A novel acetyl xylan esterase, its immobilization and application

Abstract

The application discloses a novel acetyl xylan esterase as well as immobilization and application thereof. The amino acid sequence of the novel acetyl xylan esterase is shown as SEQ ID NO. 1. The application constructs a recombinant plasmid and a recombinant host containing a coding gene of the acetyl xylan esterase. The enzyme has good acetyl hydrolysis activity and can be used for acetylated xylan degradation and bioconversion of astragalus saponins. The acetic acid yield after reaction with wheat bran can reach 359.27 mg / g. In the application of astragalus saponin I conversion, 2.5 mg of astragalus saponin I can generate 0.16 mg of astragaloside A after being treated by the acetyl xylan esterase BsAxe-3. The application constructs an immobilized acetyl xylan esterase BsAxe-3@MAF-6-PEI based on MAF-6-PEI, and the tolerance of the acetyl xylan esterase to temperature and pH change is improved.

Description

Technical Field

[0001] This invention belongs to the field of biological technology, specifically relating to a novel acetylxylan esterase and its immobilization and application. Background Technology

[0002] Xylan is a major component of hemicellulose and is abundant in agricultural waste such as wheat bran, wheat straw, and corn stalks. Degrading xylan in these wastes can release nutrients or fermentable sugars, thus contributing to agricultural production in several ways. Industrially, xylan degradation often employs acid or alkaline methods, but these processes are frequently accompanied by side reactions, producing numerous toxic substances that inhibit subsequent microbial fermentation. Furthermore, the resulting acid and alkaline wastewater poses a significant environmental burden. Therefore, enzymatic degradation of xylan, with its mild and environmentally friendly advantages, is poised to become the primary method for xylan degradation in the future.

[0003] Xylan is a heteropolysaccharide whose backbone consists of multiple xylanosyl groups linked by β-1,4-xylosidic bonds. Approximately 80% of xylan contains side chains, such as O-acetyl groups, L-arabinose residues, ferulic acid, and 4-O-methyl-D-glucuronic acid residues. Due to the complexity of its origin and structure, complete degradation of xylan requires the synergistic action of multiple enzymes to cleave the backbone and side chains, including β-1,4-endoxylanase, β-D-xylosidase, α-L-arabinofuranase, α-D-glucuronidase, ferulic acid esterase, and acetylxylan esterase. The xylan backbone often contains acetyl groups, which create steric hindrance and limit the activity of xylan-degrading enzymes. Therefore, the degradation of acetyl groups is particularly important in the biodegradation of xylan.

[0004] Acetylxylan esterase specifically catalyzes the hydrolysis of the acetyl side chain in xylan molecules, releasing acetic acid and deacetylifying the xylan chain. This promotes the continuous action of major xylan hydrolytic enzymes (such as β-xylanase and β-xylosidase), significantly improving the efficiency of the entire xylan-degrading enzyme system and achieving efficient saccharification of biomass. In the construction of engineered bacteria, research on acetylxylan esterase can provide key components for constructing high-yield, synergistically effective hemicellulose-degrading enzyme systems, thereby improving the expression efficiency and application performance of the entire enzyme system. In industrial biotransformation, this enzyme can synergistically degrade hemicellulose into xylose with endoxylanase and β-xylosidase, which can then be converted into high-value products such as xylitol through subsequent fermentation or catalytic processes. In the utilization of biomass resources, taking destarched wheat bran as an example, the acetylated xylan and xylooligosaccharides contained therein can be deacetized under the action of acetylxylan esterase. This process not only promotes subsequent saccharification but also enables the recovery of acetate, improving resource utilization. Furthermore, some acetylxylan esterases possess transsubstrate activity, capable of acting on the acetyl groups on chitin, thus enabling their use in the enzymatic green preparation of chitosan, showing promising application prospects in pharmaceuticals, textiles, papermaking, and cosmetics. Therefore, developing highly active acetylxylan esterases is of great significance for all of the above-mentioned aspects.

[0005] Meanwhile, acetylxylan esterases existing in free enzyme form suffer from poor stability, difficulty in recovery, and low environmental tolerance due to their fragile protein structure. Encapsulating the enzyme in situ within metal-organic frameworks (MOFs) to form enzyme@MOF composites can effectively prevent enzyme leakage, enhance enzyme protection, and improve operational stability. However, research in this field has largely focused on ZIF-8 materials, and faces challenges such as decreased catalytic efficiency and limited MOF support types, restricting their practical application. Summary of the Invention

[0006] To address the above problems, this invention provides a novel acetylxylan esterase, recombinant plasmid, recombinant strain, immobilized acetylxylan esterase, and its applications. This solves the problems of low degradation efficiency and unstable enzymatic properties of acetylxylan esterase.

[0007] To achieve the aforementioned objectives, the technical solution adopted by this invention includes: A novel acetylxylan esterase, the amino acid sequence of which is shown in SEQ ID NO.1.

[0008] A gene encoding the novel acetylxylan esterase of claim 1, wherein the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 2.

[0009] A recombinant plasmid containing the encoding gene for the acetylxylan esterase. This invention does not have special requirements for the type of backbone vector for the recombinant plasmid; commonly used vectors capable of expression in common host bacteria such as *Escherichia coli*, such as pET-28(a)+ and pET-30, can be selected.

[0010] A recombinant host comprising the recombinant plasmid. The recombinant host cell is *Escherichia coli* BL21(DE3).

[0011] The immobilized enzyme prepared from the novel acetylxylan esterase.

[0012] The immobilized enzyme comprises the novel acetylxylan esterase and the MAF-6 vector.

[0013] The immobilized enzyme was named BsAxe-3@MAF-6-PEI and was prepared according to the following steps: the acetyloxylan esterase of claim 1, zinc acetate, polyethyleneimine and 2-ethylimidazole were mixed in water, the solid and liquid were separated after the reaction, and the resulting solid was washed and dried to obtain the enzyme.

[0014] The mass ratio of acetylated xylan esterase, zinc acetate, polyethyleneimine, and 2-ethylimidazole is (0.5~1):23:(5~20):216.3.

[0015] The application of the acetylxylan esterase or the immobilized acetylxylan esterase includes: Acetic acid production using wheat bran; Astragaloside I was converted into astragaloside A.

[0016] A method for producing acetic acid using the acetylxylan esterase catalyzed by the above-mentioned acetylxylan esterase involves using wheat bran (after starch and protein removal) as a substrate and reacting it with a solution of the novel acetylxylan esterase to produce acetic acid.

[0017] A method for producing astragaloside A using the novel acetylxylan esterase as a catalyst involves reacting astragaloside I as a substrate with a solution of the novel acetylxylan esterase to generate astragaloside A.

[0018] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a novel acetylated xylan esterase, BsAxe-3, derived from Bacillus. This enzyme has good acetylation activity and can be used for the degradation of acetylated xylan and the biotransformation of astragaloside compounds.

[0019] Treatment of wheat bran pretreated with amylase and papain using this recombinant acetylan esterase effectively hydrolyzes the acetyl groups, yielding an acetic acid yield of 359.27 mg / g, meaning that 1 mg of enzyme yields 668.41 mg / g. In the conversion of astragaloside I, this enzyme catalyzes the deacetylation of astragaloside I to produce astragaloside A; 2.5 mg of astragaloside I treated with acetylan esterase BsAxe-3 yields 0.16 mg of astragaloside A.

[0020] Furthermore, this invention constructs an immobilized acetylxylan esterase system, BsAxe-3@MAF-6-PEI, based on MAF-6-PEI, which improves the enzyme's tolerance to temperature and pH changes. Under acidic conditions (pH 5.0), the immobilized enzyme retains over 60% of its activity, which is beneficial for its stable catalytic role in processes such as acetylxylan degradation. The immobilized acetylxylan esterase provides better diffusion channels for substrates in biocatalytic reactions, improving substrate diffusion. It also exhibits high enzyme loading capacity, good acid resistance, heat resistance, and reusability, making it more practically valuable in the hydrolysis of acetylxylan. Attached Figure Description

[0021] Figure 1 Phylogenetic analysis of the strains based on the 16S rRNA gene sequence in Example 1 of this invention; Figure 2 This is a map of the recombinant plasmid pET28a-BsAxe-3 of BsAxe-3 acetylxylan esterase in Example 2 of the present invention; Figure 3 This is an SDS-PAGE result of BsAxe-3 acetylxylan esterase in Example 2 of the present invention; Figure 4 Figure a shows the optimal temperature detection results for the recombinant acetylxylan esterase BsAxe-3 of this invention. Figure 4 b is a graph showing the optimal pH detection results of the recombinant acetylxylan esterase BsAxe-3 of the present invention; Figure 5 This is a high-performance liquid chromatography (HPLC) image of the recombinant acetylxylan esterase BsAxe-3 converting pretreated wheat bran in Example 4 of this invention. Figure 6 This is a flowchart of the conversion of recombinant acetylxylan esterase BsAxe-3 into astragaloside in Example 5 of the present invention; Figure 7 This is a high-performance liquid chromatography (HPLC) image of the conversion of astragaloside I by recombinant acetylxylan esterase BsAxe-3 in Example 5 of the present invention. Figure 8 This is a transmission electron microscope image of BsAxe-3@MAF-6-PEI-5 in Example 6 of the present invention; Figure 9 The graph shows the detection results of the optimal temperature and optimal pH of BsAxe-3@MAF-6-PEI in Example 6 of the present invention. Detailed Implementation

[0022] The embodiments described below are exemplary descriptions of key experimental evidence and are not intended to limit the core content and application scope of this invention due to the amount of evidence. It should be noted that all the accompanying drawings and corresponding descriptions merely illustrate the concept, principles, and representative experimental evidence of the disclosed embodiments of this invention. Where the chain of evidence is complete, it is unnecessary to show all the specific details and extended details of the various embodiments listed in this invention.

[0023] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the materials, reagents, etc., used in the following embodiments are commercially available.

[0024] Acetylxylan esterases can specifically remove acetyl groups from xylan molecules, clearing the way for the efficient operation of other major xylan hydrolases and thus significantly improving the overall efficiency of biomass conversion into sugars. Therefore, developing highly active acetylxylan esterases has significant practical implications. However, acetylxylan esterases in their free enzyme form suffer from poor stability, difficulty in recovery, and low environmental tolerance, limiting their practical applications.

[0025] Based on the study of the genome of a Bacillus species RSTR-B20 isolated from ginseng soil, this invention obtained a novel acetylxylan esterase gene fragment. This invention provides an acetylxylan esterase edited from this gene fragment, the amino acid sequence of which is shown in SEQ ID NO. 1. This acetylxylan esterase exhibits efficient acetyl ester bond cleavage and good stability in high-temperature and alkaline environments, making it suitable for industrial applications.

[0026] This invention also provides the encoding gene for the novel acetylated xylan esterase described above.

[0027] The present invention also provides recombinant plasmids containing the above-mentioned genes.

[0028] This invention also provides a recombinant strain expressing the above-mentioned acetylxylan esterase, and a method for preparing acetylxylan esterase with the amino acid sequence shown in SEQ ID NO. 1 using the recombinant strain.

[0029] This invention also provides applications of the novel acetylated xylan esterase, including: producing acetic acid using wheat bran; and converting astragaloside I into astragaloside A.

[0030] This invention also provides methods for producing acetic acid using acetylxylan esterase and methods for producing astragaloside A using catalysis.

[0031] The present invention will be described below through specific embodiments.

[0032] The nucleotide sequence shown in SEQ ID NO.2 was synthesized by Suzhou Genewiz Biotechnology Co., Ltd.; the vector pET-28(a)+ was purchased from Suzhou Genewiz Biotechnology Co., Ltd. Commercial amylase was purchased from Beijing Solarbio Technology Co., Ltd., 3700 U / g, CAS: 9000-90-2; Commercial papain was purchased from Shanghai Yuanye Biotechnology Co., Ltd., 800 U / mg, CAS: 9001-73-4.

[0033] Example 1 This embodiment provides an acetylxylan esterase BsAxe-3, the amino acid sequence of which is shown in SEQ ID NO. 1, and the nucleotide sequence encoding the gene for acetylxylan esterase BsAxe-3 is shown in SEQ ID NO. 2.

[0034] The acetylxylan esterase BsAxe-3 can be synthesized using conventional solid-phase synthesis methods, following the amino acid sequence shown in SEQ ID NO. 1, or it can be synthesized directly using the coding gene shown in SEQ ID NO. 2.

[0035] (1) Screening of acetylxylan esterase-producing strains Laboratory-preserved rhizosphere fungi and bacterial strains of ginseng (Panax ginseng) were activated and cultured separately. The fungi were cultured on potato dextrose agar, and the bacteria on LB agar. After culturing, the bacterial cultures were collected; the fungal cultures were filtered through gauze, and the bacterial cultures were centrifuged to obtain the supernatant.

[0036] The crude enzyme solution was initially purified by ammonium sulfate precipitation. Ammonium sulfate was added to 60% saturation, and the mixture was allowed to stand overnight at 4 °C. The precipitate was then collected, reconstituted with Tris-HCl buffer, and dialyzed to obtain a partially purified enzyme solution. Acetylxylan esterase (AcXE) activity was detected using p-nitrophenylacetate (p-NPA) as a substrate. A strain with high AcXE activity was screened and named RSTR-B20.

[0037] (2) Whole genome sequencing and gene mining of strain RSTR-B20 Genomic DNA was extracted from strain RSTR-B20 and sequenced using whole-genome shotgun sequencing, combined with second- and third-generation sequencing technologies to obtain the complete genome sequence. The results showed that the RSTR-B20 genome consists of a single circular chromosome, with a total length of 4,094,181 bp and a GC content of 43.87%.

[0038] Phylogenetic analysis based on 16S rRNA gene sequence (its map is shown below) Figure 1 As shown in the figure, sequence alignment was performed using MAFFT, and a phylogenetic tree was constructed using FastTree. The results showed that strain RSTR-B20 belongs to Bacillus subtilis.

[0039] Further annotation analysis of genome-encoded proteins was performed using DIAMOND and hmmscan software on the NR and CAZy databases, respectively, identifying 29 candidate genes belonging to the carbohydrate esterase family. Sequence analysis revealed one gene with potential acetylsylan esterase function, named BsAxe-3.

[0040] (3) Identification of BsAxe-3 gene sequence The BsAxe-3 gene encodes a protein consisting of 319 amino acids, the nucleotide sequence of which is shown in SEQ ID NO.2 and the amino acid sequence of which is shown in SEQ ID NO.1.

[0041] Homology analysis showed that BsAxe-3 belongs to the polysaccharide deacetylase family, but its coding sequence differs from previously reported protein sequences, indicating that it is a novel acetylxylan esterase gene derived from strain RSTR-B20.

[0042] Example 2 This embodiment provides a recombinant plasmid and recombinant bacteria expressing the acetylxylan esterase BsAxe-3 from Example 1, and provides a method for expressing and purifying the recombinant acetylxylan esterase BsAxe-3.

[0043] (1) Synthesize the nucleotide sequence shown in SEQ ID NO.2 using conventional gene synthesis methods, or extract total RNA from Bacillus spp. B20 and reverse transcribe it into cDNA, then amplify the nucleotide sequence shown in SEQ ID NO.2 using a pair of specific primers with BamHI and XhoI restriction sequences (BsAxe-3-F (SEQ ID NO.3): TGGACAGCAAATGGGTCGCGGATCCATGTACAAAAAATTTGTACCGTT; BsAxe-3-R (SEQ ID NO.4): AGTGGTGGTGGTGGTGGTGCTCGAGTTACTTCAATAGTCTTGTTTCAT).

[0044] (2) The empty vector pET-28(a)+ was incubated at 37°C for 50 min using BamHI and XhoI enzymes. Then, using homologous recombination, the nucleotide sequence shown in SEQ ID NO.2 and the pET-28(a)+ linear vector fragment treated with restriction enzymes BamHI and XhoI were ligated at 50°C for 1 h to obtain the recombinant plasmid pET28a-BsAxe-3 (its pattern is shown in Figure 1). Figure 2 (As shown). The recombinant plasmid pET28a-BsAxe-3 was transformed into Escherichia coli BL21(DE3), and positive transformants were screened to obtain recombinant Escherichia coli BL21(DE3) / pET-28a-AxE960 containing the recombinant plasmid pET28a-BsAxe-3.

[0045] (3) Protein expression and purification ① Add kanamycin (Kna) to 50 mL of LB medium (10 g / L tryptone, 5 g / L yeast extract and 10 g / L sodium chloride) to make the final concentration of Kna 100 μg / mL. Inoculate recombinant Escherichia coli BL21(DE3) / pET-28a-AxE960 and culture overnight at 37°C with shaking at 220 rpm.

[0046] ②Inoculate the overnight culture into 1L LB medium containing 100μg / mL Kna and culture at 37℃ with shaking at 220rpm until the OD600 value is 0.8.

[0047] ③ Add IPTG (isopropyl-β-D-thiogalactoside) (final concentration in the cultured bacterial solution is 0.5mM) to the cultured bacterial solution, and culture at 180 rpm for 20 h at 18℃ to induce recombinant Escherichia coli to express BsAxe-3 acetylxylan esterase.

[0048] ④ Collect the bacterial sludge by centrifuging at 8000 rpm for 10 min at 4℃.

[0049] ⑤ Resuspend the bacterial sludge in 1x PBS, then sonicate (260W, 30 minutes, 5 seconds on, 5 seconds off) to lyse the cells. Centrifuge at 11000 rpm for 30 minutes at 4℃ to remove cell debris. Collect the supernatant and purify the protein using a Ni-NTA column. The purification steps are as follows: Equilibrate the column with 5 column volumes of binding buffer (50mM imidazole aqueous solution), then allow the buffer to flow down naturally. Slowly add the cell lysis supernatant to the nickel column, wash the column with 5-10 column volumes of washing buffer (50mM imidazole), then replace with elution buffer (250mM imidazole aqueous solution), collect the eluent until it is colorless, and finally transfer the eluent to an ultrafiltration tube. Replace the imidazole with low-salt buffer (1×PBS) to remove the imidazole, and collect the purified enzyme solution. Perform SDS-PAGE analysis on the purified enzyme solution.

[0050] The results of SDS-PAGE detection are as follows: Figure 3 As shown in the figure, M is the protein marker, and the protein is the protein solution eluted from the Ni-NTA column in step ⑤; the protein band with a molecular weight of 45 kDa shown in the SDS-PAGE detection is the recombinant acetylxylan esterase BsAxe-3.

[0051] Example 3 This embodiment investigated the enzymatic properties of recombinant acetylxylan esterase BsAxe-3.

[0052] The concentration of the protein solution eluted from the Ni-NTA column in step ⑤ of Example 2 was adjusted to make the concentration of recombinant acetylxylan esterase BsAxe-3 0.5 mg / mL, which was used to investigate the optimal temperature and optimal pH of the recombinant acetylxylan esterase BsAxe-3.

[0053] 1. Optimal temperature: 50 mM p-nitrobenzene acetate (p-NPA) was prepared as the reaction substrate. Recombinant acetylxylan esterase BsAxe-3 enzyme solution (0.5 mg / mL) and 50 mM Tris-HCl buffer (pH 7.0) were added. The reaction system consisted of 50 µL of reaction substrate, 50 µL of recombinant acetylxylan esterase BsAxe-3 enzyme solution, and 1.4 mL of Tris-HCl buffer. Nine parallel experiments were conducted at each temperature (30, 40, 50, 60, 70, 80, 90, and 100 °C). After incubation for 10 min, anhydrous ethanol was added to terminate the enzymatic reaction. The absorbance of the reaction solution at 405 nm was measured, and the relative enzyme activity was calculated.

[0054] The optimal temperature detection results for recombinant acetylxylan esterase BsAxe-3 are as follows: Figure 4 As shown in Figure a, its activity is optimal at 60℃, and within a temperature range of 30~90℃, recombinant acetylxylan esterase BsAxe-3 can maintain more than 60% of its enzyme activity, exhibiting good temperature stability.

[0055] 2. Optimal pH Tris-HCl buffer solutions with concentrations of 50 mM and different pH values ​​were prepared: 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, and 9.0.

[0056] 50 mM p-nitrobenzene acetate (p-NPA) was prepared as the reaction substrate. Recombinant acetylxylan esterase BsAxe-3 enzyme solution (0.5 mg / mL) and 50 mM Tris-HCl buffer at different pH values ​​were added. The reaction system consisted of 50 µL of reaction substrate, 50 µL of recombinant acetylxylan esterase BsAxe-3 enzyme solution, and 1.4 mL of Tris-HCl buffer. Nine parallel experiments were conducted at different pH conditions, all incubated at 60 °C for 10 min. After the reaction was terminated, the absorbance of the reaction solution at 405 nm was measured, and the relative enzyme activity was calculated.

[0057] The optimal pH detection results for recombinant acetylxylan esterase BsAxe-3 are as follows: Figure 4 As shown in Figure b, its activity is higher at pH 8.5 or 9.0, with the best activity at pH 8.5, and relatively lower activity under acidic conditions.

[0058] Example 4 This example investigated the degradation ability of acetylxylan esterase BsAxe-3 on pretreated wheat bran.

[0059] The concentration of the protein solution eluted from the Ni-NTA column in step ⑤ of Example 2 was adjusted to make the concentration of recombinant acetylxylan esterase BsAxe-3 0.5 mg / mL, which was used to investigate the degradation ability of acetylxylan esterase BsAxe-3 on pretreated wheat bran.

[0060] The wheat bran pretreatment steps are as follows: 50g of wheat bran is washed with water to remove impurities, then boiled for ten minutes, filtered, washed, and added together with 0.2g of commercial amylase to 500mL of distilled water. After reacting at 50℃ and pH 7.0 for 1.5 hours, it is centrifuged and filtered at 200rpm. The resulting precipitate is washed three times with distilled water and tested with an iodine-containing test reagent; no residual starch is found. Then, 0.15g of commercial papain and 500mL of distilled water are added to the washed and centrifuged precipitate, and reacted at 37℃ and pH 7.0 for 0.5 hours. After centrifuging and filtering at 200rpm, it is washed three times. Another 0.15g of commercial papain and 500mL of distilled water are added, and the reaction is repeated at 37℃ and pH 7.0 for 0.5 hours. After centrifuging and filtering at 200rpm, it is washed three times. The mixture is then autoclaved at 121℃ for 15 minutes, centrifuged and filtered at 10000rpm, washed three times, and the solid is collected. It is then dried and pulverized at 60℃ to obtain pretreated wheat bran.

[0061] Three parallel experiments were set up: 50 mg of pretreated wheat bran was used as the reaction substrate, and 2 mL of 50 mM Tris-HCl buffer (pH 8.5) and 2.5 mL of recombinant acetylxylan esterase BsAxe-3 enzyme solution were added. After reacting at 60 °C for 20 min, 0.5 mL of sample was collected from the enzymatic reaction solution, mixed with methanol in an equal proportion, and then centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm organic spectrum filter and then analyzed by high performance liquid chromatography (HPLC).

[0062] HPLC detection conditions: C18 column (Shim-pack Scepter HD-C18-80, 5μm, 4.6×250mm, SHIMADZU), mobile phase of 0.02mol / L potassium dihydrogen phosphate (pH 2.7) and methanol, volume ratio of 97:3, isocratic elution at 30℃, flow rate of 1.0mL / min, and detection of acetic acid at 214nm.

[0063] HPLC chromatogram as shown Figure 5 As shown. Calculations show that the acetic acid yield from recombinant acetylan esterase BsAxe-3 converted wheat bran pretreated with amylase and papain was 359.27 mg / g, meaning that 1 mg of enzyme yielded 668.41 mg / g. "mg / g" refers to the mass of acetic acid obtained from each gram of substrate (pretreated wheat bran).

[0064] Example 5 This example investigated the conversion ability of acetylxylan esterase BsAxe-3 to astragaloside I.

[0065] The concentration of the protein solution eluted from the Ni-NTA column in step ⑤ of Example 2 was adjusted to make the concentration of recombinant acetylxylan esterase BsAxe-3 0.5375 mg / mL, which was used to investigate the ability of acetylxylan esterase BsAxe-3 to convert astragaloside I.

[0066] Three parallel experiments were set up. 2.5 mg of astragaloside I was used as the reaction substrate, and 2 mL of 50 mM Tris-HCl buffer (pH 8.5) and 2.5 mL of recombinant acetylxylan esterase BsAxe-3 enzyme solution were added. After reacting at 60 °C for 20 min, 0.5 mL of sample was collected from the enzymatic reaction solution, mixed with methanol in an equal proportion, and then centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μm organic spectroscopy filter and then analyzed by HPLC.

[0067] HPLC detection conditions: C18 column (Shim-pack Scepter HD-C18-80, 5μm, 4.6×250mm, SHIMADZU); acetonitrile-water (32:68) as the mobile phase; detection using an evaporative light scattering detector. The theoretical plate number, calculated based on the astragaloside A peak, should be no less than 4000.

[0068] The flowchart of the conversion of recombinant acetylxylan esterase BsAxe-3 into astragaloside is as follows: Figure 6 As shown, the product is astragaloside IV (AS-IV, hereinafter referred to as astragaloside IV), and the HPLC chromatogram is as follows. Figure 7 As shown. Calculations showed that the acetyl group in 2.5 mg of astragaloside I was hydrolyzed to produce 0.16 mg of astragaloside A. Compared with other acetylationan esterases catalyzing astragaloside, the recombinant acetylationan esterase BsAxe-3 in this study exhibited stronger hydrolytic activity.

[0069] Example 6 This embodiment provides an immobilized acetylational xylan esterase BsAxe-3@MAF-6-PEI. Its preparation method is as follows: Three mixtures with different PEI concentrations were prepared by mixing the protein solution eluted from the Ni-NTA column in step ⑤ of Example 2, Zn(OAc)₂·2H₂O, PEI (polyethyleneimine), and HeIM (2-ethylimidazole) in water. The concentrations of recombinant acetylxylan esterase BsAxe-3 in each mixture were 0.5 mg / mL, Zn(OAc)₂·2H₂O was 125 mM, PEI concentrations were 5 mg / mL, 10 mg / mL, and 20 mg / mL, and HeIM concentration was 2.25 M, respectively. The mixture was stirred at room temperature for 4–6 hours, and the precipitate was recovered by centrifugation at 13,000 rpm for 5 minutes. The precipitate was then washed three times with deionized water (each time by centrifugation at 13,000 rpm for 5 minutes in deionized water) to remove any unreacted precursors. The samples were then vacuum dried at room temperature to obtain BsAxe-3@MAF-6-PEI-5, BsAxe-3@MAF-6-PEI-10, and BsAxe-3@MAF-6-PEI-20, respectively. The obtained products were stored as powders at 4°C.

[0070] In another preferred embodiment, immobilized acetylxylan esterase BsAxe-3@MAF-6-PEI was prepared using recombinant acetylxylan esterase BsAxe-3 at a concentration of 1 mg / mL, with other conditions remaining unchanged.

[0071] Based on the concentrations of each component in the examples, the molar concentrations were converted to mass concentrations to obtain the mass ratios of each component. The specific calculations are as follows: For anhydrous zinc acetate (Zn(OAc)₂), its relative molecular mass is 183.46 g / mol, and the mass concentration corresponding to 125 mM is 0.125 × 183.46 = 22.93 g / L, or 23 mg / mL. HeIM refers to 2-ethylimidazole, whose relative molecular mass is 96.13 g / mol, and the mass concentration corresponding to 2.25 M is 2.25 × 96.13 = 216.3 g / L, or 216.3 mg / mL. The mass ratio of acetylsylan esterase BsAxe-3, zinc acetate, PEI, and HeIM is (0.5–1): 23: (5–20): 216.3.

[0072] The nanoporous material rho-Zn(eIM)2 (i.e. MAF-6, where eIM is 2-ethylimidazolium salt, MAF represents a metal nitrazole salt framework, and rho represents the ρ topology of the material) has a more open pore window with a diameter of 8 Å, making it more suitable for mass transfer of macromolecular substrates.

[0073] The immobilized acetylxylan esterase BsAxe-3@MAF-6-PEI was prepared using MAF-6 as the immobilization carrier and through a dual-induced crystallization process regulated by PEI and the enzyme. MAF-6, as the immobilization carrier for acetylxylan esterase, is constructed from Zn(II) nodes and 2-ethylimidazolium ligands, forming a three-dimensional porous framework with a π-H topology, which provides better diffusion channels for substrates in biocatalytic reactions, thus improving substrate diffusion. PEI is a cationic polymer with abundant primary, secondary, and tertiary amino groups on its surface; the positive charge on its molecular surface can efficiently adsorb enzyme molecules through electrostatic interactions. Simultaneously, the structure formed by PEI and the enzyme significantly enhances the enzyme's thermostability. Therefore, this immobilized acetylxylan esterase BsAxe-3@MAF-6-PEI is beneficial for improving the stability of the aforementioned acetylxylan esterase, reducing its usage cost, and facilitating its recycling.

[0074] Field emission transmission electron microscopy (TEM) images were taken at an accelerating voltage of 5.0 kV (Tecnai G2 F20, Netherlands), such as... Figure 8 As shown. By Figure 8 It is evident that the BsAxe-3@MAF-6-PEI-5 material (i.e., the concentration of recombinant acetylational esterase BsAxe-3 in the mixed system during the preparation process is 0.5 mg / mL, and the concentration of PEI is 5 mg / mL) has the best shape and shows no deformation.

[0075] The optimal pH and optimal temperature of BsAxe-3@MAF-6-PEI-5 were investigated using the method described in Example 3, and the results are as follows: Figure 9 As shown, BsAxe-3@MAF-6-PEI exhibits high relative enzyme activity within the temperature range of 30~70℃ and pH range of 5~9. Furthermore, its enzyme activity within the temperature range of 30~70℃ (except 60℃) and its enzyme activity within pH range of 5~8 are significantly higher than those of free acetylxylan esterase BsAxe-3, demonstrating superior resistance to temperature and pH changes.

[0076] The above embodiments only describe a portion of the specific implementation methods of the present invention in detail, and are not limited to the embodiments disclosed herein. Furthermore, the substantive content protected by the present invention is not limited thereto. Any other modifications, equivalent substitutions, improvements, etc., made based on the principles and techniques of the present invention without departing from its design scope are all within the protection scope of the present invention.

Claims

1. A novel acetylxylan esterase, characterized in that, The amino acid sequence of the novel acetylxylan esterase is shown in SEQ ID NO.

1.

2. A gene encoding the novel acetylxylan esterase of claim 1, characterized in that, The nucleotide sequence of the encoding gene is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the encoding gene of the acetylxylan esterase as described in claim 2.

4. A recombinant host, characterized in that, The host comprises the recombinant plasmid of claim 3.

5. The immobilized enzyme prepared by the novel acetylxylan esterase according to claim 1.

6. The immobilized enzyme according to claim 5, characterized in that, The immobilized enzyme comprises the novel acetylxylan esterase of claim 1 and the MAF-6 vector.

7. The immobilized enzyme according to claim 5, characterized in that, The immobilized enzyme was named BsAxe-3@MAF-6-PEI and was prepared according to the following steps: the acetyloxylan esterase of claim 1, zinc acetate, polyethyleneimine and 2-ethylimidazole were mixed in water, the solid and liquid were separated after the reaction, and the resulting solid was washed and dried to obtain the enzyme.

8. The immobilized acetylxylan esterase BsAxe-3@MAF-6-PEI according to claim 7, characterized in that, The mass ratio of acetylated xylan esterase, zinc acetate, polyethyleneimine, and 2-ethylimidazole is (0.5~1):23:(5~20):216.

3.

9. The application of the acetylxylan esterase according to claim 1 or the immobilized acetylxylan esterase according to any one of claims 5 to 8, characterized in that, include: Acetic acid production using wheat bran; Astragaloside I was converted into astragaloside A.

10. A method for producing astragaloside A using the novel acetylyl xylan esterase described in claim 1, characterized in that, Astragaloside I was used as a substrate and reacted with a solution of the novel acetylxylan esterase to generate astragaloside A.

Images