Method for screening of rna aptamers targeting mitochondria
Patent Information
- Application Number
- CN202510518590.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-23
- Publication Date
- 2026-10-23
AI Technical Summary
[0032]本申请的筛选方法通过利用Flag标签和Tom20融合蛋白实现对线粒体的纯化，并利用SELEX技术筛选靶向RNA配体。
Smart Images
Figure HDA0005374133610000011 
Figure HDA0005374133610000012 
Figure HDA0005374133610000021
Abstract
Description
Technical Field
[0001] This application belongs to the field of biomedical technology, specifically, it relates to a method for screening RNA aptamers that target mitochondria. Background Technology
[0002] Mitochondria are vital energy factories within cells, and their dysfunction is closely linked to various diseases, such as mitochondrial diseases, cancer, and neurodegenerative diseases. Drugs or molecules targeting mitochondria can effectively regulate their function, which is of great significance for treating mitochondrial-related diseases. Currently, RNA molecules targeting mitochondria have been proposed as potential therapeutic tools. However, efficiently screening and discovering mitochondrial-targeting RNA ligands remains a technical challenge. Summary of the Invention
[0003] To address the problems existing in the prior art, this application provides a method for screening RNA aptamers targeting mitochondria.
[0004] Specifically, this application relates to the following aspects:
[0005] 1. A method for screening RNA aptamers targeting mitochondria, comprising the following steps:
[0006] Mitochondria were purified using the mitochondrial surface membrane protein Tom20;
[0007] Purified mitochondria were incubated with a SELEX RNA library, and RNA was extracted from the mitochondria to screen for RNA aptamers enriched by mitochondria, i.e. RNA aptamers targeting mitochondria.
[0008] 2. The screening method according to item 1, wherein the purification of mitochondria using the mitochondrial surface membrane protein Tom20 includes the following steps:
[0009] Constructing a cell line with mitochondrial visualization markers;
[0010] A plasmid expressing Tom20 and Flag tags was constructed, lentiviruses were packaged, and the cell lines were infected.
[0011] Screening for infected cell lines to obtain cell lines expressing the Tom20-Flag tag;
[0012] The cell line expressing the Tom20-Flag tag was cultured and the cells were processed after culture to obtain crude mitochondrial extract;
[0013] The crude mitochondrial extract was then purified using Flag resin to obtain purified mitochondria.
[0014] 3. The screening method according to item 2, wherein the mitochondrial visualization marker cell line is a cell line containing mitochondrial adenosine transporter 9 and fluorescent protein.
[0015] 4. The screening method according to item 2, wherein the treated cells include the following steps:
[0016] The cells were lysed and centrifuged with MS buffer.
[0017] The precipitate after centrifugation was resuspended with SELEX buffer.
[0018] 5. The screening method according to any one of items 1-4, wherein the SELEX RNA library is obtained by transcription from a DNA library containing the following sequences:
[0019] 5'-TCGGGCGAGTCGTCTG-N50-AATCGTTGGTGGTGGCC-3',
[0020] Where N50 represents a 50nt random sequence.
[0021] 6. The screening method according to any one of items 1-5, wherein the screening is performed in multiple rounds, and the step of incubating the purified mitochondria with the SELEX RNA library and extracting RNA from the mitochondria comprises the following steps:
[0022] The purified mitochondria were incubated with the SELEX RNA library, and RNA was extracted from the mitochondria for the first round of screening.
[0023] The RNA enriched in the first round of screening was reverse transcribed into DNA and then amplified.
[0024] The amplified DNA was transcribed into RNA and mixed with the SELEX RNA library to form a secondary library for the second round of screening.
[0025] This process is repeated for multiple rounds of screening.
[0026] 7. The screening method according to item 6, wherein in each round of screening, the molar ratio of the transcribed RNA to the SELEX RNA library is 1:1 to 1.5:1;
[0027] Preferably, the number of rounds is 8-12.
[0028] 8. The screening method according to any one of items 1-7, wherein the screening method further comprises sequencing the RNA aptamer targeting mitochondria to obtain the sequence of the RNA aptamer targeting mitochondria.
[0029] 9. An RNA aptamer obtained by any one of the screening methods described in items 1-7.
[0030] 10. An RNA aptamer, the sequence of which is shown in SEQ ID NO:6.
[0031] Beneficial effects of this application
[0032] The screening method in this application purifies mitochondria by using Flag tags and Tom20 fusion protein, and uses SELEX technology to screen for target RNA ligands.
[0033] The screening method of this application is based on the construction of a visualized and purifiable mitochondrial cell line using a lentiviral transfection system. Mitochondria are isolated and purified in vitro, and RNA aptamers targeting mitochondria are screened using these mitochondria. This screening method can be carried out while preserving the true state of mitochondria and the natural conformation of mitochondrial surface proteins to the greatest extent, thereby improving the targeting of the screened RNA aptamers in cells. This can solve the problems of low efficiency and poor specificity of RNA aptamer screening in the prior art. Attached Figure Description
[0034] Figure 1 This shows the results of Western blotting validation of the cell line.
[0035] Figure 2 The results show the effect of in vitro mitochondrial purification. (A) shows the in vitro purified mitochondria observed under a microscope, and (B) shows the in vitro purified mitochondria detected by Western blotting. The negative control is a sample of Su9-mCherry-U2OS cells after the same treatment.
[0036] Figure 3 This displays the results of each round of screening for PCR validation.
[0037] Figure 4 The results of microscopic identification of aptamer targeting are shown, with green representing in vitro purified mitochondria and magenta representing CY5-labeled screening aptamers. Detailed Implementation
[0038] The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.
[0039] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.
[0040] As used herein, the term "aptamer" refers to any nucleic acid sequence having a non-covalent binding site for a specific target. Exemplary aptamer targets include nucleic acid sequences, proteins, peptides, antibodies, small molecules, minerals, antibiotics, and others. Aptamer binding sites may originate from secondary, tertiary, or quaternary conformations of the aptamer. As used herein, the term "RNA aptamer" refers to an aptamer composed of RNA.
[0041] As used in this article, SELEX (Systematic Evolution of Ligands by Exponential Enrichment) is an in vitro combinatorial chemistry method for screening nucleic acid aptamers with high affinity for target substances from a random single-stranded nucleic acid sequence library.
[0042] To address the problems existing in the prior art, this application provides a method for screening RNA aptamers targeting mitochondria, comprising the following steps:
[0043] S1: Purification of mitochondria using the mitochondrial surface membrane protein Tom20;
[0044] S2: The purified mitochondria were incubated with the SELEX RNA library and RNA was extracted from the mitochondria to screen for RNA aptamers enriched by mitochondria, i.e. RNA aptamers targeting mitochondria.
[0045] To screen for RNA aptamers targeting mitochondria, it is necessary to obtain mitochondria with high purity. In step S1, the applicant discovered through extensive experiments that the surface membrane protein Tom20 has a good effect on mitochondrial purification, enabling efficient and high-purity purification of mitochondria. Therefore, the surface membrane protein Tom20 was used to purify mitochondria.
[0046] Specifically, step S1 may include the following steps:
[0047] S11: Constructing a cell line with visual markers for mitochondria;
[0048] S12: Construct a plasmid that fused the expression of Tom20 and Flag tags, package it with lentivirus, and infect the cell line;
[0049] S13: Screen infected cell lines to obtain cell lines expressing the Tom20-Flag tag;
[0050] S14: Culture the cell line expressing the Tom20-Flag tag and process the cells after culture to obtain crude mitochondrial extract;
[0051] S15: The crude mitochondrial extract was then purified using Flag resin to obtain purified mitochondria.
[0052] In step S11, the construction of a mitochondrial visualization marker cell line is to make mitochondria visible, facilitating subsequent screening steps. Specifically, mitochondrial adenosine transporter 9 and fluorescent protein can be fused to construct the cell line.
[0053] In some specific embodiments, step S11 includes: constructing a pLV3-puro lentiviral vector by tandemly linking the mitochondrial adenosine transporter 9 gene with the fluorescent protein mCherry gene, transfecting 293T cells with the lentiviral helper plasmid to obtain packaged lentivirus. The commercial cell line U2OS is then infected with this virus, and after multiple rounds of screening, a mitochondrial visualization marker cell line is obtained.
[0054] Steps S12-S15 are to obtain Tom20 with the Flag tag in the cell line for subsequent isolation and purification, ensuring that the mitochondria extracted from the cells have high purity, which facilitates subsequent ligand screening.
[0055] In some specific embodiments, step S12 includes: expressing the Tom20 gene in tandem with the Flag tag, transfecting 293T cells with a lentiviral helper plasmid, collecting the cell supernatant after transfection to obtain packaged lentivirus, and further infecting mitochondrial visualization marker cell lines.
[0056] In some specific embodiments, step S13 includes: selecting infected cells using neomycin for three rounds of screening to obtain a cell line expressing the Tom20-Flag fusion protein.
[0057] Step S14 is to bind Tom20 to the mitochondria to obtain crude mitochondrial extract.
[0058] In some specific embodiments, step S14 includes: seeding cells expressing the Tom20-Flag tag into culture dishes, culturing for 48 h, and then using the culture medium for mitochondrial isolation. The culture medium is removed, and the cells are washed with PBS buffer, repeated twice, followed by the addition of Hypo buffer. The cells are collected in glass grinding tubes, placed on ice for 5 min, and then processed.
[0059] The cell processing may include the following steps: lysing the cells and centrifuging them with MS buffer; resuspending the centrifuged precipitate with SELEX buffer.
[0060] In some specific embodiments, cell processing includes: transferring the lysed cell solution to a centrifuge tube, adding 1.5 times the volume of 2.5x MS buffer, mixing thoroughly, and then transferring to a pre-chilled centrifuge at 4°C. Centrifuge at 800g for 10 min. Collect the supernatant after centrifugation, transfer it to a new centrifuge tube, centrifuge at 18000g for 10 min, remove the supernatant, and resuspend the precipitate at the bottom of the centrifuge tube with SELEX buffer.
[0061] In step S15, the crude mitochondrial extract can be purified using a Flag resin known in the art.
[0062] In some specific embodiments, step S15 includes: adding SELEX buffer to the Flag resin suspension, centrifuging at 4000g for 5 min at 4°C, repeating this process 3 times, then adding the crude mitochondrial extract sample and incubating at 4°C for 2 h. After incubation, centrifuging the sample at 4000g for 5 min at 4°C. Collecting the resin and resuspending it in SELEX buffer, centrifuging at 4000g for 5 min at 4°C, removing the supernatant, retaining the resin, repeating the resin washing process 3 times, adding SELEX buffer containing Flag peptide, incubating at 4°C for 30 min, centrifuging the sample at 4000g for 5 min at 4°C, and collecting the supernatant to obtain the purified mitochondrial solution.
[0063] In step S2, the SELEX RNA library can be obtained by transcription from a DNA library containing the following sequences:
[0064] 5'-TCGGGCGAGTCGTCTG-N50-AATCGTTGGTGGTGGCC-3',
[0065] Where N50 represents a 50nt random sequence.
[0066] Those skilled in the art will understand that the screening in step S2 can be a single round or multiple rounds.
[0067] In some implementations, the screening is performed in multiple rounds, and step S2 includes the following steps:
[0068] S21: The purified mitochondria were incubated with the SELEX RNA library, and RNA was extracted from the mitochondria for the first round of screening.
[0069] S22: The RNA enriched in the first round of screening is reverse transcribed into DNA and then amplified;
[0070] S23: Transcribe the amplified DNA into RNA and mix it with the SELEX RNA library to create a secondary library for the second round of screening;
[0071] S24: And so on, to complete multiple rounds of screening.
[0072] This process, known as "following the same logic," involves several rounds of screening. After the second round, the RNA enriched in the second round is reverse transcribed into DNA and amplified. The amplified DNA is then transcribed back into RNA and mixed with a SELEX RNA library to create a secondary library for the third round of screening. After the third round, the RNA enriched in the third round is reverse transcribed into DNA and amplified. This amplified DNA is then transcribed back into RNA and mixed with a SELEX RNA library to create a secondary library for the fourth round of screening. This process is repeated for the fifth, sixth, seventh, eighth, ninth, and tenth rounds of screening.
[0073] In some implementations, the molar ratio of the transcribed RNA to the SELEX RNA library is 1:1 to 1.5:1, for example, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, etc. That is, for each round of screening, the molar ratio of the transcribed RNA to the SELEX RNA library is 1:1 to 1.5:1.
[0074] In some implementations, the number of rounds is 8-12, for example, 8, 9, 10, 11 or 12 rounds.
[0075] In some implementations, the method for screening RNA aptamers targeting mitochondria includes the following steps:
[0076] S11: Constructing a cell line with visual markers for mitochondria;
[0077] S12: Construct a plasmid that fused the expression of Tom20 and Flag tags, package it with lentivirus, and infect the cell line;
[0078] S13: Screen infected cell lines to obtain cell lines expressing the Tom20-Flag tag;
[0079] S14: Culture the cell line expressing the Tom20-Flag tag and process the cells after culture to obtain crude mitochondrial extract;
[0080] S15: The crude mitochondrial extract was then purified using Flag resin to obtain purified mitochondria;
[0081] S21: The purified mitochondria were incubated with the SELEX RNA library, and RNA was extracted from the mitochondria for the first round of screening.
[0082] S22: The RNA enriched in the first round of screening is reverse transcribed into DNA and then amplified;
[0083] S23: Transcribe the amplified DNA into RNA and mix it with the SELEX RNA library to create a secondary library for the second round of screening;
[0084] S24: And so on, to complete multiple rounds of screening.
[0085] In some implementations, the method for screening RNA aptamers targeting mitochondria includes the following steps:
[0086] S11: Constructing a cell line with visual markers for mitochondria;
[0087] S12: Construct a plasmid that fused the expression of Tom20 and Flag tags, package it with lentivirus, and infect the cell line;
[0088] S13: Screen infected cell lines to obtain cell lines expressing the Tom20-Flag tag;
[0089] S14: Culture the cell line expressing the Tom20-Flag tag and process the cells after culture to obtain crude mitochondrial extract;
[0090] S15: The crude mitochondrial extract was then purified using Flag resin to obtain purified mitochondria;
[0091] S21: The purified mitochondria were incubated with the SELEX RNA library, and RNA was extracted from the mitochondria for the first round of screening.
[0092] S22: The RNA enriched in the first round of screening is reverse transcribed into DNA and then amplified;
[0093] S23: Transcribe the amplified DNA into RNA and mix it with the SELEX RNA library to create a secondary library for the second round of screening;
[0094] S24: And so on, completing 8-12 rounds of screening, in which the molar ratio of the transcribed RNA to the SELEX RNA library is 1:1-1.5:1 in each round of screening.
[0095] Furthermore, the screening method also includes sequencing the RNA aptamer targeting mitochondria to obtain the sequence of the RNA aptamer targeting mitochondria.
[0096] The screening method of this application can purify mitochondria by using Flag tags and Tom20 fusion protein, and then use SELEX technology to screen for target RNA ligands based on the purified mitochondria.
[0097] Specifically, the screening method of this application is based on the construction of a visualized and purifiable mitochondrial cell line using a lentiviral transfection system, the isolation and purification of mitochondria in vitro, and the screening of RNA aptamers targeting mitochondria. This screening method can be carried out while preserving the true state of mitochondria and the natural conformation of mitochondrial surface proteins to the greatest extent, thereby improving the targeting of the screened RNA aptamers in cells and solving the problems of low efficiency and poor specificity of RNA aptamer screening in the prior art.
[0098] This application also provides an RNA aptamer obtained by the screening method described above.
[0099] This application also provides an RNA aptamer, the sequence of which is shown in SEQ ID NO:6.
[0100] Example
[0101] Example 1
[0102] 1. Construction and purification of cell lines using lentiviral transfection system
[0103] The mitochondrial adenine nucleotide transporter 9 (Su9) gene (GenBank: MK178574.1) and the fluorescent protein mCherry gene were tandemly constructed into the pLV3-puro lentiviral vector (purchased from Neopharm, catalog number V017979). This vector, along with lentiviral helper plasmids (PAX2 and Vsvg plasmids), was transfected into 293T cells to obtain packaged lentivirus. This virus was then used to infect the commercial cell line U2OS (human osteosarcoma cells), and after multiple rounds of selection, Su9-mCherry-U2OS cells, i.e., the mitochondrial visualization marker cell line, were obtained.
[0104] Tom20 is a mitochondrial surface membrane protein. The applicant investigated the purification effects of several mitochondrial surface membrane proteins on mitochondria and found that Tom20 was the most effective in purifying mitochondria.
[0105] This embodiment achieves efficient and high-purity purification of mitochondria by capturing membrane proteins fused with the Flag tag. Based on the pLVX-IRES-Neo vector (purchased from Neopharm, catalog number V010431), this embodiment constructs the pLVX-Tom20-Flag-Neo plasmid, tandemly expressing the Tom20 gene (NM_014765.3) with the Flag tag. This plasmid, along with a lentiviral helper plasmid, is transfected into 293T cells. Cell supernatant is collected after transfection to obtain packaged lentivirus, which is then used to infect Su9-mCherry-U2OS cells. Infected cells are screened three times using neomycin to obtain a new cell line expressing the Tom20-Flag fusion protein, Tom20-Flag-Su9-mCherry-U2OS. After cell line construction, cells are lysed, and Western blotting is used to verify successful expression of the Tom20 recombinant protein (e.g., ...). Figure 1 (As shown).
[0106] 2. Purification of mitochondria
[0107] Mitochondria labeled with the Flag tag were affinity purified using Flag resin (purchased from GenScript, catalog number L00432) to ensure high purity of the extracted mitochondria for subsequent ligand screening experiments. Tom20-Flag-Su9-mCherry-U2OS cells were seeded in 10cm culture dishes and cultured for 48 hours before mitochondrial isolation. The culture medium was removed, and the cells were washed twice with PBS buffer. Hypo buffer (10mM NaCl, 1.5mM MgCl2, 10mM Tris-HCl (pH 7.5)) was then added. Cells were collected in glass grinding tubes using a cell scraper, placed on ice for 5 minutes, and then lysed. Transfer the lysed cell solution to a centrifuge tube, add 1.5 volumes of 2.5x MS buffer (525mM mannitol, 70mM sucrose, 12.5mM Tris-HCl (pH 7.5), 2.5mM EDTA (pH 7.5)), mix well, and transfer to a pre-chilled centrifuge at 4°C. Centrifuge at 800g for 10 min. Collect the supernatant and transfer it to a new centrifuge tube. Centrifuge at 18000g for 10 min. Remove the supernatant, and resuspend the precipitate at the bottom of the centrifuge tube in SELEX buffer (20mM Tris-HCl (pH 7.5), 2mM KCl, 40mM NaCl, 1mM MgCl2, 250mM sucrose) to obtain a crude mitochondrial extract. Add protease inhibitors and store on ice temporarily.
[0108] Take the Flag peptide resin suspension (containing 50% resin), add 500 μL of SELEX buffer, centrifuge at 4000g for 5 min at 4°C, repeat 3 times, then add the crude mitochondrial extract sample, and incubate at 4°C for 2 h. Centrifuge the incubated sample at 4000g for 5 min at 4°C. Collect the resin and resuspend it in SELEX buffer, centrifuge at 4000g for 5 min at 4°C, remove the supernatant, retain the resin, repeat the resin washing 3 times, add SELEX buffer containing Flag peptide, incubate at 4°C for 30 min, centrifuge the incubated sample at 4000g for 5 min at 4°C, and collect the supernatant, which is the affinity-purified mitochondrial solution.
[0109] The purified mitochondrial samples were observed under a microscope to confirm the purification results. Simultaneously, purified mitochondrial samples were subjected to SDS-PAGE electrophoresis, transferred to an NC membrane, and then Western blotting to verify the purification effect.
[0110] The results are as follows Figure 2 As shown, the results indicate that Tom20-Flag-Su9-mCherry-U2OS cells can be used for in vitro purification of mitochondria. The purified mitochondria can be observed under a microscope, and the target protein can be detected in the mitochondria isolated from Tom20-Flag-Su9-mCherry-U2OS cells in Western blotting experiments.
[0111] 3. Construction and filtering of SELEX screening libraries
[0112] To broaden the screening possibilities, this study designed a DNA library with fixed sequences at both ends and a 50-nt random sequence in the middle, 5'-TCGGGCGAGTCGTCTG(SEQ ID NO:1)-N50-AATCGTTGGTGGTGGCC(SEQ ID NO:2)-3'. After in vitro transcription into RNA, this became the SELEX RNA library, which was then used for screening. The screening process consisted of 10 rounds. In the first round, 10 μg of the SELEX RNA library was incubated with purified mitochondria at 4°C for 45 min, followed by centrifugation at 20000g for 20 min. The mitochondria precipitated at the bottom of the tube were collected, and PBS solution containing 20 mM EDTA and 0.5% SDS was added. The tube was heated at 95°C for 10 min, cooled to room temperature, and the RNA was purified using an RNA purification kit, yielding the mitochondrial-enriched RNA aptamers. Purified RNA was reverse transcribed into DNA using an in vitro reverse transcription kit. Primers SELEX T7 F and SELEX R (SELEX T7 F: TAATACGACTCACTATAGGGGCCACCACCAACGATT (SEQ ID NO: 3), SELEX R: TCGGGCGAGTCGTCTG (SEQ ID NO: 4)) were designed based on the fixed sequences at both ends of the library for verification and amplification of the DNA corresponding to the enriched aptamers. The amplified DNA was transcribed into RNA and mixed with the original SELEX library at a 1:1 ratio to form a secondary library for the second round of screening. This process was repeated for 10 rounds of screening.
[0113] The results of each round of screening are as follows: Figure 3 As shown,
[0114] 4. Next-generation sequencing and analysis
[0115] The RNA obtained after 10 rounds of screening was reverse transcribed into DNA in vitro. Multiplex Oligosfor (Dual Index Primers Set 2) (NEB#E7780S) barcode sequences were added and paired-end sequencing was performed by Novogene. Sequencing results were screened and assembled according to quality control principles before analysis. The enriched sequence (GGCCACCACCAACGATTCGTCTTGCCAAACTGTAGATCCGCCAACTGA CGGAACAAGCCAGAAGGGCCAGACGACTCGCCCGA (SEQ ID NO:5)) was identified and validated using extracellular biochemical experiments.
[0116] 5. In vitro verification of mitochondrial targeting of RNA aptamers
[0117] The DNA sequence corresponding to the screened aptamers (the sequence shown in SEQ ID NO:5) was synthesized, transcribed into RNA in vitro, and then labeled in vitro using the Jena Bioscience pCp-CY5 kit (GGCCACCACCAACGAUUCGUCUUGCCAAACUGUAGAUCCGCCAACUG ACGGAACAAGCCAGAAGGGCCAGACGACUCGCCCGA (SEQ ID NO:6)), i.e., Seq1-CY5. Mitochondria were purified in vitro according to the above method and incubated with Seq1-CY5 for 15 min, then observed under a confocal microscope.
[0118] The results are as follows Figure 4 As shown in the figure, the results indicate that mitochondria and Seq1-CY5 have good co-localization.
Claims
1. A method for screening RNA aptamers targeting mitochondria, comprising the following steps: Mitochondria were purified using the mitochondrial surface membrane protein Tom20; Purified mitochondria were incubated with a SELEX RNA library, and RNA was extracted from the mitochondria to screen for RNA aptamers enriched by mitochondria, i.e. RNA aptamers targeting mitochondria.
2. The screening method according to claim 1, wherein the purification of mitochondria using the mitochondrial surface membrane protein Tom20 includes the following steps: Constructing a cell line with mitochondrial visualization markers; A plasmid expressing Tom20 and Flag tags was constructed, lentiviruses were packaged, and the cell lines were infected. Screening for infected cell lines to obtain cell lines expressing the Tom20-Flag tag; The cell line expressing the Tom20-Flag tag was cultured and the cells were processed after culture to obtain crude mitochondrial extract; The crude mitochondrial extract was then purified using Flag resin to obtain purified mitochondria.
3. The screening method according to claim 2, wherein the mitochondrial visualization marker cell line is a cell line containing mitochondrial adenosine transporter 9 and fluorescent protein.
4. The screening method according to claim 2, wherein the treated cells include the following steps: The cells were lysed and centrifuged with MS buffer. The precipitate after centrifugation was resuspended with SELEX buffer.
5. The screening method according to any one of claims 1-4, wherein the SELEX RNA library is obtained by transcription from a DNA library containing the following sequences: 5'-TCGGGCGAGTCGTCTG-N50-AATCGTTGGTGGTGGCC-3', Where N50 represents a 50nt random sequence.
6. The screening method according to any one of claims 1-5, wherein the screening is performed in multiple rounds, and the step of incubating the purified mitochondria with the SELEX RNA library and extracting RNA from the mitochondria comprises the following steps: The purified mitochondria were incubated with the SELEX RNA library, and RNA was extracted from the mitochondria for the first round of screening. The RNA enriched in the first round of screening was reverse transcribed into DNA and then amplified. The amplified DNA was transcribed into RNA and mixed with the SELEX RNA library to form a secondary library for the second round of screening. This process is repeated for multiple rounds of screening.
7. The screening method according to claim 6, wherein in each round of screening, the molar ratio of the transcribed RNA to the SELEX RNA library is 1:1 to 1.5:1; Preferably, the number of rounds is 8-12.
8. The screening method according to any one of claims 1-7, wherein the screening method further comprises sequencing the RNA aptamer targeting mitochondria to obtain the sequence of the RNA aptamer targeting mitochondria.
9. An RNA aptamer obtained by the screening method according to any one of claims 1-7.
10. An RNA aptamer, the sequence of which is shown in SEQ ID NO:6.