM) was added. After mixing, the mixture was transferred to a 4 mm electroporation cuvette (Bio-Rad) and electroporated using a Gene Pulser Xcell electroporator (Bio-Rad). Different voltages (650 V, 750 V, 850 V, 950 V) and pulse counts (5 or 10 pulses) were set, with each pulse lasting 5 ms. After electroporation, the samples were incubated at 37°C for 30 minutes, then ultracentrifuged at 100,000 × g for 60 minutes to remove free miRNA. The precipitate was resuspended in PBS to obtain engineered vesicle MSC-EVs-H-let. Control group: MSC-EVs-H that were co-incubated with let-7a-5p mimic but not electroporated (denoted as iMSC-EVs-H).

[0130] 8.2 qRT-PCR detection of let-7a-5p loading levels after electroporation

[0131] Total RNA was extracted from vesicles in each treatment group (miRNeasy Mini Kit, Qiagen), reverse transcribed using the tailing method (Mir-XmiRNA First-Strand Synthesis Kit, Takara), and then subjected to qRT-PCR (SYBR Green method). The relative levels of let-7a-5p were calculated using the 2^-ΔΔCt method with cel-miR-39 as an external reference. Primer sequences: let-7a-5p RT primers and qPCR primers were provided by Takara.

[0132] The results are as follows Figure 23 As shown, when the number of pulses is fixed at 5, the loading level of let-7a-5p increases with increasing voltage, reaching its peak at 850 V (approximately four orders of magnitude higher than the baseline level and approximately four times higher than the iMSC-EVs-H group under simple incubation). However, when the voltage is increased to 950 V or the number of pulses is increased to 10, the loading level decreases significantly, even falling below that of the iMSC-EVs-H group. Therefore, the optimal electroporation parameters are determined to be: 850 V, 5 pulses.

[0133] 8.3 Effects of electroporation on vesicle concentration, particle size and morphology

[0134] The particle concentration and size distribution of vesicles after electroporation with optimal parameters were determined using a nanoparticle size analyzer and compared with the iMSC-EVs-H group. Results are as follows: Figure 24-25 As shown, the vesicle concentration decreased slightly after electroporation, but the particle size distribution remained essentially unchanged. Transmission electron microscopy observation (method as in Example 4.2) shows... Figure 26 As shown, after electroporation, MSC-EVs-H still maintained the complete saucer-like morphology, with no obvious damage or aggregation, indicating that the optimized electroporation conditions had little impact on the integrity of the vesicle structure.

[0135] Experimental Example 9: Validation of Cell Uptake and Delivery Efficiency of MSC-EVs-H-let

[0136] 9.1 Cellular uptake experiment

[0137] PKH67-labeled MSC-EVs, MSC-EVs-H, and MSC-EVs-H-let (prepared with optimal parameters) were co-incubated with A549 cells for 4 hours (final concentration 20 μg / mL), and uptake was observed using a confocal microscope. Results are as follows: Figure 27 As shown, the degree of internalization of MSC-EVs-H and MSC-EVs-H-let by A549 cells was significantly higher than that of native MSC-EVs (P < 0.001), indicating that membrane fusion and electroporation loading did not impair vesicle uptake efficiency.

[0138] 9.2 LEFT-7A-5P Delivery Efficiency Detection

[0139] A549 cells were divided into a PBS control group, an MSC-EVs-H-let group (20 μg / mL), and an MSC-EVs-H group (empty vector control). After 48 hours of treatment, total RNA was extracted from the cells, and the expression level of let-7a-5p was detected by qRT-PCR. Simultaneously, in situ hybridization (FISH) was performed: hybridization was conducted using a Cy3-labeled let-7a-5p probe (Exiqon) according to the kit instructions, followed by DAPI staining of the nuclei and observation under a confocal microscope. Results are as follows: Figures 28-29 As shown, the expression level of let-7a-5p in A549 cells treated with MSC-EVs-H-let was significantly increased (P < 0.001), demonstrating that engineered vesicles can efficiently deliver functional let-7a-5p to recipient cells.

[0140] Experimental Example 10: Validation of the in vitro antitumor function of MSC-EVs-H-let

[0141] A549 cells were divided into three groups: control group (PBS), MSC-EVs-H group (20 μg / mL), and MSC-EVs-H-let group (20 μg / mL, prepared with optimal parameters). Functional experiments were performed 48 hours after treatment.

[0142] 10.1 CCK-8 proliferation experiment (method as in Experiment 6.1)

[0143] The results are as follows Figure 30 As shown, compared with the control group and the MSC-EVs-H group, the proliferation capacity of A549 cells in the MSC-EVs-H-let group was significantly reduced (P < 0.001).

[0144] 10.2 Transwell migration and invasion experiments (methods same as in Experiment 6.2)

[0145] The results are as follows Figure 31 As shown, MSC-EVs-H-let treatment significantly inhibited the migration and invasion abilities of A549 cells (P < 0.01).

[0146] Experimental Example 11: Evaluation of the in vivo antitumor effect of MSC-EVs-H-let (nude mouse subcutaneous xenograft model)

[0147] 11.1 Establishment of a subcutaneous xenograft model

[0148] Six-week-old female BALB / c nude mice (weighing 18-20 g, purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) were subcutaneously inoculated with A549 cell suspension (5 × 10⁻⁶ g) in the right axilla. 6 Each tumor-bearing mouse was resuspended in 100 μL PBS. When the tumor volume grew to approximately 100 mm³ (approximately 7 days), the tumor-bearing mice were randomly divided into three groups (6 mice per group): PBS control group, MSC-EVs-H group (100 μg / mouse, based on total protein), and MSC-EVs-H-let group (100 μg / mouse). The drugs were administered via tail vein injection every 3 days for a total of 4 weeks.

[0149] 11.2 Tumor volume and weight measurement

[0150] Every 3 days, the long diameter (L) and short diameter (W) of the tumor were measured using calipers. The tumor volume was calculated using the formula V = (L × W²) / 2, and a tumor growth curve was plotted. On the 3rd day after the last administration, the mice were sacrificed, and the tumor tissue was dissected and weighed. The results are as follows: Figures 32-33As shown, compared with the PBS control group and the MSC-EVs-H group, the tumor volume growth in the MSC-EVs-H-let group was significantly slowed down (P < 0.01), and the tumor weight at the endpoint was significantly reduced (P < 0.01), indicating that engineered hybrid vesicles can effectively inhibit the growth of NSCLC subcutaneous xenografts in vivo.

[0151] Statistical methods

[0152] All data are expressed as mean ± standard deviation (Mean ± SD). One-way ANOVA was used for comparisons among multiple groups, and Student's t-test was used for comparisons between two groups. P < 0.05 was considered statistically significant, as were P < 0.01 and P < 0.001.

[0153] Experimental Results Section:

[0154] (1) Preparation and identification of extracellular vesicles derived from hUCMSCs and A549 cell membrane hybrid MSC-EVs-H

[0155] To obtain extracellular vesicles (EVs) derived from human umbilical cord-derived mesenchymal stem cells (hUCMSCs), hUCMSCs were first isolated and cultured. Morphological observation showed that hUCMSCs grew in a monolayer adherent state and exhibited fibroblast-like morphology. Figure 1 Differentiation potential identification results showed that: Alizarin Red S staining revealed calcium phosphate deposition (osteogenic induction), Oil Red O staining revealed lipid droplets (adipogenic induction), and Alcian Blue staining revealed proteoglycans (chondrogenic induction), indicating that hUCMSCs possess multi-directional differentiation capacity. Figure 1 Flow cytometry analysis showed that hUCMSCs highly expressed CD73 (98.63%), CD90 (98.94%), and CD105 (99.28%), and expressed low levels of CD45 (0.82%). Figure 2 The above results indicate that hUCMSCs have been successfully isolated from the umbilical cord.

[0156] Hybridized MSC-EVs (MSC-EVs-H) were prepared by fusing extracellular vesicles derived from human umbilical cord mesenchymal stem cells (MSC-EVs) with A549 cell membranes using an ultrasonic fusion method. Transmission electron microscopy (TEM) observation showed that the vesicles had similar morphology before and after fusion. Figure 3Nanoparticle size analysis results showed that the average particle sizes of MSC-EVs and MSC-EVs-H were 116.53 nm and 118.03 nm, respectively. Figure 4 Western blot results showed that both expressed high levels of CD9, CD81, and TSG101, but not Calnexin. Figure 5 The Zeta potentials were -28.69 mV and -29.77 mV, respectively. Figure 6 This indicates that the vesicle size and potential remained essentially unchanged after membrane fusion. No significant change in MSC-EVs-H particle size was observed after storage at -80°C, suggesting good stability. Figure 7 ).

[0157] To verify the fusion effect, FRET technology was used to label MSC-EVs with DiD and DiI. Figure 8 Under 549 nm excitation, after the addition of the A549 cell membrane, only the DiI fluorescence signal was detected at 575 nm, and the DiD fluorescence decreased significantly. Figure 9 As the amount of A549 cell membrane increased, fluorescence at 575 nm gradually recovered, while fluorescence at 670 nm gradually decreased. Figure 10 This suggests that the FRET effect is weakened due to membrane dispersion. A distinct yellow fluorescent co-localization signal was observed in DiO / DiD-MSC-EVs-H, while it was almost absent in the physical mixture. Figure 11-13 This directly confirms the successful fusion of MSC-EVs with the A549 cell membrane. SDS-PAGE and Western blot results show that MSC-EVs-H retains the characteristic proteins of the A549 cell membrane, E-cadherin, CD44, and CD47 (…). Figure 14-15 This indicates that the target-related proteins were well integrated. Functional experiments showed that MSC-EVs-H treatment did not affect the proliferation of A549 cells, but significantly inhibited their migration and invasion abilities. Figure 16-18 The above results demonstrate the successful construction of a hybrid vesicle, MSC-EVs-H, combining MSC-EVs and the A549 cell membrane. This vesicle exhibits good structural stability and retains the targeting protein characteristics of the A549 cell membrane, laying a foundation for subsequent engineered miRNA loading and targeted therapy research.

[0158] (2) Homologous targeting ability and cellular uptake mechanism of MSC-EVs-H

[0159] To evaluate the homologous targeting ability of MSC-EVs-H, HBE (normal bronchial epithelium), AGS (gastric cancer) cells, and A549 cells were co-incubated with MSC-EVs-H, respectively. Figure 19As shown, the intensity of red fluorescence detected in A549 cells was significantly higher than that in AGS and HBE cells. Furthermore, the internalization of MSC-EVs-H by A549 cells was significantly enhanced. Figure 20 This indicates that MSC-EVs-H possesses good homologous targeting ability in vitro. The targeting efficiency of MSC-EVs-H was quantitatively analyzed by flow cytometry. Figure 21 The results showed that after co-culturing A549 cells with MSC-EVs-H, the uptake rate was approximately 95.83%, while the uptake rates of AGS and HBE cells were approximately 5.52% and 10.74%, respectively. To investigate the endocytosis pathway of MSC-EVs-H in A549 cells, cells were treated with different endocytosis inhibitors, and the results were analyzed by flow cytometry. The results indicated that each inhibitor could inhibit the uptake of MSC-EVs-H by cells to varying degrees. Figure 22 The above results suggest that the uptake of MSC-EVs-H by A549 cells may involve multiple endocytic pathways or interactions mediated by multiple targets. These results indicate that MSC-EVs-H possesses a highly selective homologous targeting ability for NSCLC cells, and its cellular uptake may be mediated synergistically through multiple endocytic pathways.

[0160] (3) Construction and validation of hybrid vesicle MSCs-EVs-H-let fused with A549 membrane and loaded with let-7a-5p

[0161] MSC-EVs are rich in five highly expressed miRNAs (miR-122-5p, miR-148a-3p, miR-486-5p, let-7a-5p, and miR-100-5p). The specific function of let-7a-5p in lung cancer is still unclear, so it was selected as the research subject. To determine the optimal let-7a-5p loading electroporation parameters, different voltages and pulse counts were used for optimization. The expression level of let-7a-5p was quantitatively detected by qRT-PCR. Simultaneously, an MSC-EVs-H group (without electroporation, iMSC-EVs-H) co-incubated only with let-7a-5p was set up to assess the basal incorporation level without electroporation. The results showed that when the pulse count was fixed at 5, the let-7a-5p loading level increased with increasing voltage; however, when the pulse count increased to 10, the loading level decreased significantly, becoming comparable to the iMSC-EVs-H group (without electroporation). Figure 23 The loading efficiency was highest at 850 V and 5 pulses, under which the let-7a-5p level was increased by approximately four orders of magnitude compared to the baseline level and by approximately four times compared to the simple incubation group. Figure 23 NTA analysis showed that, compared with the simple incubation group, the vesicle concentration was slightly lower under these conditions. Figure 24 The particle size distribution remains basically unchanged. Figure 25 TEM observation showed that electroporation did not alter the morphology or membrane integrity of MSC-EVs-H. Figure 26 This indicates that engineered vesicles maintain good stability.

[0162] To verify the cellular uptake and delivery efficiency of MSC-EVs-H-let, A549 cells were treated with PKH67-labeled MSC-EVs, MSC-EVs-H, and MSC-EVs-H-let, respectively. The results showed that the internalization degree of MSC-EVs-H and MSC-EVs-H-let in A549 cells was significantly higher than that of native MSC-EVs (…). Figure 27 ); The expression level of let-7a-5p in A549 cells of the MSC-EVs-H-let treatment group was significantly increased ( Figures 28-29 Functional experiments showed that MSC-EVs-H-let significantly inhibited the proliferation, migration, and invasion of A549 cells. Figures 30-31 Furthermore, in vivo subcutaneous tumorigenesis experiments in nude mice showed that MSC-EVs-H-let significantly reduced the volume and weight of transplanted tumors, consistent with in vitro cell experiments. Figures 32-33 The above results demonstrate the successful construction of let-7a-5p engineered heterozygous vesicles MSC-EVs-H-let. These vesicles maintain good structural stability, efficiently deliver let-7a-5p to A549 cells, and significantly inhibit their malignant phenotype.

[0163] Data are expressed as mean ± standard deviation (Mean ± SD); * p < 0.05, ** p < 0.01, *** p < 0.001, compared with the control group NC.

[0164] The above are merely preferred embodiments of the present invention and are not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. An engineered hybrid vesicle derived from mesenchymal stem cells, characterized in that, It was obtained by fusing extracellular vesicles derived from mesenchymal stem cells with the A549 cell membrane.

2. The engineered hybrid vesicle according to claim 1, characterized in that, include: E-cadherin, CD44, and CD47.

3. The engineered hybrid vesicle according to claim 1 or 2, characterized in that, include: CD9, CD81, and TSG101.

4. The use of an engineered hybrid vesicle according to any one of claims 1-3 as a let-7a-5p delivery vector.

5. The use of the engineered hybrid vesicles according to any one of claims 1-3 in the preparation of a therapeutic drug for non-small cell lung cancer.

6. The application according to claim 5, characterized in that, The non-small cell lung cancer treatment drugs include engineered hybrid vesicles derived from mesenchymal stem cells and let-7a-5p.

7. The application according to claim 6, characterized in that, Engineered hybrid vesicles derived from mesenchymal stem cells were loaded with let-7a-5p via electroporation.

8. The application according to claim 7, characterized in that, The voltage of the electroporation process is 650-950V, and the number of pulses is 5-10.

9. A method for preparing engineered hybrid vesicles according to any one of claims 1-3, characterized in that, Extracellular vesicles derived from mesenchymal stem cells were mixed with A549 cell membranes and then subjected to ultrasonic treatment, water bath treatment, and centrifugation to obtain engineered hybrid vesicles.

10. The preparation method according to claim 9, characterized in that, The extraction process of the A549 cell membrane includes: adding A549 cells to a membrane protein extraction buffer, followed by a lysis step, an ultrasonic disruption step, and a first centrifugation step to obtain a supernatant; the supernatant is then subjected to a second centrifugation step to obtain the A549 cell membrane. Extracellular vesicles derived from mesenchymal stem cells were extracted from the supernatant of mesenchymal stem cells using differential ultracentrifugation.

Images