Hadh a protein, gene, vector, cell, composition and use thereof

Abstract

The application provides a HADHA protein, gene, vector, cell, composition and application thereof. In the liver of a db / db mouse model and a db / db-iER mouse model of T2DM combined with MASLD, the application finds and identifies a HADHA protein with significant difference acetylation modification and an acetylation site K353 of the HADHA protein, the acetylation modification of the HADHA protein is related to liver lipid deposition, and the HADHA protein can be used as a biological marker for assisting in diagnosis and judging the severity of the disease in the future. The HADHA protein mutant in the application is obtained by mutating the 353th lysine of the wild type HADHA protein into arginine, the HADHA-K353R mutation enhances the enzyme activity and stability, inhibits lipid deposition, reduces insulin resistance, hinders the combination with ASC, and helps to inhibit the expression of inflammatory cytokines.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, and in particular relates to a HADHA protein, gene, vector, cell, composition and its application. Background Technology

[0002] Metabolic dysfunction-associated fatty liver disease (MASLD), formerly known as non-alcoholic fatty liver disease (MASLD), along with type 2 diabetes mellitus (T2DM), has become a global public health problem. The coexistence of MASLD and T2DM increases the risk of various intrahepatic and extrahepatic adverse events, leading to metabolic deterioration and increased all-cause mortality. MASLD is characterized by excessive fat accumulation in the liver, which triggers inflammation and liver damage (i.e., metabolic dysfunction-associated steatohepatitis, MASH), ultimately leading to liver fibrosis, cirrhosis, and even hepatocellular carcinoma. There is a bidirectional promoting relationship between MASLD and T2DM, accelerating disease progression, suggesting that treatment for MASLD can improve glycemic control in these comorbid patients. Currently, intermittent energy restriction (iER) is used clinically as a first-line non-pharmacological intervention for the comorbidity of MASLD and T2DM. iER refers to a dietary intervention pattern of periodically alternating low-calorie intake and normal eating, which activates metabolic regulatory mechanisms through short-term energy restriction, thereby positively impacting the comorbidity of MASLD and T2DM.

[0003] HADHA is the α subunit of the mitochondrial trifunctional protein (MTP), an important factor in lipid metabolism, with a molecular weight of approximately 78-83 kDa. HADHA possesses long-chain 3-hydroxyacylcoenzyme A dehydrogenase (LCHAD) and enoyl-coenzyme A hydratase (ECH) activities. Although HADHA protein is associated with MASLD and T2DM comorbidities, the key mechanisms between HADHA protein and these comorbidities remain unclear, and research on HADHA protein mutants related to MASLD and T2DM comorbidities is lacking.

[0004] Therefore, it is necessary to provide a HADHA protein, gene, vector, cell, composition and its application to solve the technical problem of how to obtain HADHA mutants associated with MASLD and T2DM comorbidities. Summary of the Invention

[0005] The main objective of this invention is to provide a HADHA protein, gene, vector, cell, composition, and its application to solve the technical problem of how to obtain HADHA mutants associated with MASLD and T2DM comorbidities.

[0006] To achieve the above objectives, the present invention provides a HADHA protein mutant, the amino acid sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides a mutant gene that encodes a HADHA protein mutant as described above.

[0008] Furthermore, the nucleotide sequence of the mutated gene is shown in SEQ ID NO.2.

[0009] The present invention also provides an expression vector having any of the mutant genes described above.

[0010] The present invention also provides an engineered cell having any of the mutant genes described above.

[0011] The present invention also provides the application of any of the HADHA protein mutants described above in the preparation of a therapeutic drug for T2DM combined with MASLD.

[0012] The present invention also provides the application of any of the mutant genes described above in the preparation of therapeutic drugs for T2DM combined with MASLD.

[0013] The present invention also provides the use of any of the above-described HADHA protein mutants or mutant genes in the preparation of inhibitors, wherein the inhibitors include at least one of inflammation inhibitors, lipid accumulation inhibitors, and insulin resistance inhibitors.

[0014] The present invention also provides a composition for detecting HADHA protein mutants, wherein the composition for detecting HADHA protein mutants uses any of the HADHA protein mutants described above as detection targets.

[0015] The present invention also provides a composition for detecting mutated genes, wherein the composition for detecting mutated genes uses any of the mutated genes described above as detection targets.

[0016] The beneficial effects of the present invention include at least the following: This invention mutates the wild-type human HADHA protein, changing amino acid position 353 from lysine K to arginine R, resulting in the HADHA-K353R protein mutant. Acetylation modifications of HADHA at different lysine sites can regulate different biological functions, even leading to opposite regulatory outcomes. Data from this invention show that the HADHA-K353R mutation enhances enzyme activity and stability, inhibits lipid deposition, alleviates insulin resistance, and hinders its binding to ASCs, thus helping to suppress the expression of inflammatory cytokines. In summary, based on research on MASLD and T2DM comorbidities, this invention, through targeted mutation of the HADHA protein, yields a HADHA mutant with higher enzyme activity and stability than the wild-type HADHA protein, and at least exhibits inhibitory effects on inflammation, lipid accumulation, and insulin resistance. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention.

[0018] Figure 1 In Example 1 of this invention, based on the liver proteome and acetylated proteome of the iER intervention group (db / db_iER) and the model group (db / db), the total protein, differentially expressed protein, and acetylated differentially expressed protein are shown in the Venn diagram to illustrate the overlap between the differentially expressed acetylated protein and all identified proteins and differentially expressed proteins. Figure 1 In this context, Acetylation-DEP refers to acetylated differentially expressed proteins in the acetylation proteome, Proteome-All refers to all proteins in the proteome, Proteome-DEP refers to differentially expressed proteins in the proteome, and Hadha refers to the α subunit of the hydroxyacyl-CoA dehydrogenase trifunctional multienzyme complex. Figure 2 In Example 1 of this invention, the liver protein acetylation group based on the iER intervention group (db / db_iER) and the model group (db / db) identifies the pivotal acetylated proteins and Hadha direct and indirect interacting proteins from the protein-protein interaction network of differentially expressed acetylated proteins. Figure 3 In Embodiment 1 of the present invention, the liver protein acetylation profile based on the iER intervention group (db / db_iER) and the model group (db / db) includes a heatmap of differentially acetylated proteins involving direct and indirect interactions with Hadha. Figure 4In Example 1 of this invention, based on the intersection analysis of transcriptomics, proteomics and acetylation, genes or proteins with significant changes in mRNA expression, protein expression and acetylation levels in the liver of db / db mice after iER intervention were identified. Figure 4 In the graph, a is a scatter plot of the relationship between changes in RNA expression and changes in protein expression (labeled with changes in Hadha), b is a scatter plot of the relationship between changes in protein expression and changes in acetylated protein expression (labeled with changes in Hadha), c is a scatter plot of the relationship between changes in RNA expression and changes in acetylated protein expression (labeled with changes in Hadha), db / db_iER vs. db / db refers to the comparison between the iER intervention group (db / db_iER) and the model group (db / db) in db / db mice, Log2FC_RNA expression refers to the logarithmic value of the fold change in RNA expression level (base 2), Log2FC_Protein acetylation refers to the logarithmic value of the fold change in acetylated protein expression level (base 2), and Log2FC_Proteinexpression refers to the logarithmic value of the fold change in protein expression level (base 2). Figure 5 In Example 1 of this invention, based on protein acetylation analysis, mass spectrometry analysis identified a HADHA-derived peptide containing acetylated Lys 353 from mouse liver; Figure 5 In this context, "Relative abundance" refers to the relative abundance of different ions, "Mass analyzer" refers to a mass analyzer, "Score" refers to the score, "m / z" refers to the mass-to-charge ratio, and "Proteins" refers to proteins. Figure 6 In Embodiment 1 of the present invention, based on the PhosphoSitePlus database, PhosphoSitePlus bar graphs are used to display the post-translational modification sites of mouse Hadha protein. Figure 6 In this context, "Total number of references" refers to the total number of references, and "Residue number" refers to the residue number. Figure 7 Bright-field and fluorescence images of MIHA cells transfected with HADHA-K353R (K353R) in Example 2 of this invention; Figure 7 In this context, oe-HADHA-K353R refers to the overexpression of the K353R mutant HADHA, GFP refers to green fluorescent protein, and Bright Field refers to bright field. Figure 8The Co-IP experiment in Example 2 of this invention was used to verify the deacetylation modification of HADHA-K353R; Figure 8 In this context, Vector refers to the empty vector control, HADHA-WT refers to wild-type HADHA, HADHA-K353R refers to K353R mutant HADHA, IP: Flag refers to hybridization of Flag magnetic beads with total protein lysate, IB: Ace-lys refers to Western blot: panacetylated lysine, IB: Flag refers to Western blot: Flag-tagged protein, Input: HADHA refers to the basal expression level of HADHA in total protein lysate, and Input: β-actin refers to the basal expression level of internal control protein in total protein lysate. Figure 9 This is an example of comparing the relative enzyme activities in MIHA cells overexpressing HADHA-WT and HADHA-K353R in Example 2 of the present invention; Figure 9 In the middle, Relative enzyme activity refers to the relative enzyme activity of HADHA, Vector refers to the empty vector plasmid group, HADHA refers to the wild-type HADHA group, and HADHA-K353R refers to the HADHA-K353R mutant group. Figure 10 In Example 2 of this invention, the relative HADHA enzyme activity was measured in HADHA-K353R MIHA cells treated with or without HGHF + LPS. Figure 10 In this context, Vector refers to the empty vector plasmid group; Vector+Model refers to the treatment of MIHA cells with high sugar and high fat after transfection with wild-type empty vector plasmid using lentivirus; HADHA refers to the wild-type HADHA group; HADHA+Model refers to the treatment of MIHA cells with high sugar and high fat after transfection with wild-type HADHA plasmid using lentivirus; K353R+Model refers to the treatment of MIHA cells with high sugar and high fat after transfection with mutant HADHA-K353R plasmid using lentivirus; and Relative enzyme activity refers to the relative enzyme activity of HADHA. Figure 11 In Example 2 of this invention, Western blot was used to detect insulin resistance and inflammation-related indicators in different groups of MIHA cells, including HADHA, HADHA+ model, and HADHA-K353R+ model groups. Figure 11In this context, HADHA-WT refers to the transfection of wild-type HADHA plasmid with lentivirus into MIHA cells; HADHA-WT+Model refers to the transfection of wild-type HADHA plasmid with lentivirus into MIHA cells followed by high-sugar, high-fat treatment; K353R+Model refers to the transfection of mutant HADHA-K353R plasmid with lentivirus into MIHA cells followed by high-sugar, high-fat treatment; HADHA refers to the target protein HADHA; p-AKT refers to phosphorylated AKT (reflecting insulin sensitivity); AKT refers to total AKT (reflecting insulin sensitivity); Mature-IL-1β refers to the mature form of the inflammatory cytokine interleukin-IL-1β; pro-IL-1β refers to the precursor of the inflammatory cytokine interleukin-IL-1β; IL-18 refers to the inflammatory cytokine interleukin-18; and β-Actin refers to the internal reference protein. Figure 12 for Figure 11 Quantitative analysis of insulin resistance and inflammation-related indicators in different groups of MIHA cells using Western blotting; Figure 12 In the diagram, HADHA (top left) refers to wild-type HADHA plasmid transfected with lentivirus in MIHA cells; HADHA+Model refers to MIHA cells transfected with wild-type HADHA plasmid with lentivirus followed by high-sugar, high-fat treatment; K353R+Model refers to MIHA cells transfected with mutant HADHA-K353R plasmid with lentivirus followed by high-sugar, high-fat treatment; HADHA (horizontal axis) refers to the target protein HADHA; p-AKT / AKT refers to the comparison between phosphorylated AKT and total AKT; Mature-IL-1β refers to the mature form of the inflammatory cytokine interleukin-IL-1β; pro-IL-1β refers to the precursor of the inflammatory cytokine interleukin-IL-1β; IL-18 refers to the inflammatory cytokine interleukin-18; and Relative protein expression refers to the relative expression level after Western blot analysis. Figure 13 The Co-IP experiment in Example 2 of this invention was used to determine the acetylation of HADHA in the HADHA, HADHA+ model and HADHA-K353R+ model groups; Figure 13In the text, Vector refers to the empty vector control group, HADHA-WT refers to the wild-type HADHA group, HADHA-WT+Model refers to the wild-type HADHA group cultured in high glucose and high fat, K353R+Model refers to the HADHA-K353R mutant cultured in high glucose and high fat, IP: Flag refers to hybridization of Flag magnetic beads with total protein lysate, IB: Ace-lys refers to Western blot: panacetylated lysine, IB: Flag refers to Western blot: Flag-tagged protein, Input: Flag refers to the expression level of Flag protein in total protein lysate, and Input: β-actin refers to the basal expression level of internal reference protein in total protein lysate. Figure 14 Oil Red O staining and Nile Red staining were performed on different groups of MIHA cells in Example 2 of this invention; Figure 14 In this context, Lenti-Vector refers to the empty vector plasmid group transfected by lentivirus, Vector+Model refers to the empty vector plasmid group transfected by high sugar and high fat treatment, Lenti-HADHA refers to the wild-type HADHA plasmid group transfected by lentivirus, HADHA+Model refers to the wild-type HADHA plasmid group transfected by lentivirus transfected by high sugar and high fat treatment, K353R+Model refers to the HADHA-K353R mutant plasmid group transfected by lentivirus transfected by high sugar and high fat treatment, Oil Red O refers to Oil Red O staining, and Nile Red refers to Nile Red staining. Figure 15 for Figure 14 Quantitative analysis of Oil Red O staining in different groups of MIHA cells, including Vector+ model, HADHA+ model and K353R+ model groups; Figure 15 In this context, Vector+Model refers to the empty vector plasmid group treated with high sugar and high fat, HADHA+Model refers to the HADHA wild-type plasmid group transfected with lentivirus treated with high sugar and high fat, K353R+Model refers to the HADHA-K353R mutant plasmid group transfected with lentivirus treated with high sugar and high fat, and Relative Oil red O intensity refers to the relative quantitative intensity of Oil Red O staining. Figure 16 for Figure 14 Quantitative analysis of Nile Red staining in Vector+, HADHA+, and K353R+ models of MIHA cells in different groups; Figure 16In this context, Vector+Model refers to the empty vector plasmid group treated with high sugar and high fat, HADHA+Model refers to the HADHA wild-type plasmid group transfected with lentivirus treated with high sugar and high fat, K353R+Model refers to the HADHA-K353R mutant plasmid group transfected with lentivirus treated with high sugar and high fat, and Relative Nile Red intensity refers to the relative quantitative intensity of Nile Red staining. Figure 17 This is a structural diagram of the docking model of the HADHA (purple) and ASC (brown) complex based on molecular docking analysis in Example 3 of the present invention; Figure 18 The ASC structural conformational change induced by the HADHA-K353R mutant in Example 3 of this invention; the predicted HADHA-K353R structure is represented by a green box by AlphaFold2, while the natural HADHA-WT structure is represented by a purple box. Figure 19 This is a co-immunoprecipitation analysis used in Example 3 of the present invention to detect the interaction between HADHA or HADHA-K353R and ASC. Figure 19 In this context, Vector refers to the empty vector control group, HADHA-WT refers to the HADHA wild-type plasmid overexpressing group, HADHA-WT+Model refers to the HADHA wild-type plasmid transfected with lentivirus under high sugar and high fat treatment, HADHA-K353R+Model refers to the HADHA-K353R mutant plasmid transfected with lentivirus under high sugar and high fat treatment, IP: Flag refers to hybridization of the Flag magnetic beads with the total protein lysate, IB: ASC refers to the immunoblot: ASC protein, IB: Flag refers to the immunoblot: Flag tag protein, Input: HADHA refers to the basal expression level of HADHA in the total protein lysate, and Input: β-actin refers to the basal expression level of the internal reference protein in the total protein lysate.

[0019] The realization of the objective, functional characteristics and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0020] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0021] Furthermore, the technical solutions of the various embodiments of the present invention can be combined with each other, but only if they are based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.

[0022] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the molecular genetics, nucleic acid chemistry, and molecular biology-related terms and laboratory procedures used herein are all widely used terms and routine procedures in their respective fields. To better understand this invention, definitions and explanations of relevant terms are provided below.

[0023] This invention provides a HADHA protein mutant, the amino acid sequence of which is shown in SEQ ID NO.1.

[0024] The amino acid sequence shown in SEQ ID NO.1 is as follows: .

[0025] The present invention also provides a mutant gene that encodes any of the HADHA protein mutants described above; specifically, the nucleotide sequence of the mutant gene is shown in SEQ ID NO.2.

[0026] The nucleotide sequence shown in SEQ ID NO.2 is as follows:

[0027] The mutant HADHA protein of the present invention is obtained by mutating lysine at position 353 of the human wild-type HADHA protein to arginine; in the present invention, the amino acid sequence of the human wild-type HADHA protein is shown in SEQ ID NO.3, and the nucleotide sequence encoding the human wild-type HADHA protein is shown in SEQ ID NO.4.

[0028] The amino acid sequence shown in SEQ ID NO.3 is as follows: .

[0029] The nucleotide sequence shown in SEQ ID NO.4 is as follows:

[0030] This invention identified and characterized significantly differentially acetylated HADHA protein and its acetylation site K353 in the livers of db / db mouse models of type 2 diabetes mellitus (T2DM) combined with hepatic lipid deposition and could serve as a biomarker to aid in diagnosis and assess disease severity. This invention achieves deacetylation through the HADHA-K353R mutation and demonstrates that K353 is a key site for HADHA to exert its enzymatic activity. The HADHA-K353R mutation can enhance enzyme activity and stability, and could serve as a target for antibody preparation and the development of therapeutic drugs for T2DM combined with hepatic lipid deposition.

[0031] In this invention, the method for determining HADHA enzyme activity is as follows: Samples are homogenized for 10 minutes by sonication (on ice bath conditions, in a buffer solution containing 75 mM tris(hydroxymethyl)aminomethane (pH 10), 75 mM potassium chloride, and 1.2 mM NAD+), followed by centrifugation at 8000 × g for 10 minutes at 4°C. The supernatant is collected, and the reaction is initiated by adding 3-hydroxypalmitoyl-CoA (C16) as a substrate. The reaction mixture contains 100 μL of supernatant, 20 μL of NAD+ (1.2 mM), 10 μL of substrate (125 μM), 66 μL of buffer solution, and 4 μL of WST-8 reagent (containing WST-8 and 1-methylpropenesulfonamide) in each well of a 96-well plate. The initial absorbance at 450 nm is recorded as a baseline using a microplate reader. After incubation at 37°C for 30 minutes, the development value of the colorimetric reaction is recorded as the final reading. HADHA enzyme activity is expressed as the difference in absorbance between two readings, corrected for protein concentration, to give units of enzyme activity per microgram of protein. One unit of enzyme activity is defined as the reduction of 1 mM NADH per minute corresponding to 1 mg of protein. Results are presented as a percentage of the control group.

[0032] The present invention also provides an expression vector having any of the mutant genes described above.

[0033] The present invention also provides an engineered cell having any of the mutant genes described above; the engineered cell is used to express the HADHA protein mutant.

[0034] In this invention, the method for obtaining the engineered cells includes: inserting the full-length cDNA of the HADHA protein mutant into the pCDH-CMV-MCS-EF1-GFP+Puro vector to generate the Flag-HADHA-K353R plasmid; co-transfecting the pCDH-HADHA plasmid with the packaging plasmids psPAX2 and pMD2.G into HKT293T cells to prepare a virus-like solution; collecting the viral supernatant after transfection and using it to infect the target hepatocyte MIHA cells; and obtaining the engineered cells after screening.

[0035] The present invention also provides the application of any of the HADHA protein mutants described above in the preparation of a therapeutic drug for T2DM combined with MASLD.

[0036] In this invention, T2DM combined with MASLD refers to type 2 diabetes mellitus combined with metabolic dysfunction-related fatty liver disease.

[0037] The present invention also provides the application of any of the mutant genes described above in the preparation of therapeutic drugs for T2DM combined with MASLD.

[0038] The present invention also provides the use of any of the above-described HADHA protein mutants or mutant genes in the preparation of inhibitors, wherein the inhibitors include at least one of inflammation inhibitors, lipid accumulation inhibitors, and insulin resistance inhibitors.

[0039] In this invention, the deacetylation of the HADHA-K353R mutation enhances enzyme activity and stability, thereby reducing lipid accumulation and insulin resistance in MIHA cells induced by LPS combined with HGHF, similar to iER intervention; furthermore, the deacetylation of the HADHA-K353R mutation in this invention can block its binding to the inflammasome linker ASC.

[0040] The present invention also provides a composition for detecting HADHA protein mutants, wherein the composition for detecting HADHA protein mutants may exist in the form of a HADHA protein mutant detection reagent, wherein the HADHA protein mutant detection reagent uses any of the HADHA protein mutants described above as detection targets.

[0041] The present invention also provides a composition for detecting mutated genes, wherein the composition for detecting mutated genes may exist in the form of a mutated gene detection reagent, wherein the mutated gene detection reagent uses any of the mutated genes described above as detection targets.

[0042] The following are specific examples of the present invention: Example 1 Animal experiments: Ten-week-old male diabetic db / db mice (BKS.Cg-+ Lepr db / + Lepr db / Jcl) (suffering from type 2 diabetes and fatty liver) and similarly aged male C57BLKS / JGpt mice (WT) were purchased as healthy control groups. The mice were purchased from Jiangsu Jicui Pharmaceutical Co., Ltd. and were acclimatized in the laboratory for 2 weeks (at which time the mice were 12 weeks old) before being used for subsequent experiments.

[0043] All experimental mice were housed in a pathogen-free environment with a 12-hour light / 12-hour dark cycle, an ambient temperature of 20-24℃, and a relative humidity of 50%±10%. All mice had free access to drinking water throughout the experiment.

[0044] db / db mice were randomly divided into two groups: the db / db group and the db / db_iER group, with 6 mice in each group; age-matched male wild-type mice were used as the normal control group (n=6).

[0045] Mice in the db / db group were fed a standard diet without any restrictions. Mice in the db / db_iER group received the iER protocol, which involves a cyclical feeding pattern; each cycle consists of 4 days of a low-calorie CMNT diet (providing 50% of their normal daily energy intake on day 1 and 10% on days 2 through 4), followed by 7 days of free access to standard mouse feed, repeated for a total of 7 cycles. Before being given the CMNT diet, the mice were transferred to new, sterilized cages to prevent fecal ingestion or consumption of leftover feed.

[0046] Experimental results and analysis: By comparing proteomics and lysine acetylation data, it was found that only one metabolic enzyme, HADHA, showed significant changes at both levels, indicating that the proteome and lysine acetylationome may exhibit different structural morphologies due to iER intervention, and HADHA has become a core molecular target of iER. Figure 1 ).

[0047] Protein-protein interaction (PPI) analysis revealed that HADHA forms the central node of an interconnected protein module, highlighting its potential importance in metabolic regulation. Figures 2-3 ).

[0048] Cross-analysis of transcriptomics, proteomics, and acetylation showed that iER increased HADHA protein expression and decreased HADHA-K353 acetylation, but had no effect on transcriptional expression levels. Figure 4Given that the ubiquitin-proteasome system is the most common pathway for cellular protein degradation, it is hypothesized that the loss of HADHA acetylation modification induced by iER would enhance the stability of HADHA protein by inhibiting its ubiquitination degradation.

[0049] To investigate the functional acetylation sites of HADHA, MS / MS mass spectra of the protein were extracted from the acetylation dataset. The results showed that lysine (K) 353 is the major acetylation site of HADHA. Figure 5 ).

[0050] Quantitative analysis of acetylation showed that iER intervention reduced the acetylation level at the HADHA-K353 site to 0.448-fold, while other identified modification sites (including K759 and K760) did not show significant changes (Table 1). Post-translational modification annotation analysis using the PhosphoSitePlus database revealed that the HADHA K353 site exhibits dual modification characteristics of acetylation and ubiquitination, suggesting that it may play an important role in metabolic regulation. Figure 6 ).

[0051] Table 1. Comparison of the proportion and p-value of acetylated HADHA at different sites between db / db_iER and db / db. Example 2 Mutation and functional analysis of HADHA-K353R: 1. In order to understand the metabolic effects of deacetylated HADHA-K353, this embodiment mutated lysine (K)353 to arginine. This amino acid has the same charge as lysine, but cannot be acetylated.

[0052] (1) Stable expression of HADHA in the MIHA cell line (HADHA-WT): A blank pCDH-CMV-MCS-EF1-GFP+Puro vector was purchased from Hunan Fenghui Biotechnology Co., Ltd. The full-length cDNA of human HADHA was inserted into the pCDH-CMV-MCS-EF1-GFP+Puro vector to generate the Flag-HADHA plasmid. In this invention, the amino acid sequence of human HADHA is shown in SEQ ID NO.3, and the nucleotide sequence encoding human HADHA is shown in SEQ ID NO.4.

[0053] To establish a stable MIHA cell line expressing HADHA, the pCDH-HADHA plasmid was co-transfected with the packaging plasmids psPAX2 and pMD2.G (Fenghui Biotechnology) into HKT293T cells to prepare a virus-like solution. Viral supernatant was collected 48 hours after transfection and used to infect MIHA cells. Cell lines were screened in 1640 medium containing 2.5 μg / mL Puromycin. Puromycin-resistant cells were isolated and cultured to obtain HADHA-WT cells.

[0054] (2) HADHA mutation (HADHA-K353R): The HADHAWT plasmid expressing the human KR mutant (by converting the lysine residue of human HADHA to arginine) was constructed using the Mut Express II Rapid Mutation Kit V2 (Vazyme). The mutation occurred at lysine 353 of human HADHA, resulting in K353R. In this invention, the amino acid sequence of HADHA-K353R is shown in SEQ ID NO.1, and the nucleotide sequence encoding HADHA-K353R is shown in SEQ ID NO.2.

[0055] Point mutations were generated by segmental amplification and overlapping extension PCR using primers. All introduced mutations were verified by DNA sequencing. To stably express HADHA-K353R in the MIHA cell line, the plasmid was subsequently processed in the same manner as the HADHA-WT plasmid, resulting in the corresponding MIHA cell line HADHA-K353R.

[0056] Primer sequences used for mutation: HADHA_K353(Point A): Forward: GAATcgaTTTGGAGCTCCACAGAAGGATG; Reverse: GAGCTCCAAAtcgATTCTTCTTGCACAGGACCTGAC.

[0057] HADHA-353_8370(Point B): Forward: CCGACAGGACTATAAAAGATACCAGGCGTTTCCCC; Reverse: CTTTATAGTCCTGTCGGGTTTCGCC.

[0058] 2. Culture of HADHA-WT cells and HADHA-K353R cells: (1) Cell-passage culture: HADHA-WT cells, HADHA-K353R cells and lenti-Vector cells were cultured in RPMI-1640 medium (Invitrogen) containing 2 g / L glucose, with 10% fetal bovine serum and 1% penicillin-streptomycin added, and cultured in a constant temperature incubator at 37℃ and 5% CO2.

[0059] (2) In vitro construction of comorbid MASLD and T2DM models, denoted as Model: HADHA-WT cells, HADHA-K353R cells, and lenti-Vector cells were cultured in RPMI-1640 medium containing 40mM glucose and 0.5mM free fatty acids (oleic acid: palmitic acid, molar ratio = 2:1, Thermo Fisher) (dissolved in 0.5% fat-free BSA) for 48 hours, followed by the addition of 1μg / mL LPS (lipopolysaccharide) for 24 hours.

[0060] Experimental results and analysis: The deacetylation process following HADHA-K353R overexpression was confirmed using Co-IP experiments. Figures 7-8 MIHA cells transfected with the FLAG-tagged HADHA mutant expression plasmid (HADHA-K353R) significantly increased HADHA enzyme activity. Figure 9 ).

[0061] Compared with HADHA-WT, overexpression of HADHA-K353R significantly reduced the degree of HADHA acetylation, increased HADHA enzyme activity, significantly reduced intracellular lipid accumulation, and alleviated insulin-stimulated phosphorylation of AKT at Ser473 and the migration of GLUT2 membrane transporter in K. pneumoniae LPS-binding HGHHF-induced MIHA cells. Figures 10-16 ).

[0062] The above results indicate that deacetylation of HADHA-K353 enhances enzyme activity and stability, inhibits lipid deposition, and alleviates insulin resistance. This effect is similar to that of iER intervention in K. pneumoniae-derived LPS-HGHF-induced hepatocytes.

[0063] Example 3 HADHA-K353 deacetylation blocks its binding to the inflammasome linker ASC: (1) Molecular docking analysis: The three-dimensional structures of wild-type human HADHA (PDB ID: 6DV2) and full-length human ASC (PDB ID: 2KN6) were downloaded from the Protein Database (PDB). The three-dimensional structure of HADHA-K353R (same as in Example 2) was predicted using AlphaFold2. The docking between HADHA (wild-type and its mutants) and ASC was analyzed using the online platform HDOCK server (http: / / hdock.phys.hust.edu.cn / ).

[0064] All 100 possible docking models were analyzed to identify potential interaction surfaces between HADHA (wild type and its mutants) and ASC. Interaction sites between wild-type HADHA, its mutant K353R, and ASC were highlighted using the biomolecular visualization tool PyMOL. Binding differences between wild-type HADHA, its mutants, and ASC were compared, and structural images of wild-type HADHA and its mutants binding to ASC were generated.

[0065] (2) Western blotting and immunoprecipitation: Proteins were extracted from whole-cell lysates of cultured cells using RIPA lysis buffer (P0013B, Beyotime) supplemented with PMSF. Total protein concentration was determined using a BCA protein quantification kit (P0010S, Beyotime). Subsequently, equal volumes of designated protein samples were separated by 10–15% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes (66485, Pall, USA). Protein-loaded membranes were blocked with Tris-buffered saline-Tween-20 (TBST) containing 5% skim milk powder, incubated overnight at 4°C with the designated specific primary antibody, and then incubated with HRP-labeled secondary antibody. Protein signals were developed using enhanced chemiluminescence (ECL) substrate solution (WBKLS0500, Millipore), and images were acquired using an iBright FL1500 imaging system (Thermo Fisher Scientific, USA). β-Actin was used as an internal control for loading whole-cell lysates. The optical density values ​​of the protein immunoblot bands were quantitatively analyzed using ImageJ software.

[0066] For co-immunoprecipitation (Co-IP) experiments, cultured MIHA cells were lysed using IP lysis buffer (P0013, Beyotime, China). The supernatant was incubated overnight at 4°C with gentle shaking with anti-HADHA antibody or anti-Flag antibody. Mouse and rabbit-derived control IgG were used as negative controls. Antibody-protein complexes were captured by incubating Dynabeads™ Protein G magnetic beads (Thermo Fisher Sci., 10007D) at 4°C for 3 hours. The protein-bound magnetic beads were mixed with loading buffer, boiled at 100°C for 5 minutes, and then Western blotting was performed. To eliminate interference from antibody light chains, IPKine HRP-labeled goat anti-rabbit IgG HCS (A25222, Abbkine) was used as a secondary antibody, as appropriate.

[0067] Experimental results and analysis: Molecular docking analysis showed that the HADHA-K353 site can bind to ASC (docking score = -199.74). Figure 17 ).

[0068] To investigate whether deacetylation at the HADHA-K353 site hinders its binding to ASC, the HADHA-K353R structure was predicted using AlphaFold2. The HADHA-K353R mutant exhibited a lower binding energy to ASC (docking score = -167.94) and induced conformational changes in the ASC structure compared to the wild-type (WT). Figure 18 ).

[0069] Consistent with the results of molecular docking analysis, co-immunoprecipitation results indicated that, compared with the WT control, the HADHA-K353R mutation resulted in reduced binding to ASCs in cells. Figure 19 The above data indicate that HADHA-K353 deacetylation inhibits its binding to ASC, which helps suppress the expression of inflammatory cytokines.

[0070] The above technical solutions of the present invention are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. All equivalent structural transformations made under the technical concept of the present invention using the contents of the present invention specification and drawings, or direct / indirect applications in other related technical fields, are included in the patent protection scope of the present invention.

Claims

1. A HADHA protein mutant, characterized in that, The amino acid sequence of the HADHA protein mutant is shown in SEQ ID NO.

1.

2. A mutant gene, characterized in that, The mutant gene encodes the HADHA protein mutant as described in claim 1.

3. The mutant gene according to claim 2, characterized in that, The nucleotide sequence of the mutated gene is shown in SEQ ID NO.

2.

4. An expression carrier, characterized in that, The expression vector contains the mutated gene as described in claim 2 or 3.

5. An engineered cell, characterized in that, The engineered cells contain the mutated gene as described in claim 2 or 3.

6. The use of the HADHA protein mutant as described in claim 1 in the preparation of a therapeutic agent for T2DM combined with MASLD.

7. The use of the mutated gene as described in claim 2 or 3 in the preparation of a therapeutic agent for T2DM combined with MASLD.

8. The use of a HADHA protein mutant as described in claim 1 or a mutant gene as described in claim 2 or 3 in the preparation of an inhibitor, characterized in that, The inhibitors include at least one of the following: inflammation inhibitors, fat accumulation inhibitors, and insulin resistance inhibitors.

9. A composition for detecting HADHA protein mutants, characterized in that, The composition for detecting HADHA protein mutants uses the HADHA protein mutant as described in claim 1 as the detection target.

10. A composition for detecting mutated genes, characterized in that, The composition for detecting mutated genes uses the mutated gene as described in claim 2 or 3 as the detection target.

Images