Salvia miltiorrhiza crisper / cas9 high-efficiency promoter and application thereof

Abstract

The application discloses a Salvia miltiorrhiza CRISPR / Cas9 high-efficiency promoter and application thereof. The technical problem to be solved by the application is how to provide a Salvia miltiorrhiza high-efficiency promoter with transcription activity higher than 2*35S. To this end, the application provides a DNA molecule with a nucleotide sequence of SEQ ID NO:1, which is a Salvia miltiorrhiza Smcallus4 promoter, and the DNA molecule is used to improve the editing efficiency, KO efficiency, homozygous mutation efficiency and / or double allelic mutation efficiency of a CRISPR / Cas9 editing system. The application can be used to construct a high-efficiency CRISPR / Cas9 editing system in Salvia miltiorrhiza, lay a solid foundation for subsequent high-throughput screening of functional genes in Salvia miltiorrhiza and establishment of a high-efficiency editing system in other plants.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a highly efficient CRISPR / Cas9 promoter for Danshen and its applications. Background Technology

[0002] The CRISPR / Cas9 system is currently the most widely used genome editing system among CRISPR systems. It contains three important components: the Cas9 nuclease from Streptococcus pyogenes, the artificially designed sgRNA (singleguide RNA), and the promoter.

[0003] Promoters play a crucial regulatory role in the activation and expression of exogenous genes on vectors. The expression levels of Cas9 and SgRNA have been shown to significantly affect CRISPR / Cas9 editing efficiency (sun et al., 2015). Current literature indicates that promoter modification can effectively improve CRISPR / Cas9 editing efficiency (Scotti V and Scotti I., 2011; Feigetal., 2018). Constitutive promoters, such as RNA polymerase II (Pol II) promoters, are commonly used Cas9 gene promoters in dicotyledonous and monocotyledonous plants (Ma et al., 2015), including the Cauliflower mosaic virus (CaMV) 35S promoter (p35S) and the maize Ubiquitin promoter (pZmUbi). Pol III promoters typically drive SgRNA expression, such as the U3 and U6 promoters. Agrobacterium-mediated genetic transformation is commonly performed on embryogenic callus in Arabidopsis, maize, wheat, soybean, rice, and tomato. Studies have found that replacing the constitutive 35S promoter with egg cell and early embryo-specific promoters to drive Cas9 expression can significantly improve the editing efficiency and homozygous mutation efficiency of Arabidopsis T1 generation plants (Yan et al., 2015).

[0004] In recent years, the AtU6 promoter has been mainly used to initiate SgRNA expression in the Tanshinone CRISPR / Cas9 system, while the constitutive promoters 2×35S and AtUbi10 have driven Cas9 expression, achieving editing efficiencies of 42.31% and 77.50%, respectively (Xiang, 2022). Zhou et al. used the AtU6 promoter to knock out SmRAS, obtaining 5 biallelic mutants, 2 heterozygous mutants, and 1 homozygous mutant from 16 independent transgenic hairy root lines. However, no mutants were obtained from 13 independent transgenic hairy root lines driven by the rice U3 promoter (Zhou et al., 2018). These results indicate that the use of different promoters affects both the editing efficiency and homozygosity efficiency of Tanshinone CRISPR / Cas9; however, there has been no research on Tanshinone-specific promoters. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a promoter for driver genes (RNA genes and / or protein genes) with transcriptional activity higher than 2×35S and / or to improve the editing efficiency, KO efficiency, homozygous mutation efficiency and / or biallelic mutation efficiency of the CRISPR / Cas9 editing system.

[0006] Therefore, the present invention provides a DNA molecule, which may be any of the following:

[0007] P1) A DNA molecule with the nucleotide sequence SEQ ID NO: 1.

[0008] DNA molecules that share more than 70% identity with P1 and possess promoter activity,

[0009] P3 is derived from Salvia miltiorrhiza and is a DNA molecule that shares more than 70% identity with P1 and has promoter activity.

[0010] The aforementioned 70% or more similarity can be 75% or more similarity. Specifically, the 75% or more similarity can be 80% or more similarity. Specifically, the 80% or more similarity can be 85% or more similarity. Specifically, the 85% or more similarity can be 90% or more similarity. Specifically, the 90% or more similarity can be 91% or more similarity, 92% or more similarity, 93% or more similarity, 94% or more similarity, 95% or more similarity, 96% or more similarity, 97% or more similarity, 98% or more similarity, or 99% or more similarity. More specifically, the 70% or more identity can be at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity.

[0011] The present invention also provides a biomaterial, which may be any of the following:

[0012] A1) Recombinant nucleic acids containing the aforementioned DNA molecules.

[0013] A2) An expression cassette containing the aforementioned DNA molecule, or an expression cassette containing the recombinant nucleic acid described in A1).

[0014] A3) A recombinant vector containing the recombinant nucleic acid described in A1), or a recombinant vector containing the expression cassette described in A2).

[0015] A4) Recombinant microorganisms containing the nucleic acid molecules described in A1), or recombinant microorganisms containing the expression cassette described in A2), or recombinant microorganisms containing the recombinant vector described in A3).

[0016] A5) A transgenic plant cell line containing the nucleic acid molecule described in A1), or a transgenic plant cell line containing the expression cassette described in A2).

[0017] A6) Transgenic plant tissue containing the nucleic acid molecules described in A1), or transgenic plant tissue containing the expression cassette described in A2).

[0018] A7) A transgenic plant organ containing the nucleic acid molecule described in A1), or a transgenic plant organ containing the expression cassette described in A2).

[0019] Furthermore, in the aforementioned biological materials, the recombinant nucleic acid described in A1) refers to a nucleic acid having a non-naturally occurring sequence or a sequence artificially combined from two originally separate sequence fragments. Such artificial combination is typically achieved through chemical synthesis, or more commonly through artificial manipulation of separated nucleic acid fragments (e.g., through genetic engineering techniques).

[0020] Further, in the aforementioned biological materials, the expression cassette containing nucleic acid molecules described in A2) refers to DNA capable of expressing the proteins described above in host cells. The expression cassette may also include single-stranded or double-stranded nucleic acid molecules containing all the regulatory sequences necessary for expressing any of the aforementioned proteins. The regulatory sequences, under compatible conditions, can guide the coding sequence to express any of the aforementioned proteins in suitable host cells. The regulatory sequences include, but are not limited to, leader sequences, polyadenylated sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences must include a promoter and termination signals for transcription and translation. To introduce specific restriction enzyme sites into the vector for linking the regulatory sequences to the coding region of the nucleic acid sequence encoding the protein, a regulator-linked regulatory sequence may be provided. The regulatory sequence may be a suitable promoter sequence, i.e., a nucleic acid sequence that can be recognized by the host cell expressing the nucleic acid sequence. The promoter sequence contains transcriptional regulatory sequences that mediate protein expression. The promoter can be any nucleic acid sequence that is transcriptionally active in the selected host cell, including mutated, truncated, and heterozygous promoters, and can be derived from genes encoding extracellular or intracellular proteins that are homologous or heterologous to those of the host cell. The regulatory sequence can also be a suitable transcription termination sequence, i.e., a sequence that can be recognized by the host cell and thus terminate transcription. The termination sequence is operatively attached to the 3' end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a suitable leader sequence, i.e., an untranslated region of mRNA that is crucial for translation in the host cell. The leader sequence is operatively attached to the 5' end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in this invention. The regulatory sequence can also be a signal peptide coding region, which encodes an amino acid sequence linked to the amino terminus of a protein that guides the encoded protein into the cellular secretion pathway. Signal peptide coding regions that can guide the expressed protein into the secretion pathway of the host cell can be used in this invention. Adding a regulatory sequence that can regulate protein expression according to the growth status of the host cell may also be necessary. Examples of regulatory sequences are those that respond to chemical or physical stimuli (including in the presence of regulatory compounds), thereby turning gene expression on or off. Other examples of regulatory sequences are those that enable gene amplification. In these cases, the nucleic acid sequence encoding the protein should be operatively linked to the regulatory sequence.

[0021] In the aforementioned biological materials, the “vector” described in A3) is a nucleic acid molecule that allows the insertion of foreign nucleic acids without disrupting the vector’s ability to replicate and / or integrate into the host cell. The vector may include nucleic acid sequences that allow it to replicate in the host cell, such as an origin of replication. The vector may also include one or more optional marker genes and other genetic elements. An integration vector is capable of integrating itself into the host nucleic acid. An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of the inserted gene. The vector may be a plasmid vector or a viral vector, such as an adenovirus vector or an adeno-associated virus (AAV) vector.

[0022] Furthermore, in the biological material, the recombinant microorganism mentioned in A4) can be yeast, bacteria, algae, and fungi, specifically Agrobacterium.

[0023] Further, in the biological material described in A5) or A6), the transgenic plant refers to a plant whose genome has been altered by integrating or inserting a recombinant DNA molecule, construct, cassette, or sequence for expressing non-coding RNA molecules, mRNA, and / or proteins therein. Transgenic plants include R0 generation plants developed or regenerated from initially transformed plant cells and their progeny transgenic plants, or plants obtained by hybridization with R0 generation transgenic plants containing recombinant DNA molecules, constructs, cassettes, or sequences. Plants with integrated or inserted recombinant DNA molecules, constructs, cassettes, or sequences are considered transgenic plants, even if the plant also has other mutations or edits that are not themselves considered transgenic.

[0024] Furthermore, in the biological material, the plant tissue described in A7) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos and / or anthers.

[0025] Furthermore, in the biological material, the transgenic plant organs described in A8) can be the roots, stems, leaves, flowers, fruits, and seeds of the transgenic plant.

[0026] This invention also provides applications of the above-mentioned DNA molecules as promoters, or applications for preparing promoters.

[0027] In the above applications, the term "promoter" generally refers to DNA containing an RNA polymerase binding site, a transcription start site, and / or a TATA box that assists or promotes the transcription of transcribed DNA. Promoters can be artificially synthesized, modified, or derived from known or naturally occurring promoters. Promoters can also include chimeric promoters comprising combinations of two or more heterologous sequences. Therefore, the promoters of this application can include variants of promoter sequences that are compositionally similar but not identical to other promoter sequences provided herein.

[0028] The present invention also provides the use of the above-mentioned DNA molecules and / or biological materials in any of the following:

[0029] B1) Application in improving the efficiency of plant gene editing

[0030] B2) Application in the preparation of products that improve the inference efficiency of CRISPR editing in plants.

[0031] B3) Application in improving the efficiency of CRISPR editing inference in plants.

[0032] B4) Application in the preparation of products that improve the efficiency of plant gene editing

[0033] B5) Application in improving the KO efficiency of plant gene editing

[0034] B6) Application in the preparation of products that improve the KO efficiency of plant gene editing

[0035] B2) Application in improving the efficiency of homozygous mutations in plant gene editing

[0036] B3) Application in the preparation of products that improve the efficiency of homozygous mutations in plant gene editing.

[0037] Application of B9 in improving the efficiency of biallelic mutations in plant gene editing

[0038] Application of B10 in the preparation of products that improve the bis-allelic efficiency of plant gene editing

[0039] Application of B11 in plant gene editing

[0040] Applications of B12 in the preparation of plant gene editing-related products.

[0041] Application of B13 in plant breeding

[0042] Application of B14 in the preparation of plant breeding-related products.

[0043] Furthermore, the improvement can be an improvement compared to a 2×35S promoter.

[0044] The present invention also provides a method for plant gene editing, the method comprising the steps of introducing recombinant nucleic acids obtained by linking the above-mentioned DNA molecule as a promoter to the DNA to be transcribed into a target plant to achieve plant gene editing.

[0045] The present invention also provides a method for improving the efficiency of plant gene editing, the method comprising the step of introducing recombinant nucleic acid obtained by linking the DNA molecule as a promoter to the DNA to be transcribed into the target plant, thereby improving the efficiency of plant gene editing.

[0046] The present invention also provides a method for improving the efficiency of biselastic mutation in plants, the method comprising the step of introducing recombinant nucleic acid obtained by linking the DNA molecule as a promoter to the DNA to be transcribed into a target plant, thereby improving the efficiency of biselastic mutation in plants.

[0047] The present invention also provides a method for improving the CRISPR editing inference efficiency of plant gene editing, the method comprising the step of introducing recombinant nucleic acid obtained by linking the DNA molecule as a promoter to the DNA to be transcribed into the target plant, thereby improving the CRISPR editing inference efficiency of the plant.

[0048] The present invention also provides a method for improving the efficiency of homozygous mutations in plant gene editing, the method comprising the step of introducing recombinant nucleic acids obtained by linking the DNA molecule as a promoter to the DNA to be transcribed into the target plant, thereby improving the efficiency of homozygous mutations in plant genes.

[0049] In the above method, the DNA to be transcribed includes the encoding genes for sgRNA and Cas proteins. The "DNA to be transcribed" refers to DNA that can be transcribed into RNA molecules. The RNA molecules can be coding or non-coding.

[0050] The Cas protein may be at least one of the following proteins: Cas9, Cas1, Cas2, Cas4, Cas5, Cas6, Cas7, dCas9, ddCpfl, etc.

[0051] Furthermore, the Cas protein may be the Cas9 protein derived from Streptococcus pyogenes.

[0052] The connection can be an operatively linked connection. The term "operatively linked connection" refers to an operatively linked nucleic acid sequence that is functionally related to each other. It refers to a functional connection between a promoter and a gene-associated DNA sequence to be transcribed (such as an sgRNA gene) or a gene's coding sequence (CDS), enabling the promoter to function and initiate the transcription and expression of the transcribed DNA sequence or coding sequence.

[0053] The improvement in plant gene editing efficiency, biallelic mutation efficiency, CRISPR gene editing inference efficiency, and / or homozygous gene editing efficiency can be an improvement compared to the control method. The control method is identical to the method of the present invention except that the DNA molecule is replaced with a 2×35S promoter. The plant gene editing efficiency, biallelic mutation efficiency, CRISPR gene editing inference efficiency, and / or homozygous gene editing efficiency of the present invention includes the introduction of recombinant nucleic acids obtained by linking the DNA molecule as a promoter to the DNA to be transcribed into the target plant, thereby improving plant gene editing efficiency, biallelic mutation efficiency, CRISPR gene editing inference efficiency, and / or homozygous gene editing efficiency.

[0054] In the above applications or methods, the plant may be any of the following: N1) plants of the class Dicotyledons or Magnoliopsida, N2) plants of the order Lamiaceae or Solanaceae, N3) plants of the family Lamiaceae or Solanaceae, N4) plants of the genus Sage or Nicotiana, N5) Salvia miltiorrhiza or Nicotiana.

[0055] In summary, this invention has constructed a highly efficient CRISPR / Cas9 editing system for Salvia miltiorrhiza, laying a solid foundation for subsequent high-throughput screening of functional genes in Salvia miltiorrhiza and for establishing highly efficient editing systems in other plants. Attached Figure Description

[0056] Figure 1 The results of callus induction and electrophoresis of RNA samples from callus and leaves in *Salvia miltiorrhiza*.

[0057] Figure 2 Thermograph of the TOP10 promoter cis-regulatory elements in the Salvia miltiorrhiza callus promoter.

[0058] Figure 3 Visual analysis of the top 10 promoter cis-regulatory elements in the Salvia miltiorrhiza callus promoter.

[0059] Figure 4 Analysis of the expression patterns of the top 10 promoters in the Salvia miltiorrhiza callus promoter.

[0060] Figure 5 Electrophoresis diagram of the top 10 promoters of Salvia miltiorrhiza callus (1: Smcallus1; 2: Smcallus2; 3: Smcallus3; 4: Smcallus4; 5: Smcallus5; 6: Smcallus6; 7: Smcallus7; 9: Smcallus9; 10: Smcallus10; M: Trans8K DNA Marker).

[0061] Figure 6 This is a schematic diagram of the RUBY system carrier.

[0062] Figure 7 Transient expression of tobacco by the Danshen promoter.

[0063] Figure 8 This is a schematic diagram of the CRISPR / Cas9 vector.

[0064] Figure 9 Editing efficiency of 5 active promoters at 112 target sites.

[0065] Figure 10 Improve the editing efficiency of multi-target sites driven by the Smcallus4 promoter of Danshen.

[0066] Figure 11 Example of sequencing peak diagram of homozygous mutants of representative targets. Detailed Implementation

[0067] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0068] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0069] Example 1: Preparation and screening of promoters for high expression of Salvia miltiorrhiza callus

[0070] 1.1 Extraction and transcriptome sequencing of RNA from Salvia miltiorrhiza callus

[0071] Using vigorous tissue culture seedlings of *Salvia miltiorrhiza* as material, the leaves were cut into 1-2 cm pieces under sterile conditions in a clean bench. 2 The explants were placed on MS medium containing 6BA (6-benzylaminopurine, Beijing Solarbio Science & Technology Co., Ltd.) and 2,4-D growth hormone (2,4-dichlorophenoxyacetic acid, Beijing Solarbio Science & Technology Co., Ltd.). Callus tissue grew at the leaf margins in about 10 days. Figure 1The MS medium formula containing 6BA and 2,4D growth hormones is as follows: MS 4.43 g / L, sucrose 30 g / L, 6BA 2 mg / L, 2,4D 1 mg / L, adjusted to pH 5.5-5.6 using 3M NaOH, agar powder 7.5 g / L, autoclaved at 121°C for 15 minutes. After autoclaving the prepared solid medium, pour it into plant culture dishes, let it stand for a while until solidified, and then store it in a 4°C refrigerator for later use.

[0072] Callus tissue was detached from the explant, with remaining leaves serving as controls. Each group consisted of 2-3 leaves, and the procedure was repeated four times. Total RNA was extracted from both callus tissue and leaves using a Chinese herbal RNA extraction kit. RNA integrity was assessed using 1.5% agarose gel electrophoresis and an Agilent 2100 bioanalyzer. Agarose gel electrophoresis showed that the total RNA from both callus and leaf tissues was largely intact. Figure 1 ).

[0073] Qualified RNA samples were commissioned to Novogene Technology Co., Ltd. for library construction. RNA transcriptome sequencing was performed using the Novaseq-PE150 platform. Gene function was annotated using protein and nucleic acid databases. Raw reads were obtained from *Salvia miltiorrhiza* callus (46537608, 47466374, 48453244) and from leaves (44696272, 42887892, 44848988). After adapter removal and filtering of low-quality sequences, clean reads were obtained: 46207202, 45664532, 44828702 from *Salvia miltiorrhiza* callus and 43562444, 41392644, 43499378 from leaves. Q20 and Q30 positivity rates were both above 97% and 94%, respectively, indicating high-quality *Salvia miltiorrhiza* callus transcriptome assembly.

[0074] 1.2 Screening and Cloning of Highly Expressed Promoter Genes from Callus

[0075] The raw data obtained in section 1.1 were used for differential gene analysis using DESeq2 software. The top 10 genes expressed in *Salvia miltiorrhiza* callus and 10 differentially expressed genes (padj < 0.05, Log2(fold change) > 1) were selected from both callus and leaf tissues. Promoter sequences (first 2000 bp of CDS) were extracted using the online software http: / / www.bic.ac.cn / BIC / # / . Promoter sequences and domains were analyzed using the online software PlantCARE (a database of plant promoters and their cis-acting regulatory elements). Tbtools was used for promoter visualization analysis.

[0076] The results of cis-acting element prediction of highly expressed promoters in Salvia miltiorrhiza callus using the cis-acting element website PlantCARE are shown in the figure. Figure 2 The top 10 promoters contain cis-acting elements of the following 17 types, among which the TATA-box, which is associated with transcription initiation, and the CAAT-box, which is a cis-acting element shared by the promoter and the enhancement region, are the most abundant, with 484 (56.28%), 146 (16.98%), and 128 (14.88%), respectively. Other types of responses, including abscisic acid response (3.72%), methyl jasmonic acid response (2.21%), auxin response (1.16%), anaerobic induction (0.81%), gibberellin responsiveness (0.81%), low temperature response (0.81%), MYB binding site involvement in drought induction (0.70%), salicylic acid responsiveness (0.47%), MYB binding site involvement in light response (0.35%), MYB binding site involvement in flavonoid biosynthesis gene regulation (0.23%), circadian rhythm control (0.23%), cell cycle regulation (0.12%), defense and stress response (0.12%), and seed-specific cis-regulatory elements, were present in lower amounts (0.12%). Figure 3 ).

[0077] Among the top 10 promoters (named SmCallus), Smcallus3, Smcallus4, and Smcallus1 contain the most cis-regulatory elements. Smcallus3 contains the most cis-regulatory elements (183), including 147 TATA-box cis-regulatory elements related to transcription initiation, suggesting potentially high transcriptional activity. Smcallus4 is the second most abundant with 122 cis-regulatory elements, including 59 TATA-box elements and a large number of light-responsive cis-regulatory elements (38), which may be related to the need for light during callus formation. Smcallus1 contains 110 cis-regulatory elements, including 81 TATA-box cis-regulatory elements related to transcription initiation. Therefore, Smcallus1, Smcallus3, and Smcallus4 should be the focus of further analysis.

[0078] The 2000bp sequences of the 10 selected promoters were cloned. First, promoter-specific primers were designed using online software (http: / / www.bic.ac.cn / BIC / # / ), with XbaI and HindIII double restriction sites added to the 5′ and 3′ ends of the primers, respectively. Using genomic DNA from *Salvia miltiorrhiza* leaves as templates, the TOP10 promoters of *Salvia miltiorrhiza* callus were amplified by PCR. The PCR reaction was performed using Toyobo's KOD one (KMM-101), followed by sequencing. Approximately 2000bp sequences of 9 promoters (excluding *Smcallus8*) were successfully cloned. Results are as follows... Figure 4 The transcriptome data from different tissues of *Salvia miltiorrhiza* showed that Smcallus1 was most highly expressed in the root, Smcallus2 was most highly expressed in the stem, while the other seven promoters showed no tissue specificity. Figure 4 After sequencing and alignment, it was found that Smcallus5 (42.1%) and Smcallus3 (89.92%) had less than 80% similarity to the original sequence, while the other seven sequences had more than 96% similarity to the original sequence: Smcallus1 (99.45%), Smcallus2 (96.51%), Smcallus4 (100%), Smcallus6 (96.67%), Smcallus7 (99.70%), Smcallus9 (97.95%), and Smcallus10 (97.85%). This suggests that the promoter structures of Smcallus5 and Smcallus3 may be damaged. Figure 5In the diagram, 1 represents Smcallus1; 2 represents Smcallus2; 3 represents Smcallus3; 4 represents Smcallus4; 5 represents Smcallus5; 6 represents Smcallus6; 7 represents Smcallus7; 9 represents Smcallus9; 10 represents Smcallus10; and M represents Trans8K DNA Marker.

[0079] 1.3 Transformation of Agrobacterium GV3101 with tobacco overexpression vector and tobacco injection

[0080] To compare the transcriptional activity of the TOP10 promoters of *Salvia miltiorrhiza*, transient expression was performed in tobacco using the RUBY reporter system. Figure 6 This is a schematic diagram of the RUBY system carrier spectrum. First, the carrier pW501 containing the red fluorescent DsRed reporter system was modified ( Figure 6 In step a), replace DsRed with the RUBY sequence to construct the pW501-35S:RUBY vector. Figure 6 The sequence 'b' (abbreviated as 35S:RUBY) was obtained, and the RUBY sequencing results were consistent with the reference sequence reported in the literature (A reporter for noninvasively monitoring gene expression and plant transformation). Further, 35S was replaced with the top 10 promoters of *Salvia miltiorrhiza* callus (excluding Smcallus8): Smcallus1, Smcallus2, Smcallus3, Smcallus4, Smcallus5, Smcallus6, Smcallus7, Smcallus9, and Smcallus10, resulting in the RUBY expression vector pSmCallus-RUBY driven by the *Salvia miltiorrhiza* promoter. Figure 6 SmCallus (RUBY) in c is a fusion expression vector. SmCallus refers to any one of the nine promoters: SmCallus1-7 and SmCallus9-10.

[0081] The above-mentioned fusion expression vector and the control pW501-35S:RUBY were transformed into GV3101 competent cells, respectively. Positive monoclonal bacterial cultures were selected for tobacco injection, with 3-5 tobacco plants injected for each promoter. Results are as follows: Figure 7As shown, the positive control injected with the pW501-35S:RUBY expression vector had the largest and deepest red area, indicating successful expression of the RUBY gene in tobacco. All four candidate promoter groups (Smcallus1, Smcallus4, Smcallus5, and Smcallus9) showed red color, indicating transcriptional activity. Among the 24 tobacco leaves injected with the Smcallus4 promoter, all 24 leaves turned red, and the color was the deepest. This was followed by Smcallus5 (14 / 14) and Smcallus9 (27 / 29), with positive rates of 100% and 93.1%, respectively, and a relatively red color. In contrast, among the 15 tobacco leaves injected with the Smcallus1 promoter, only 2 leaves turned red, and the color was weaker, with a positive rate of only 13.3%. The color of tobacco injected with the other promoters Smcallus2, Smcallus3, Smcallus6, Smcallus7, and Smcallus10 did not change, indicating that these five promoters were inactive.

[0082] Therefore, four promoters with high transcriptional activity in tobacco, Smcallus1, Smcallus4, Smcallus5 and Smcallus9, were selected as key candidate promoters.

[0083] The specific method is as follows:

[0084] Based on pW501, the red fluorescent protein DsRed (approximately 678 bp) was double-digested with XbaI and SacI to obtain the pW501-double-digested linear plasmid. The pW501 vector and RUBY template were kindly provided by Professor Zhang Huawei's laboratory at the Institute of Modern Agriculture, Peking University. The detailed sequence of the pW501 vector can be found in the reference Pan et al., 2022 (PAN WB, CHENG ZT, HAN ZG, et al. Efficient genetic transformation and CRISPR / Cas9-mediated genomeediting of watermelon assisted by genes encoding developmental regulators[J]. JOURNAL OF ZHEJIANG UNIVERSITY-SCIENCE B, 2022, 23(4):339-44.). For the RUBY sequence, please refer to the reference He et al., 2020 (He Y, Zhang T, Sun H, et al. A reporter for noninvasively monitoring gene expression and plant transformation. [J]. Hortic Res, 2020, 19; 7(1): 152.). The RUBY-specific primer sequence is as follows:

[0085] XbaI-RUBY-F: cgaacgatactcgagtaatctaga ATGGATCATGCGACCCTCGC,

[0086] SacI-RUBY-R: gatacgaacgaaagctctgagctc CTTATCTTTAATCATATTCCATAGTCCATACC.

[0087] Using ruby ​​as a template, PCR amplification was performed using the aforementioned RUBY-specific primers, and the PCR products were recovered by 1.5% agarose gel electrophoresis (RUBY PCR gel recovery products).

[0088] Seamless connection is achieved according to the following system:

[0089] 2×Mix 2.5ul pW501 double enzyme cleavage plasmid 1ul RUBY PCR gel recovery products 1.5ul Total volume 5ul

[0090] The fragments were obtained by ligation at 50℃ for 30 minutes.

[0091] 5 μL of the ligation fragment was transformed into 50 μL of the cloning strain Trans1T1 and incubated on ice for 30 minutes. Then, the cells were heat-shocked in a 42°C water bath for 45 seconds, followed immediately by an ice bath for 2 minutes. 600 μL of LB broth was added, and the cells were incubated at 37°C for 1 hour using a shaker at 220 rpm. Afterward, the cells were centrifuged at 12000g for 1 minute and evenly plated onto LB broth containing kanamycin. The cells were incubated overnight at 37°C for 12–16 hours. Single colonies were picked, and bacterial PCR was performed using the following primers (F: tcaagcaatcaagcattctacttc; R: caaactcagtaggattctggtgtg). The strain yielding a PCR product of approximately 4418 bp contained the recombinant vector pW501-RUBY, which in turn contained the RUBY gene. The recombinant vector pW501-35S:RUBY was extracted from this strain.

[0092] The 35S promoter of pW501-35S:RUBY was cut off (approximately 911 bp) using XbaI and HindIII. The nine promoters were then seamlessly linked using homologous recombination. The resulting vector was named pSmCallus-RUBY (also known as SmCallus:RUBY), where SmCallus represents any one of the nine promoters SmCallus1-7 and SmCallus9-10.

[0093] The above-mentioned pSmCallus-RUBY vector was transferred into tobacco leaves via Agrobacterium tumefaciens GV3101.

[0094] 1.4 The effect of the Danshen promoter on the efficiency of the CRISPR / Cas9 system

[0095] Although the four promoters Smcallus1, Smcallus4, Smcallus5, and Smcallus9 exhibit high transcriptional activity in tobacco, gene expression may differ across species. Therefore, further evaluation of their editing efficiency in the hairy roots of *Salvia miltiorrhiza* was conducted. Based on the original pZKD672 vector, 2×35S were replaced with the top 10 promoters of *Salvia miltiorrhiza* callus: Smcallus1, Smcallus2, Smcallus3, Smcallus4, Smcallus5, Smcallus6, Smcallus7, Smcallus9, and Smcallus10, resulting in a CRISPR / Cas9 gene editing vector driven by the *Salvia miltiorrhiza* promoter. Figure 8Based on the above nine vectors, the vector pZKD672-Smcallus-112 (where Smcallus represents any one of the nine promoters SmCallus1-7 and SmCallus9-10) targeting 112 was constructed and transformed into Agrobacterium rhizogenes C58C1. The transcriptional activity of the nine promoters was evaluated by identifying the hair-like root editing efficiency and homozygous / bicelesteal efficiency under different promoters.

[0096] The specific method is as follows:

[0097] The pZKD672 vector was kindly provided by Professor Zhang Huawei's laboratory at the Institute of Modern Agriculture, Peking University. The vector sequence can be found in the Vector Construction section of the Materials and Methods section of the following reference: Pan et al., 2022 (PAN W, LIU X, LID, et al. Establishment of an Efficient Genome Editing System in Lettuce Without Sacrificing Specificity[J]. FRONTIERS IN PLANT SCIENCE, 2022, 13.). The pZKD672-Smcallus4 vector was obtained by replacing the fragment between the restriction endonuclease recognition sites HindIII and SwaI of pZKD672 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing.

[0098] pZKD672-Smcallus4-112 is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI in pZKD672-Smcallus4 with a gRNA gene targeting site 112, while keeping other nucleotides of pZKD672-Smcallus4 unchanged. The nucleotide sequence of the gRNA gene targeting site 112 is 5′-CTTCCTCTTCCTCTTCCTCA-3′.

[0099] The recombinant vectors pZKD672-Smcallus1-112, pZKD672-Smcallus2-112, pZKD672-Smcallus3-112, pZKD672-Smcallus5-112, pZKD672-Smcallus6-112, pZKD672-Smcallus7-112, pZKD672-Smcallus8-112, pZKD672-Smcallus9-112, and pZKD672-Smcallus10-112 differ from pZKD672-Smcallus4-112 only in that the Smcallus4 promoter is replaced with the corresponding promoter; all other nucleotide sequences are identical to pZKD672-Smcallus4-112.

[0100] pZKD672-112, pZKD672-Smcallus1-112, pZKD672-Smcallus2-112, pZKD672-Smcallus3-112, pZKD672-Smcallus4-112, pZKD672-Smcallus5-112, pZKD672-Smcallus6-112, pZKD672-Smcallus7-112, pZKD672-Smcallus9-112, and pZKD672-Smcallus10-112 were transformed into Tanshinone bh2-7 via leaf disc method mediated by Agrobacterium rhizogenes C58C1. Specific steps are detailed in the reference Tian et al. al., 2025 (Tian, ​​M., Luo, L., Jin, B., Liu, J., Chen, T., Tang, J., Shen, Y., Zhang, H., Guo, J., Zhang, H., Cui, G. and Huang, L. (2025) Highly efficient Agrobacterium rhizogenes-mediated gene editing system in Salvia miltiorrhiza inbred line bh2-7.PlantBiotechnol.J., https: / / doi.org / 10.1111 / pbi.70029).

[0101] The following methods were used to obtain ICE (Inference of CRISPR Edits), editing efficiency, heterozygous efficiency, knockout efficiency (KO), bi-allelic mutation efficiency, homozygous mutation efficiency (Homo), and homozygous and bi-allelic mutation efficiency (HOM).

[0102] Multiple hairy roots were collected from each target site, and genomic DNA was extracted from each hairy root. Specific primers were designed for the upstream and downstream of each target site, and sequences near the target site were amplified by PCR. The PCR amplification products were recovered and sequenced. The primer sequences are shown in Table 2. The online tool Synthego ICE (https: / / ice.synthego.com / # / ) was used to decode the peak diagram and analyze the mutant genotype. Genotype and indel score were provided for each mutant. The reference is Enzmann et al., 2018 (ENZMANNBL, WRONSKI A. Synthego's Engineered Cells Allow Scientists to "Cut Out" CRISPR Optimization[J]. CRISPR JOURNAL, 2018, 1(4): 255-7).

[0103] ICE used the Synthego ICE website to infer mutation values ​​from CRISPR editing for each mutant.

[0104] Editing efficiency is the number of hair roots with mutations (ICE>20%) / the number of hair roots detected.

[0105] The homozygous mutation efficiency is the number of hair roots that have homozygous mutations divided by the number of hair roots detected.

[0106] Heterozygility is the number of mutants with ICE values ​​between 20% and 80% divided by the number of hairy roots detected.

[0107] Knockout efficiency is the number of mutants with an ICE value > 80% divided by the number of hairy roots detected.

[0108] Biallelic mutation efficiency: Number of hair roots with bislelic mutations / Number of hair roots detected.

[0109] The homozygous / bicelestem efficiency is the sum of the homozygous mutation efficiency and the bicelestem mutation efficiency.

[0110] Mutation: Compared with the wild type, one or more nucleotides are deleted, inserted and / or replaced at the corresponding site (target site).

[0111] A homozygous mutation is a mutation in which the corresponding sites (target sites) on both homologous chromosomes are mutated compared to the wild type, and the resulting nucleotide sequences are identical.

[0112] Biallelic mutations refer to mutations at corresponding sites (target sites) on two homologous chromosomes compared to the wild type, and the nucleotide sequences of the two homologous chromosomes are different after the mutation.

[0113] Approximately 40 hairy roots were examined for each promoter (Table 3). The results showed that Smcallus 1, Smcallus 4, Smcallus 5, and Smcallus 9, which have transcriptional activity in tobacco, also exhibited certain editing efficiency in the hairy roots of Salvia miltiorrhiza.

[0114] like Figure 9 As shown, among the five active promoters, Smcallus 4 (Cal 4) exhibited the highest editing efficiency and homozygous / bialled efficiency. Of the 51 hairy roots examined, 36 were edited, resulting in 4 bialled mutants and 5 homozygous mutants. The editing efficiency and homozygous / bialled mutant efficiency were 70.59% and 17.65%, respectively, representing a significant improvement compared to the original target 112 (Table 3). Although the editing efficiency and KO efficiency of the Smcallus 1 (Cal 1) and Smcallus 10 (Cal 10) promoters were lower than those of the control target 112, 4 homozygous / bialled mutants were detected in 60 and 44 hairy roots, respectively, with homozygous / bialled efficiencies (6.67% and 9.09%) higher than the control group. The other three promoters, Smcallus 3, Smcallus 5 and Smcallus 9, had lower editing efficiency, ranging from 3% to 28%, and no homozygous / biallelic mutants were detected (Table 1).

[0115] Therefore, based on the above research results, the Smcallus 1, Smcallus 4, and Smcallus 10 promoters showed the highest editing efficiency and homozygous / bicelestem efficiency. Although Smcallus 10 can generate homozygous mutants, only 10 out of the 44 hairy roots tested showed mutations, indicating a very low editing efficiency of only 22.73%, suggesting that a large number of hairy roots are wild-type (Table 1). Therefore, the Smcallus 4 promoter was selected for further multi-target testing.

[0116] Table 1 Editing efficiency of different promoters at target 112

[0117]

[0118] Note: Line 112 represents the transformation and editing efficiency mediated by Agrobacterium rhizogenes C58C1 at target site 112. Lines Smcallus1, Smcallus2, Smcallus3, Smcallus4, Smcallus5, Smcallus6, Smcallus7, Smcallus9, and Smcallus10 represent pZKD672-Smcallus1-112, pZKD672-Smcallus2-112, pZKD672-Smcallus3-112, pZKD672-Smcallus4-112, pZKD672-Smcallus5-112, and pZKD672-Smcallus1-112, respectively. Various editing efficiencies of lus6-112, pZKD672-Smcallus7-112, pZKD672-Smcallus9-112, and pZKD672-Smcallus10-112 mediated by Agrobacterium rhizogenes C58C1.

[0119] 1.5 Efficiency Analysis of CRISPR / Cas9 System Driven by the Smcallus4 Promoter of Danshen

[0120] To further investigate the high editing efficiency of the Smcallus4 promoter in CRISPR / Cas9 for Danshen, the number of target sites was increased from 112 to 9, including two homozygous / bicelestealous targets (222 and 228) with efficiencies below 10%, and six targets with moderate homozygous / bicelestealous efficiencies (18-40%): 37, 47, 81, 94, 112, 200, and 220. These eight targets were then constructed onto CRISPR / Cas9 editing vectors containing the Smcallus4 promoter. Figure 8In the specific experimental method, except for the different vectors used to transform Agrobacterium rhizogenes C58C1 and the different total number of transformed hairy roots detected, all other operations were the same. The vectors used to transform Agrobacterium rhizogenes C58C1 were pZKD672-37, pZKD672-47, pZKD672-81, pZKD672-94, pZKD672-112, pZKD672-200, pZKD672-220, pZKD672-222, pZKD672-228, pZKD672-Smcallus4-37, and pZKD672-Smcallus4-37. us4-47, pZKD672-Smcallus4-81, pZKD672-Smcallus4-94, pZKD672-Smcallus4-112, pZKD672- Smcallus4-200, pZKD672-Smcallus4-220, pZKD672-Smcallus4-222, pZKD672-Smcallus4-228.

[0121] Table 2 Primers for target genome sequences

[0122]

[0123] The pZKD672-37 (corresponding to treatment 37 in Table 4) recombinant vector was obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 37: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 37.

[0124] pZKD672-Smcallus4-37 (corresponding to treatment 37-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-37 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 37.

[0125] The pZKD672-47 (corresponding to treatment 47 in Table 4) is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 47: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 47.

[0126] pZKD672-Smcallus4-47 (corresponding to treatment 47-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-47 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 47.

[0127] The pZKD672-81 (corresponding to treatment 81 in Table 4) is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 81: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 81.

[0128] pZKD672-Smcallus4-81 (corresponding to treatment 81-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-81 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 81.

[0129] The pZKD672-94 (corresponding to treatment 94 in Table 4) is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 94: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 94.

[0130] pZKD672-Smcallus4-94 (corresponding to treatment 94-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-94 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 94.

[0131] pZKD672-112 (corresponding to treatment 112 in Table 4) is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 112: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 112.

[0132] pZKD672-Smcallus4-112 (corresponding to treatment 112-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-112 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 112.

[0133] pZKD672-200 (corresponding to treatment 200 in Table 4) is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 200: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 200.

[0134] pZKD672-Smcallus4-200 (corresponding to treatment 200-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-200 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 200.

[0135] pZKD672-220 (corresponding to treatment 220 in Table 4) is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 220: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 220.

[0136] pZKD672-Smcallus4-220 (corresponding to treatment 220-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-220 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 220.

[0137] pZKD672-222 (corresponding to treatment 222 in Table 4) is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 222: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 222.

[0138] pZKD672-Smcallus4-222 (corresponding to treatment 222-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-222 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 222.

[0139] pZKD672-228 (corresponding to treatment 228 in Table 4) is a recombinant vector obtained by replacing the fragment between the restriction endonuclease recognition site BsaI of pZKD672 with the target site 228: 5′-CTTCCTCTTCCTCTTCCTCA-3′, while keeping other nucleotide sequences unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 228.

[0140] pZKD672-Smcallus4-228 (corresponding to treatment 228-Smcallus4 in Table 4) is a recombinant vector obtained by replacing the 2×35S promoter of pZKD672-228 with the Smcallus4 promoter of sequence 1 (SEQ ID NO: 1, 2000bp) in the sequence listing, while keeping other nucleotides unchanged. This recombinant vector expresses Cas9 and sgRNA targeting site 228.

[0141] The 2×35S promoter is a fragment located between the restriction endonuclease recognition sites HindIII and SwaI on pZKD672.

[0142] Driven by the Smcallus4 promoter, the ICE efficiency of eight targets (e.g., 37, 47, 81, 112, 200, 222, 228) was higher than the control, while only 94 targets showed lower ICE efficiency than the control. Editing efficiency, KO, and ICE efficiency were similar, exhibiting a similar mutational pattern. Figure 10(b). The homozygous / bialled efficiencies also varied, with improvements observed at all five targets (e.g., 37, 47, 112, 220, 228) compared to the control. For example, the homozygous / bialled efficiency of 37-Smcallus4 increased from 32.61% to 57.14% at the control target 37; 47-Smcallus4 increased from 35.9% to 40%; 112-Smcallus4 increased from 0% to 18.07%; 220-Smcallus4 increased from 40% to 68.75%; and 228-Smcallus4 increased from 7.04% to 34.78% (Table 3). Figure 11 Targets 81-Smcallus4, 200-Smcallus4, and 222-Smcallus4 showed higher ICE, editing efficiency, and KO efficiency than the control group targets 222 and 81, respectively; however, their homozygous / bialled efficiencies were lower than the control. Only target 94-Smcallus4 showed lower ICE, editing efficiency, KO efficiency, and homozygous / bialled efficiencies than the control group target 94.

[0143] Table 3. Editing efficiency of multi-target sites driven by the Smcallus4 promoter of Danshen.

[0144]

[0145]

[0146] In summary, Smcallus4 demonstrated superior homozygous / bialled efficiency compared to the control group at targets 37, 47, 112, 220, and 228. Smcallus4-driven efficiency at targets 81, 200, and 222 was also superior to the control group. Furthermore, considering all nine target data points, Smcallus4 showed higher ICE efficiency, editing efficiency, KO efficiency, and homozygous / bialled efficiency than the control group. Figure 10 (c) The ICE efficiency increased from 49.19 to 61.24 for 2×35S, the editing efficiency increased from 64.84% to 76.51%, the KO efficiency increased from 34.93% to 48.62%, and the homozygous / bicoreductoid efficiency increased from 21.56% to 29.46% (Table 4).

[0147] Table 4 Comparison of average editing efficiency of 9 sgRNAs driven by the Smcallus4 promoter of Danshen.

[0148] 2×35S Smcallus4 ICE (%) 49.19 61.24 Editing(%) 64.84 76.51 KO (%) 34.93 48.62 HOM (%) 21.56 29.46

[0149] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A DNA molecule, characterized in that, The DNA molecule is any one of the following: P1) A DNA molecule with the nucleotide sequence SEQ ID NO:

1. DNA molecules that share more than 70% identity with P1 and possess promoter activity, P3 is derived from Salvia miltiorrhiza and is a DNA molecule that shares more than 70% identity with P1 and has promoter activity.

2. Biomaterials, wherein the biomaterials are any one of the following: A1) A recombinant nucleic acid containing the DNA molecule of claim 1. A2) An expression cassette containing the DNA molecule of claim 1, or an expression cassette containing the recombinant nucleic acid of claim A1; A3) A recombinant vector containing the recombinant nucleic acid described in A1), or a recombinant vector containing the expression cassette described in A2); A4) Recombinant microorganisms containing the nucleic acid molecules described in A1), or recombinant microorganisms containing the expression cassette described in A2), or recombinant microorganisms containing the recombinant vector described in A3); A5) A transgenic plant cell line containing the nucleic acid molecule described in A1), or a transgenic plant cell line containing the expression cassette described in A2); A6) Transgenic plant tissue containing the nucleic acid molecules described in A1), or transgenic plant tissue containing the expression cassette described in A2); A7) A transgenic plant organ containing the nucleic acid molecule described in A1), or a transgenic plant organ containing the expression cassette described in A2).

3. The application of the DNA molecule of claim 1 as a promoter, or the application of preparing a promoter.

4. The use of the DNA molecule of claim 1 and / or the biomaterial of claim 2 in any of the following: B1) Application in improving the efficiency of plant gene editing B2) Application in the preparation of products that improve the inference efficiency of CRISPR editing in plants. B3) Application in improving the efficiency of CRISPR editing inference in plants. B4) Application in the preparation of products that improve the efficiency of plant gene editing B5) Application in improving the KO efficiency of plant gene editing B6) Application in the preparation of products that improve the KO efficiency of plant gene editing B2) Application in improving the efficiency of homozygous mutations in plant gene editing B3) Application in the preparation of products that improve the efficiency of homozygous mutations in plant gene editing. Application of B9 in improving the efficiency of biallelic mutations in plant gene editing Application of B10 in the preparation of products that improve the bis-allelic efficiency of plant gene editing Applications of B11 in plant gene editing Applications of B12 in the preparation of plant gene editing-related products. Application of B13 in plant breeding Application of B14 in the preparation of plant breeding-related products.

5. A method for plant gene editing, characterized in that, The method includes the step of introducing recombinant nucleic acid obtained by linking the DNA molecule of claim 1 as a promoter to the DNA to be transcribed into the target plant to achieve plant gene editing.

6. A method for improving the efficiency of plant gene editing, characterized in that, The method includes the step of introducing recombinant nucleic acid obtained by linking the DNA molecule of claim 1 as a promoter to the DNA to be transcribed into the target plant, thereby improving the efficiency of plant gene editing.

7. A method for improving the efficiency of bicelestem mutation in plants, characterized in that, The method includes the step of introducing recombinant nucleic acid obtained by linking the DNA molecule of claim 1 as a promoter to the DNA to be transcribed into the target plant, thereby improving the efficiency of plant biselastic mutation.

8. A method for improving the inference efficiency of CRISPR gene editing in plants, characterized in that, The method includes the step of introducing recombinant nucleic acids obtained by linking the DNA molecule of claim 1 as a promoter to the DNA to be transcribed into the target plant, thereby improving the efficiency of plant CRISPR editing inference.

9. A method for improving the efficiency of homozygous mutations in plant gene editing, characterized in that, The method includes the step of introducing recombinant nucleic acids obtained by linking the DNA molecule of claim 1 as a promoter to the DNA to be transcribed into the target plant, thereby improving the efficiency of homozygous mutation of plant genes.

10. The application according to claim 4, and / or the method according to any one of claims 5-9, characterized in that, The plant is any one of the following: N1) Dicotyledons or Magnoliopsida plants. N2) Plants of the order Lamiaceae or Solanales N3) Plants of the Lamiaceae or Solanaceae families. N4) Plants of the genera *Salvia* or *Nicotiana*. N5) Danshen or tobacco.

Images