An engineered extracellular vesicle based on polypeptide-rna specific recognition and a preparation method thereof

Abstract

The present application relates to a kind of engineering cell external vesicle preparation system loaded target gene, it is characterized in that, include: fusion gene XY coding frame;It includes the gene X of coding extracellular vesicle abundant protein, and sequence-specific RNA binding polypeptide coding gene Y;Target gene, and non-coding region sequence;The non-coding region is configured to be recognized by the sequence-specific RNA binding polypeptide;And the engineering cell that can simultaneously express fusion gene XY coding frame and target gene, non-coding region sequence.This application can not only change RNA composition in extracellular vesicle, but also can quickly deliver target RNA to cell and tissue quickly.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to an engineered extracellular vesicle based on peptide-RNA specific recognition and its preparation method. Background Technology

[0002] Extracellular vesicles are different types of membrane vesicles secreted by cells, including exosomes originating from the endosomal system and microvesicles originating from the serous membrane. Extracellular vesicles carry biomolecules such as RNA, proteins, and lipids, and are important mediators of intercellular communication. Extracellular vesicles can efficiently transport the biomolecules they carry into recipient cells, exhibiting characteristics such as targeted delivery and low immunogenicity. Numerous studies have shown that extracellular vesicles derived from different cell types can effectively treat a variety of diseases. To further enhance the therapeutic effects of extracellular vesicles, exogenous loading methods such as co-incubation, ultrasonic incubation, electroporation, saponin incubation, repeated freeze-thaw cycles, and transfection can be used to increase the content of therapeutic molecules within the vesicles.

[0003] mRNA technology has become a research hotspot in the biomedical field in recent years. It involves synthesizing and modifying mRNA using DNA as a template through in vitro transcription, then delivering it into the recipient's cells via a lipid nanoparticle delivery system. The cell's own translation system then translates the mRNA into the target protein, achieving clinical therapeutic goals. Although mRNA technology has demonstrated numerous advantages in vaccine development, tumor immunotherapy, and cell genetic engineering, its complex and time-consuming preparation process results in high costs.

[0004] While natural extracellular vesicles can carry non-coding RNA and mRNA, the amount they carry varies, making it difficult to obtain extracellular vesicles rich in therapeutically relevant RNA molecules. Therefore, the amount of extracellular vesicles used in disease treatment is usually large, resulting in high preparation time and cost. How to prepare extracellular vesicles rich in therapeutically relevant RNA molecules has become a bottleneck limiting the clinical application of extracellular vesicles. Summary of the Invention

[0005] To address the technical problems existing in the prior art, this invention proposes an engineered extracellular vesicle preparation system loaded with a target gene, characterized by comprising: a fusion gene XY coding frame; which includes: a gene X encoding a protein-rich extracellular vesicle and a sequence-specific RNA-binding polypeptide encoding a gene Y; a target gene coding frame, which includes: a target gene and a sequence-specific RNA configured to be recognized and / or bound by the sequence-specific RNA-binding polypeptide; and engineered cells capable of simultaneously expressing the fusion gene XY coding frame and the target gene coding frame.

[0006] The preparation system described above is characterized in that the extracellular vesicles are rich in proteins selected from one or more of the following proteins: CD9, CD63, CD81, CD82, Flotilin 1, Flotilin 2, and Syntenin-1.

[0007] The preparation system described above is characterized in that the sequence-specific RNA-binding polypeptide comprises 10-100 amino acid residues configured to recognize and bind to a non-coding region sequence; preferably, the amino acid sequence of the sequence-specific RNA-binding polypeptide is selected from one or more of SEQ ID NO. 1-3, or has at least 80% homology with one or more of SEQ ID NO. 1-3, or is a polyploid tandem sequence of one or more of SEQ ID NO. 1-3.

[0008] The preparation system described above is characterized in that the amino acid sequence of the sequence-specific RNA-binding polypeptide is a polyploid of any one or more of the amino acid sequences shown in SEQ ID NO. 1-3; preferably, the amino acid sequence of the sequence-specific RNA-binding polypeptide is a polyploid of the amino acid sequence shown in SEQ ID NO. 1; preferably, the amino acid sequence of the sequence-specific RNA-binding polypeptide is a diploid of the amino acid sequence shown in SEQ ID NO. 1; preferably, the monomers in the diploid or polyploid form a first flexible linker; preferably, the amino acid sequence of the first flexible linker is as shown in SEQ ID NO. 10.

[0009] The preparation system described above is characterized in that the fusion gene XY further includes a second flexible linker coding sequence connecting the gene X and the gene Y; preferably, the amino acid sequence of the flexible linker coding sequence is shown in SEQ ID NO. 11.

[0010] The preparation system described above is characterized by further comprising: promoter A, configured to guide the XY coding frame of the fusion gene; and / or promoter B, configured to guide the target gene and a sequence-specific RNA sequence; preferably, promoter A and promoter B are both highly transcriptionally active promoters; preferably, promoter A and promoter B are the same or different; preferably, promoter A and / or promoter B are selected from one or more of the following promoters: human cytomegalovirus immediate early promoter, elongation factor 1α promoter; preferably, the nucleotide sequence of the human cytomegalovirus immediate early promoter is shown in SEQ ID NO. 12; preferably, the nucleotide sequence of the elongation factor 1α promoter is shown in SEQ ID NO. 16.

[0011] The preparation system described above is characterized in that the sequence-specific RNA sequence comprises 10-200 ribonucleotides; preferably, the nucleotide sequence of the sequence-specific RNA sequence is selected from any of the sequences shown in SEQ ID NO. 4-9, or mutants of any of the sequences shown in SEQ ID NO. 4-9, or a combination or tandem repeat sequence of any of the sequences shown in SEQ ID NO. 4-9 or mutants thereof.

[0012] The preparation system described above is characterized in that the target gene coding frame further includes a polyadenylation signal coding sequence of human α-globin; preferably, the polyadenylation signal coding sequence of human α-globin is shown in SEQ ID NO.15.

[0013] The preparation system described above is characterized in that the target gene is a protein-coding gene or a non-protein-coding gene; preferably, the target gene coding frame is linear RNA or circular RNA.

[0014] A method for preparing engineered extracellular vesicles containing a target gene, characterized by comprising the following steps: constructing a fusion gene XY coding frame comprising an extracellular vesicle-rich protein-sequence-specific RNA-binding polypeptide fusion protein; constructing a target gene coding frame comprising the target gene and a sequence-specific RNA sequence; constructing an expression vector comprising both the fusion gene XY coding frame and the target gene coding frame; transferring the expression vector described in step XY into specific cells to construct engineered cells; and using the engineered cells to prepare extracellular vesicles, which are engineered extracellular vesicles containing the target gene.

[0015] This invention enables the one-step production of engineered extracellular vesicles rich in the target gene by fusing sequence-specific RNA-binding peptides with extracellular vesicle-rich proteins and modifying the 3'UTR of the target gene with an RNA motif recognized by the sequence-specific RNA-binding peptides to construct engineered cells. Compared with existing methods, the method provided by this invention is not only convenient and rapid to operate, but also lower in cost and has broad application prospects. Attached Figure Description

[0016] The accompanying drawings, which constitute a part of this application, are used to provide a further understanding of the invention. The illustrative embodiments and descriptions of the invention are used to explain the invention and do not constitute an improper limitation of the invention. Below, preferred embodiments of the invention will be described in further detail with reference to the accompanying drawings, wherein: Figure 1 This is a schematic diagram of a fusion gene expression frame that can express an extracellular vesicle-rich protein-sequence-specific RNA-binding polypeptide fusion protein according to an embodiment of the present invention; wherein Promoter A represents the promoter, 5'UTR represents the 5' untranslated region, 3'UTR represents the 3' untranslated region, Gene X and Gene Y represent the extracellular vesicle-rich protein-coding gene and the sequence-specific RNA-binding polypeptide-coding gene, respectively, Fusion gene XY represents the fusion gene composed of Gene X and Gene Y, and Gene of Interest represents the target gene; Figure 2 According to one embodiment of this application, the expression cassette incorporates an RNA motif that is specifically recognized by an RNA-binding peptide; wherein Promoter A represents a promoter, 5'UTR represents a 5' untranslated region, 3'UTR represents a 3' untranslated region, RNA motif is an RNA motif that can be specifically recognized by an RNA-binding peptide, and 3'UTRrm represents a 3' untranslated region incorporated into the RNA motif. Figures 3a-3b The expression vector pEV1-EGFP according to one embodiment of this application (e.g.) Figure 3a The plasmid maps of pEV0-EGFP (as shown) and pEV0-EGFP (as shown) Figure 3b (as shown) Figures 4a-4b Stable transfection of pEV1-EGFP according to one embodiment of this application ( Figure 4a ) and pEV0-EGFP ( Figure 4b HEK293T cells all expressed green fluorescent protein; and Figures 5a-5dThese are fluorescence images of extracellular vesicles extracted from HEK293T cells stably transfected with pEV1-EGFP and pEV0-EGFP, according to an embodiment of this application, after co-incubation with untransfected HEK293T cells for 24 h and 48 h. Detailed Implementation

[0017] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0018] In the following detailed description, reference can be made to the accompanying drawings, which form part of this application and illustrate specific embodiments of the present application. In the drawings, similar reference numerals describe substantially similar components in different figures. Specific embodiments of the present application are described in sufficient detail below to enable those skilled in the art to implement the technical solutions of the present application. It should be understood that other embodiments or structural changes to the embodiments of the present application may also be utilized.

[0019] This invention creatively utilizes the highly specific binding ability of sequence-specific RNA-binding peptides to their corresponding RNA motifs. By using a protein-rich fusion protein-coding gene expression cassette carrying the sequence-specific RNA-binding peptide and a target gene expression cassette modified with an RNA motif-coded sequence, specific cells are genetically modified to construct engineered cells. These engineered cells are then used to prepare extracellular vesicles rich in the target gene. This method not only enables the preparation of extracellular vesicles rich in the target gene but also achieves efficient intracellular delivery of non-coding RNA of the target gene, and can deliver and express mRNA. Compared with existing technologies, this method has advantages such as simple preparation process and convenient intracellular delivery.

[0020] This invention provides a method for preparing engineered extracellular vesicles rich in a target gene, characterized by comprising the following steps: (1) Construct a fusion gene coding frame that can express extracellular vesicle-rich protein-sequence-specific RNA-binding polypeptide fusion protein (e.g., Figure 1 (as shown) (2) Construct a target gene coding frame (e.g., one that expresses an RNA motif specifically recognized by the RNA-binding polypeptide described in step (1)). Figure 2 (as shown) (3) Construct an expression vector containing the gene coding frames described in steps (1) and (2); (4) Transform the expression vector described in step (3) into specific cells to construct engineered cells; (5) The extracellular vesicles prepared using engineered cells are engineered extracellular vesicles rich in the target gene.

[0021] The present invention also provides an engineered extracellular vesicle preparation system loaded with a target gene, characterized in that it comprises: a fusion gene XY coding frame; which includes: a gene X encoding a protein-rich extracellular vesicle and a sequence-specific RNA-binding polypeptide encoding a gene Y; a target gene coding frame, which includes: a target gene and sequence-specific RNA configured to be recognized and / or bound by the sequence-specific RNA-binding polypeptide; and engineered cells capable of simultaneously expressing the fusion gene XY coding frame and the target gene coding frame. In an optional embodiment, the fusion gene XY further includes a second flexible linker coding sequence connecting the gene X and the gene Y; preferably, the amino acid sequence of the flexible linker coding sequence is as shown in SEQ ID NO. 11.

[0022] In one alternative embodiment, the extracellular vesicles are rich in proteins including one or more combinations of CD9, CD63, CD81, CD82, Flotilin 1, Flotilin 2, and Syntenin-1 (i.e., SDCBP, a multiligand glycan-binding protein).

[0023] Sequence-specific RNA-binding peptides are a class of peptides or proteins that can recognize and bind to RNA molecules with high affinity and high selectivity based on specific nucleotide sequences within the RNA molecule, rather than solely on its spatial structure. In one optional embodiment, the sequence-specific RNA-binding peptide comprises 10-100 amino acid residues configured to recognize and bind to non-coding sequences. In some embodiments, the amino acid sequence of the sequence-specific RNA-binding polypeptide is selected from one or more of SEQ ID NO. 1-3, or has at least 80% homology with one or more of SEQ ID NO. 1-3, or is a polyploid tandem sequence of one or more of SEQ ID NO. 1-3; preferably, in an optional embodiment, the amino acid sequence of the sequence-specific RNA-binding polypeptide is a polyploid of the amino acid sequence shown in any one or more of SEQ ID NO. 1-3; preferably, in an optional embodiment, the amino acid sequence of the sequence-specific RNA-binding polypeptide is a polyploid of the amino acid sequence shown in SEQ ID NO. 1; preferably, in an optional embodiment, the amino acid sequence of the sequence-specific RNA-binding polypeptide is a diploid of the amino acid sequence shown in SEQ ID NO. 1; preferably, in an optional embodiment, the monomers constituting the diploid or polyploid include a first flexible linker; preferably, in an optional embodiment, the amino acid sequence of the first flexible linker is as shown in SEQ ID NO. 10.

[0024] In one alternative embodiment, the sequence-specific RNA-binding polypeptide is one of P22 (GNAKTRRHERRRKLAIERDTIG (as shown in SEQ ID NO.1)), N22 (MDAQTRRRERRAEKQAQWKAAN (as shown in SEQ ID NO.2)), φ22 (GTAKSRYKARRAELIAERRSNE (as shown in SEQ ID NO.3)), or a mutant thereof, or a tandem repeat sequence thereof.

[0025] In some embodiments, the preparation system further includes: promoter A, configured to guide the XY coding frame of the fusion gene; and / or promoter B, configured to guide the target gene and a sequence-specific RNA sequence; preferably, in some embodiments, promoter A and promoter B are both highly transcriptionally active promoters; preferably, in some embodiments, promoter A and promoter B are the same or different; preferably, in some embodiments, promoter A and / or B are selected from one or more of the following promoters: human cytomegalovirus immediate early promoter, elongation factor 1α promoter; preferably, in some embodiments, the nucleotide sequence of human cytomegalovirus immediate early promoter is as shown in SEQ ID NO. 12; preferably, in some embodiments, the nucleotide sequence of elongation factor 1α promoter is as shown in SEQ ID NO. 16.

[0026] In some embodiments, the non-coding region includes a sequence-specific RNA sequence configured to be recognized and bound by a sequence-specific RNA-binding polypeptide; preferably, in some embodiments, the sequence-specific RNA sequence includes 10-200 ribonucleotides; preferably, in some embodiments, the nucleotide sequence of the sequence-specific RNA sequence is selected from any of the sequences shown in SEQ ID NO. 4-9, or mutants of any of the sequences shown in SEQ ID NO. 4-9, or a combination or tandem repeat sequence of any of the sequences shown in SEQ ID NO. 4-9 or mutants thereof.

[0027] In one alternative embodiment, the RNA sequence recognized by the sequence-specific RNA binding peptide is one of the following: P22B-box-L (5'-GCGCUGACAAAGCGC-3' (as shown in SEQ ID NO.4)), P22 B-box-R (5'-ACCGCCGACAACGCGGU-3' (as shown in SEQ ID NO.5)), N22 B-box-L (5'-GCCCUGAAGAAGGGC-3' (as shown in SEQ ID NO.6)), N22 B-box-R (5'-GCCCUGAAAAAGGGC-3' (as shown in SEQ ID NO.7)), φ22 B-box-L (5'-CUCAACCUAACCGUUGAG-3' (as shown in SEQ ID NO.8)), φ22 B-box-R (5'-CACCUCUAACCGGGUG-3' (as shown in SEQ ID NO.9)), or a mutant thereof, or a tandem repeat thereof.

[0028] In some embodiments, the target gene coding frame includes a polyadenylation signal coding sequence of human α-globin; preferably, the polyadenylation signal coding sequence of human α-globin is shown in SEQ ID NO.15.

[0029] In some embodiments, the target gene is a protein-coding gene or a non-protein-coding gene; preferably, the target gene coding frame is linear RNA or circular RNA.

[0030] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0031] Example 1: Construction of pEV1-EGFP In this embodiment, taking the reporter gene enhanced green fluorescent protein (EGFP) as an example, a eukaryotic expression vector pEV1-EGFP for preparing engineered extracellular vesicles rich in EGFP mRNA is constructed.

[0032] In this embodiment, promoter A is selected as the human cytomegalovirus immediate early promoter; promoter B is selected as the elongation factor 1α promoter; the sequence-specific RNA-binding polypeptide is selected as the P22 diploid, and its monomeric amino acid sequence is GNAKTRRHERRRKLAIERDTIG (as shown in SEQ ID NO.1); the gene encoding the high-abundance extracellular vesicle protein is selected as Syntenin-1 (i.e., SDCBP, a multiligand glycan-binding protein); the amino acid sequence of the flexible linker between P22 diploids is GSGSGS (as shown in SEQ ID NO.10); the amino acid sequence of the flexible linker between the P22 diploid and SDCBP is GGGSGS (as shown in SEQ ID NO.11); the RNA motif recognized by the sequence-specific RNA-binding polypeptide P22 is 5'-GCGCUGACAAAGCGC-3' (as shown in SEQ ID NO.1). (As shown in NO.4) The diploid coding sequence of the RNA motif is incorporated into the 3'-UTR coding sequence of the EGFP expression cassette, and the polyadenylation signal sequence of human α-globin is incorporated downstream of it.

[0033] The plasmid map of the eukaryotic expression vector pEV1-EGFP is as follows: Figure 3a and Figure 3b As shown, where: The sequence of the human cytomegalovirus immediate early promoter (Promoter A) is: 5'-CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCTACCGGTCGCCACC-3' (as shown in SEQ ID NO.12); The EGFP coding sequence is: ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGACAAGGCGGCGAATTCAAGCTTCTCGAGTAA (as shown in SEQ ID NO.13); The coding sequence of the RNA motif B-box diploid that can be recognized by P22 is: 5’-AAATTGGCGCTGACAAAGCGCCAATTGGCGCTGACAAAGCGCCAA-3’ (as shown in SEQ ID NO.14); The coding sequence for the human α-globin polyadenylation signal is: 5'-GCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGTCTGAGTGGGCGGCA-3' (as shown in SEQ ID NO.15); The elongation factor 1α promoter (promoter B) sequence is: 5'-AGGTCTTGAAAGGAGTGGGAATTGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGATCCGGTGCCTAGAGAAGGTGGCGCGGGGTAA ACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGACCGGTTCTAGAGCGCTGCCACC-3' (as SEQ. ID NO.16 shown); The pEV1-EGFP vector also includes the SV40 polyadenylation signal sequence, which is inherent to the vector itself and located downstream of the 3'UTRrm. Its sequence is: 5'-AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA-3' (as shown in SEQ ID NO.18). pEV1-EGFP was digested with BamHI to delete the 186 bp sequence encoding the diploid P22 peptide. The vector fragment was recovered after agarose gel electrophoresis and self-circulated using T4 DNA ligase to obtain the control vector pEV0-EGFP (e.g., pEV0-EGFP). Figure 3b (As shown). pEV0-EGFP and pEV1-EGFP were extracted using an endotoxin-free plasmid extraction kit, and the plasmid concentrations were determined. They were then stored at -20°C for later use.

[0034] Example 2: Extraction of extracellular vesicles 1. HEK 293T cells were transfected with pEV0-EGFP and pEV1-EGFP, respectively.

[0035] 24 hours after transfection, G418 was added to the culture medium to a final concentration of 2 mg / mL. The medium was changed every other day. Cells were screened until all cells showed bright green fluorescence under an inverted fluorescence microscope (e.g., Figure 4a and Figure 4b (As shown).

[0036] HEK 293T cells stably transfected with pEV0-EGFP and pEV1-EGFP were cultured in DMEM complete medium, and 200 mL of culture supernatant was collected after 72 h. 2. Centrifuge at 3000g for 15 min at 4℃ to remove cell debris; harvest the supernatant; 3. Add 0.25 volumes of PBS containing 10% PEG8000, mix thoroughly, and incubate at 4°C for 16 h; 4. Centrifuge at 15000g for 60 min at 4℃ and collect the precipitate; 5. Gently resuspend the precipitate in 2 mL of pre-cooled PBS; 6. Repeat steps 4 and 5 twice; 7. Resuspend the precipitate in 1 mL of pre-cooled PBS; 8. Store the obtained extracellular vesicle solution at -80℃ for later use.

[0037] Example 3: Extracellular vesicle-mediated intracellular mRNA delivery 1. HEK 293T cells in logarithmic growth phase were seeded into 6-well plates and cultured at 37°C, saturated humidity, and 5% CO2 (V / V) for 24 h; 2. Add the extracellular vesicles from cells stably transfected with pEV0-EGFP and pEV1-EGFP as described in Example 2, respectively; 3. Observe the green fluorescence after 24 h and 48 h respectively.

[0038] The results are as follows Figures 5a-5d As shown: After intervention with extracellular vesicles derived from pEV0-EGFP stably transfected cells, regardless of 24 h (e.g. Figure 5b (as shown) or at 48 h (as shown) Figure 5d No green fluorescence was observed in any of the samples shown, indicating that extracellular vesicles derived from stably transfected pEV0-EGFP cells could not deliver EGFP mRNA into the cells. After intervention with extracellular vesicles extracted from stably transfected pEV1-EGFP cells, scattered fluorescent spots (such as...) were visible after 24 hours. Figure 5a As shown), a large number of green fluorescent spots can be observed after 48 hours (e.g. Figure 5c As shown in the figure, this suggests that extracellular vesicles derived from stably transfected pEV1-EGFP cells can not only deliver EGFP mRNA into the cell, but also that this mRNA can be efficiently translated into EGFP protein.

[0039] Example 4: Detection of EGFP mRNA in extracellular vesicles 1. Take 20 μL of extracellular vesicles from stably transfected cells of pEV0-EGFP and pEV1-EGFP, and extract total RNA using the Trizol one-step method; 2. EGFP mRNA was detected using the Advantage RT-for-PCR kit (Takara). The upstream primer was 5'-GCCACAAGTTCAGCGTGTCC-3' (as shown in SEQ ID NO.19), and the downstream primer was 5'-CAGCAGGACCATGTGATCGC-3' (as shown in SEQ ID NO.20). The cycling parameters were set as follows: denaturation 95 ℃ for 30 s, annealing 58 ℃ for 30 s, extension 72 ℃ for 30 s, for a total of 30 cycles.

[0040] 3. Analyze the RT-PCR products using 2% TAE agarose gel electrophoresis.

[0041] The results showed that using total RNA from extracellular vesicles of stably transfected pEV1-EGFP cells as a template, approximately 593 bp of the target fragment could be amplified, while using total RNA from extracellular vesicles of stably transfected pEV0-EGFP cells as a template, approximately 593 bp of the target fragment could not be amplified. This suggests that extracellular vesicles from stably transfected pEV1-EGFP cells carry EGFP mRNA, while extracellular vesicles from stably transfected pEV0-EGFP cells do not carry EGFP mRNA.

[0042] The above embodiments are for illustrative purposes only and are not intended to limit the invention. Those skilled in the art can make various changes and modifications without departing from the scope of the invention. Therefore, all equivalent technical solutions should also fall within the scope of the invention.

Claims

1. A system for preparing engineered extracellular vesicles loaded with a target gene, characterized in that, Include: XY coding frames of fusion genes; It includes: gene X, which encodes extracellular vesicles rich in proteins, and gene Y, which encodes sequence-specific RNA-binding polypeptides; A target gene coding frame, comprising: a target gene, and sequence-specific RNA configured to be recognized and / or bound by the sequence-specific RNA-binding polypeptide; and Engineered cells that can simultaneously express the XY coding frames of fusion genes and the coding frames of target genes.

2. The preparation system according to claim 1, characterized in that, The extracellular vesicles are rich in proteins selected from one or more of the following proteins: CD9, CD63, CD81, CD82, Flotilin 1, Flotilin 2, and Syntenin-1.

3. The preparation system according to claim 1, characterized in that, The sequence-specific RNA-binding polypeptide comprises 10-100 amino acid residues configured to recognize and bind to a non-coding region sequence; preferably, the amino acid sequence of the sequence-specific RNA-binding polypeptide is selected from one or more of SEQ ID NO. 1-3, or has at least 80% homology with one or more of SEQ ID NO. 1-3, or is a polyploid tandem sequence of one or more of SEQ ID NO. 1-3.

4. The preparation system according to claim 1, characterized in that, The amino acid sequence of the sequence-specific RNA-binding polypeptide is a polyploid of any or more of the amino acid sequences shown in SEQ ID NO. 1-3; Preferably, the amino acid sequence of the sequence-specific RNA-binding polypeptide is a polyploid of the amino acid sequence shown in SEQ ID NO.1; Preferably, the amino acid sequence of the sequence-specific RNA-binding polypeptide is a diploid of the amino acid sequence shown in SEQ ID NO.1; Preferably, the monomers in the diploid or polyploid organisms include a first flexible joint; Preferably, the amino acid sequence of the first flexible connector is as shown in SEQ ID NO.

10.

5. The preparation system according to claim 1, characterized in that, The fusion gene XY further includes a second flexible linker coding sequence connecting the gene X and the gene Y; preferably, the amino acid sequence of the flexible linker coding sequence is shown in SEQ ID NO.

11.

6. The preparation system according to claim 1, characterized in that, Further includes: Promoter A; It is configured to guide the XY coding frame of the fusion gene; and / or Promoter B; which is configured to guide the target gene and sequence-specific RNA sequence; Preferably, both promoter A and promoter B are highly transcriptionally active promoters; Preferably, promoter A and promoter B are the same or different; Preferably, promoter A and / or B are selected from one or more of the following promoters: human cytomegalovirus immediate early promoter, elongation factor 1α promoter. Preferably, the nucleotide sequence of the early promoter of human cytomegalovirus is shown in SEQ ID NO.12; Preferably, the nucleotide sequence of the elongation factor 1α promoter is shown in SEQ ID NO.

16.

7. The preparation system according to claim 1, characterized in that, The sequence-specific RNA sequence comprises 10-200 ribonucleotides; Preferably, the nucleotide sequence of the sequence-specific RNA sequence is selected from any of the sequences shown in SEQ ID NO.4-9, or mutants of any of the sequences shown in SEQ ID NO.4-9, or a combination or tandem repeat sequence of any of the sequences shown in SEQ ID NO.4-9 or mutants thereof.

8. The preparation system according to claim 1, characterized in that, The target gene coding frame further includes a polyadenylation signal coding sequence of human α-globin; preferably, the polyadenylation signal coding sequence of human α-globin is shown in SEQ ID NO.

15.

9. The preparation system according to claim 1, characterized in that, The target gene is a protein-coding gene or a non-protein-coding gene; Preferably, the target gene coding frame is a linear RNA or a circular RNA.

10. A method for preparing engineered extracellular vesicles containing a target gene, characterized in that, Includes the following steps: Construct an XY coding frame for a fusion gene containing a protein-sequence-specific RNA-binding polypeptide fusion protein from extracellular vesicles; Construct a target gene coding frame that includes the target gene and a sequence-specific RNA sequence; Construct expression vectors that simultaneously include the XY coding frames of the fusion gene and the coding frames of the target gene; The expression vector described in the steps is transferred into specific cells to construct engineered cells; Extravesicles prepared using the engineered cells are engineered extracellular vesicles containing the target gene.

Images