A circular RNA rapid delivery system and a delivery method using the same

Abstract

The present application relates to a rapid delivery system of a target gene, characterized in that it comprises: a ternary fusion protein comprising: a transmembrane peptide configured to mediate a polypeptide or protein molecule fused thereto to pass through a cell membrane into a cell; an elastin-like polypeptide configured to respond to environmental factors; preferably, the environmental factors are selected from one or more of temperature, pH, salt concentration, and a sequence-specific RNA binding polypeptide configured to recognize and bind to a sequence-specific RNA; and a sequence-specific RNA coupled with a target gene; preferably, the target gene and the sequence-specific RNA are loaded on a circular RNA. The present application realizes the integration of circular RNA purification and delivery through a ternary fusion protein-circular RNA ribonucleoprotein complex, which is not only convenient and fast to operate, but also low in cost, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to a rapid delivery system for circular RNA and a delivery method using this system. Background Technology

[0002] mRNA technology has become a research hotspot in the biomedical field in recent years. It involves synthesizing and modifying mRNA in vitro using DNA as a template, then delivering it into human cells via a delivery system. The cells' own translation system then translates the mRNA into target proteins to achieve clinical therapeutic goals. While mRNA technology has demonstrated numerous advantages in vaccine development, tumor immunotherapy, and cell genetic engineering, its complex and time-consuming preparation process results in high costs. Although the emergence of circular RNA technology has solved the problems of poor stability and susceptibility to nuclease degradation of linear RNA, the issues of complex processes and high costs have not been significantly improved.

[0003] Circular RNA (circRNA), a type of single-stranded RNA with a covalently closed structure, was first discovered in higher plants. With the rapid development of high-throughput RNA sequencing technology and bioinformatics algorithms, the generation, regulation, and function of circRNA have been studied in greater depth. Due to its unique biological characteristics, it can function as a protein and gene sponge, a regulator of cell activity, and a contributor to protein translation in organisms, and is being explored as a potential therapeutic target for cancer and neurodegenerative diseases. However, the expression abundance of circRNA in cells is usually low, and it exhibits high heterogeneity, posing challenges to its isolation and purification. Existing purification techniques suffer from complex processes, high costs, and low delivery efficiency, making it difficult to meet the needs of large-scale production and research, thus limiting its widespread application. Summary of the Invention

[0004] To address the technical problems existing in the prior art, this invention proposes a rapid circular RNA delivery system, characterized by comprising: a ternary fusion protein, wherein the ternary fusion protein includes: a transmembrane peptide configured to mediate the passage of a fused polypeptide or protein molecule across the cell membrane into the cell; an elastin-like polypeptide configured to respond to environmental factors; preferably, the environmental factors are selected from one or more of temperature, pH, and salt concentration; a sequence-specific RNA-binding polypeptide configured to recognize and bind to a sequence-specific RNA; and a sequence-specific RNA coupled to a target gene; preferably, the target gene and the sequence-specific RNA are loaded onto a circular RNA.

[0005] The circular RNA rapid delivery system described above is characterized in that the membrane-penetrating peptide comprises 4-100 amino acid residues.

[0006] The circular RNA rapid delivery system described above is characterized in that the amino acid sequence of the transmembrane peptide is selected from any of the amino acid sequences shown in SEQ ID NO. 1-10, or mutants of any of the amino acid sequences shown in SEQ ID NO. 1-10, or tandem repeat sequences of one or more of SEQ ID NO. 1-10 or mutants thereof.

[0007] The circular RNA rapid delivery system described above is characterized in that the amino acid sequence of the elastin-like polypeptide includes a tandem repeat sequence of VPGXG and / or VAPGXG; preferably, X is any non-proline amino acid.

[0008] The circular RNA rapid delivery system described above is characterized in that the amino acid sequence of the elastin-like polypeptide is as shown in SEQ ID .13.

[0009] The circular RNA rapid delivery system described above is characterized in that the sequence-specific RNA-binding polypeptide comprises 10-100 amino acid residues.

[0010] The circular RNA rapid delivery system described above is characterized in that the amino acid sequence of the sequence-specific RNA-binding polypeptide is selected from any of the amino acid sequences shown in SEQ ID. 14-16, or mutants of any of the amino acid sequences shown in SEQ ID. 14-16, or tandem repeat sequences of one or more of SEQ ID. 14-16 or mutants thereof.

[0011] The circular RNA rapid delivery system described above is characterized in that the sequence-specific RNA sequence comprises 10-200 ribonucleotides.

[0012] The circular RNA rapid delivery system as described above is characterized in that the sequence-specific RNA is selected from any of the RNA sequences shown in SEQ ID .17-20, or mutants of any of the RNA sequences shown in SEQ ID .17-20, or tandem repeat sequences of one or more of SEQ ID .17-20 or mutants thereof.

[0013] A method for rapid intracellular delivery of a target gene includes: loading the target gene into any of the above-described rapid circular RNA delivery systems, specifically including: constructing the target gene into an expression vector capable of expressing circular RNA, wherein the circular RNA includes sequence-specific RNA; binding a ternary fusion protein to the circular RNA to obtain a ternary fusion protein-circular RNA complex; wherein the ternary fusion protein includes a membrane-penetrating peptide, an elastin-like polypeptide, and a sequence-specific RNA-binding polypeptide; mixing and incubating the ternary fusion protein-circular RNA complex with target cells, or directly delivering the ternary fusion protein-circular RNA complex to a designated tissue of a subject; preferably, the delivery method is selected from injection.

[0014] This invention provides a rapid purification and delivery method for circular RNA based on sequence-specific RNA-binding peptides. The method involves fusing the sequence-specific RNA-binding peptide with a pH-responsive elastin-like peptide and a cell-penetrating peptide for induced expression. A ternary fusion protein is obtained through 2-3 rounds of pH conversion purification. The pCIR contains splicing sequences on both sides of a self-splicing intron, which form a circular RNA through self-splicing after mRNA induction expression. Simultaneously, it is designed with RNA sequences that can be recognized and bound by the sequence-specific RNA-binding peptide. The sequence-specific RNA-binding peptide in the ternary fusion protein binds to the circular RNA to form a ribonucleoprotein complex. The pH-responsive elastin-like peptide in the ternary fusion protein rapidly purifies the ternary fusion protein-circular RNA complex through pH conversion. Utilizing the efficient protein transduction properties of the cell-penetrating peptide in the ternary fusion protein, the ternary fusion protein-circular RNA complex is directly used to deliver circular RNA to cells and tissues. This method integrates circular RNA purification and delivery through the ternary fusion protein-circular RNA-ribonucleoprotein complex, offering convenient and rapid operation at a low cost, and has broad application prospects. Attached Figure Description

[0015] The accompanying drawings, which constitute a part of this application, are used to provide a further understanding of the invention. The illustrative embodiments and descriptions of the invention are used to explain the invention and do not constitute an improper limitation of the invention. Below, preferred embodiments of the invention will be described in further detail with reference to the accompanying drawings, wherein: Figure 1 This is a schematic diagram of the pHRELP20-[HRELP4-P22]1 expression vector according to an embodiment of the present invention; Figure 2 This is a schematic diagram of the pHRELP20-[HRELP4-P22]2 expression vector according to an embodiment of the present invention; Figure 3This is a schematic diagram of the pHRELP20-[HRELP4-P22]3 expression vector according to an embodiment of the present invention; Figure 4 This is a schematic diagram of electrophoretic analysis of pHRELP20-[HRELP4-P22]n (n=1, 2, 3) plasmid digestion according to an embodiment of the present invention; wherein, lane M is a 5000 DNA ladder; lane 1 is the double digestion product of HRELP20-[HRELP4-P22]1 plasmid; lane 2 is the double digestion product of HRELP20-[HRELP4-P22]2 plasmid; and lane 3 is the double digestion product of HRELP20-[HRELP4-P22]3 plasmid. Figure 5 This is a schematic diagram of the purification process of the HRELP20-[HRELP4-P22]n (n=1, 2, 3) fusion protein according to an embodiment of the present invention; wherein, lane M is the Prestained Protein Ladder, band 1 is the acid-soluble sample, band 2 is the acid-soluble supernatant sample, band 3 is the precipitated sample after alkaline precipitation, and band 4 is the supernatant sample after alkaline precipitation. Figure 6 This is a schematic diagram of a pCIR expression vector according to an embodiment of the present invention; Figure 7 This is a schematic diagram of a pCIR-mCherry expression vector according to an embodiment of the present invention; Figure 8 This is a schematic diagram of electrophoretic analysis of RT-PCR products according to an embodiment of the present invention; wherein, lane M is a 5000 DNA ladder; lane 1 is the RT-PCR product; Figure 9 This is a schematic diagram of electrophoretic analysis of RT-PCR products of the conjugate according to an embodiment of the present invention; wherein, lane M is a 5000 DNA ladder; lane 1 is the RT-PCR product of the Trizol group conjugate sample; and lane 2 is the RT-PCR product of the alkaline lysis group conjugate sample. Figure 10 This is a schematic diagram of the cellular mCherry fluorescence expression of two groups of RNA-bound samples with different amounts of HRELP20-[HRELP4-P22]1 according to an embodiment of the present invention. Figure 11 This is a schematic diagram of the cellular mCherry fluorescence expression of two groups of RNA-bound samples with different amounts of HRELP20-[HRELP4-P22]2 according to an embodiment of the present invention. Figure 12This is a schematic diagram of the cellular mCherry fluorescence expression of two groups of RNA-bound samples with different amounts of HRELP20-[HRELP4-P22]3 according to an embodiment of the present invention. Figure 13 This is a schematic diagram of the cellular mCherry fluorescence expression of RNA and pure HRELP20-[HRELP4-P22]n (n=1, 2, 3) protein samples according to an embodiment of the present invention; Figure 14 This is a schematic diagram of the mCherry fluorescence expression in tissues injected with the HRELP20-[HRELP4-P22]1-circular RNA complex according to an embodiment of the present invention. Figure 15 This is a schematic diagram of the mCherry fluorescence expression in tissues injected with the HRELP20-[HRELP4-P22]2-circular RNA complex according to an embodiment of the present invention; Figure 16 This is a schematic diagram of the mCherry fluorescence expression in tissues injected with the HRELP20-[HRELP4-P22]3-circular RNA complex according to an embodiment of the present invention; Figure 17 This is a schematic diagram of the mCherry fluorescence expression in tissues after injection of simple RNA and simple HRELP20-[HRELP4-P22]n (n=1, 2, 3) protein according to an embodiment of the present invention. Detailed Implementation

[0016] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0017] In the following detailed description, reference can be made to the accompanying drawings, which form part of this application and illustrate specific embodiments of the present application. In the drawings, similar reference numerals describe substantially similar components in different figures. Specific embodiments of the present application are described in sufficient detail below to enable those skilled in the art to implement the technical solutions of the present application. It should be understood that other embodiments or structural changes to the embodiments of the present application may also be utilized.

[0018] This application relates to a rapid delivery system for circular RNA, characterized in that it comprises: A ternary fusion protein, comprising: a transmembrane peptide configured to mediate the transmembrane entry of a fused polypeptide or protein molecule into the cell; an elastin-like polypeptide configured to respond to environmental factors; preferably, the environmental factors are selected from one or more of temperature, pH, and salt concentration; and a sequence-specific RNA-binding polypeptide configured to recognize and bind to sequence-specific RNA; and An expression vector capable of expressing circular RNA, wherein the circular RNA includes sequence-specific RNA.

[0019] The term "membrane-penetrating peptide" as used in this application refers to a class of short peptides capable of crossing the cell membrane to transport themselves or their target genes or proteins into the cell interior. In some embodiments, membrane-penetrating peptides comprise 4-100 amino acid residues. In some embodiments, membrane-penetrating peptides comprise 5-30 amino acids. In some embodiments, cell-penetrating peptides include TAT (GRKKRRQRRRPQ (as shown in SEQ ID NO. 1)), TATκ (YARKAARQARA (as shown in SEQ ID NO. 2)), Penetratin (RQIKIWFQNRRMKWKK (as shown in SEQ ID NO. 3)), pVEC (IRKQAHAHSK (as shown in SEQ ID NO. 4)), Transportan (GWTLNSAGYLLGKINLKALAALAKKIL (as shown in SEQ ID NO. 5)), CPP5 (VPTLK (as shown in SEQ ID NO. 6) or KLPVM (as shown in SEQ ID NO. 7)), MAP (KLALKLALKALKAALKLA (as shown in SEQ ID NO. 8)), Pep-1 (KETWWETWWTEWSQPKKKRKV (as shown in SEQ ID NO. 9)), and NrTP (YKQSHKKGGKKGSG (as shown in SEQ ID NO. 1)). The sequence may be one or more of the following: NO.10 and polyarginine, or a mutant of any of the above sequences, or a combination or tandem repeat of any of the above sequences or their mutants.

[0020] In this application, TAT refers to transmembrane peptides derived from TAT, also known as TAT ​​PTD (protein transduction domain) or PTD.

[0021] The elastin-like polypeptides described in this application, also known as ELPs or ELPs, are a class of biological macromolecules that respond to environmental factors such as temperature. Preferably, the environmental factors are selected from one or more of temperature, pH, and salt concentration. In some embodiments, the elastin-like polypeptide is a tandem repeat sequence having the sequence characteristics of VPGXG (as shown in SEQ ID NO. 11) and / or VAPGXG (as shown in SEQ ID NO. 12) (where X is any amino acid other than proline). In some embodiments, the amino acid sequence of the elastin-like polypeptide is [(VAPGHG)3(VAPGSG)]20 (as shown in SEQ ID NO. 13).

[0022] In this application, HRELP refers to an elastin-like polypeptide, which is a tandem repeat sequence with the sequence characteristics of VPGXG (as shown in SEQ ID NO.11) and / or VAPGXG (as shown in SEQ ID NO.12) (where X is any amino acid other than proline). HRELP is (VAPGHG)3(VAPGSG), which is the sequence obtained by repeating the VAPGHG sequence three times and then linking it with VAPGSG. HRELP4 is the (VAPGHG)3(VAPGSG) sequence repeated four times; HRELP20 is [(VAPGHG)3(VAPGSG)]20, which is the VAPGHG sequence repeated three times and then linked with VAPGSG, with the resulting sequence repeated 20 times.

[0023] In some embodiments, sequence-specific RNA-binding peptides refer to a class of peptides or proteins that can recognize and bind with high affinity and high selectivity to RNA molecules based on the specific nucleotide sequence in the RNA molecule, rather than solely on its spatial structure.

[0024] In some embodiments, the sequence-specific RNA-binding polypeptide comprises 10-100 amino acid residues. In some embodiments, the sequence-specific RNA-binding polypeptide is P22 (GNAKTRRHERRRKLAIERDTIG (as shown in SEQ ID NO.14)), N22 (MDAQTRRRERRAEKQAQWKAAN (as shown in SEQ ID NO.15)), φ22 (GTAKSRYKARRAELIAERRSNE (as shown in SEQ ID NO.16)), or a mutant thereof, or a tandem repeat sequence thereof.

[0025] Other repetitive sequences in this application have similar labeling methods. For example, HRELP20-[HRELP4-P22]n (n=1, 2, 3) is the sequence after repeating n times by linking the amino acid sequences of HRELP4 and P22, and then linking it with HRELP20. pHRELP20-[HRELP4-P22]n (n=1, 2, 3) refers to a plasmid including HRELP20-[HRELP4-P22]n (n=1, 2, 3), which also includes the TAT sequence. Other repetitive sequences with similar labeling methods will not be described in detail in this application.

[0026] In some embodiments, the sequence-specific RNA sequence comprises 10-200 ribonucleotides. In some embodiments, the sequence-specific RNA sequence is selected from one or more of the following: P22 B-box-L (5'-GCGCUGACAAAGCGC-3' (as shown in SEQ ID NO.17)), P22 B-box-R (5'-ACCGCCGACAACGC agtt GGU-3' (as shown in SEQ ID NO.18)), N22 B-box (5'-GCCCUGAAGAAGGGC-3' (as shown in SEQ ID NO.19)), and φ22 B-box (5'- CUCAACCUAACCGUUGAG-3' (as shown in SEQ ID NO.20)), or a mutant of any sequence of SEQ ID NO.17-20, or a tandem repeat sequence of any sequence of SEQ ID NO.17-20 or a mutant thereof.

[0027] In some embodiments, the ternary fusion protein is HRELP20-[HRELP4-P22]n (n=1, 2, 3). In some embodiments, the ternary fusion protein is HRELP20-[HRELP4-P22]1, HRELP20-[HRELP4-P22]2, or HRELP20-[HRELP4-P22]3.

[0028] This application further relates to a method for rapid intracellular delivery of a target gene, comprising: loading the target gene into any of the above-described circular RNA rapid delivery systems, specifically including: The target gene is constructed into an expression vector capable of expressing circular RNA, wherein the circular RNA includes sequence-specific RNA; The ternary fusion protein is bound to the circular RNA to obtain a ternary fusion protein-circular RNA complex; wherein the ternary fusion protein includes a transmembrane peptide, an elastin-like polypeptide, and a sequence-specific RNA-binding polypeptide. The ternary fusion protein-circular RNA complex is mixed with target cells and incubated, or the ternary fusion protein-circular RNA complex is directly delivered to a designated tissue of the subject; preferably, the delivery method is selected from injection.

[0029] The subjects mentioned in this article refer to humans, animals, etc., who are intended to receive the ternary fusion protein-circular RNA complex. Animals may include mice, rats, rabbits, monkeys, cats, dogs, etc.

[0030] To address the shortcomings of existing technologies, this invention provides a rapid purification and delivery method for circular RNA. This invention innovatively prepares a ternary fusion protein composed of a cell-penetrating peptide, an elastin-like polypeptide, and a sequence-specific RNA-binding polypeptide. This ternary fusion protein, prepared using synthetic biology techniques, can be used simultaneously for the rapid purification and delivery of circular RNA. This method not only avoids the complex processing and purification procedures of existing technologies but also reduces the need for subsequent lipid nanoparticle assembly for intracellular delivery.

[0031] This invention provides a method for rapid purification and delivery of circular RNA, characterized by comprising the following steps: (1) A prokaryotic expression vector for cell-membrane-penetrating peptide-elastin-like peptide-sequence-specific RNA-binding peptide fusion protein was constructed, induced to express and purified to obtain a recombinant ternary fusion protein solution; (2) Construct the circular RNA expression vector pCIR, induce expression, and prepare a total RNA solution or cell lysate containing circular RNA; (3) The ternary fusion protein solution is mixed with the total RNA solution or cell lysis buffer and purified to obtain the ternary fusion protein-circular RNA complex. The complex is then used to transfect cells or injected in vivo to achieve efficient delivery. The cell-penetrating peptide described in step (1) has the property of transporting molecules covalently bound to it into the cell; the elastin-like polypeptide has pH responsiveness; the sequence-specific RNA-binding polypeptide has a high efficiency in binding RNA with specific sequences; the pCIR vector described in step (2) is designed to express an RNA sequence that is specifically recognized by the sequence-specific RNA-binding polypeptide; the pCIR vector is designed with self-splicing intron splicing sequences on both sides, and the target gene is incorporated between the splicing sequences on both sides.

[0032] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0033] Example 1: In this embodiment, a ternary fusion protein expression vector consisting of a cell-penetrating peptide, an elastin-like polypeptide, and a sequence-specific RNA-binding polypeptide was constructed, expressed, and purified. The cell-penetrating peptide was TAT ​​derived from HIV-1, with the amino acid sequence GYGRKKRRQRRR (as shown in SEQ ID NO.1); the elastin-like polypeptide was HRELP20, which is pH-responsive, with the amino acid sequence [(VAPGHG)3(VAPGSG)]20 (as shown in SEQ ID NO.13); and the sequence-specific RNA-binding polypeptide was P22, with the amino acid sequence GNAKTRRHERRRKLAIERDTIG (as shown in SEQ ID NO.14).

[0034] 1. Construction of pHRELP20-[HRELP4-P22]n (n=1, 2, 3) vector: Specific primers were designed based on the P22 sequence. Forward primer: 5'-AAAAGATCTGGTAGCGGTAACGCCAAAACCCGTCGTCATGAACGCCGCCGCAAGCTGGCGATCGAGCGTG-3' (as shown in SEQ ID NO.21); Reverse primer: 5'-AAACTCGAGTCATTAGGATCCGCTGCCATAGCCAATGGTATCACGCTCGATCGCCAGCTTGCGGCGGCGT-3' (as shown in SEQ ID NO.22).

[0035] The P22 gene was prepared by PCR, and the P22 fragment was ligated with HRELP20 and HRELP4 to obtain the expression vector pHRELP20-[HRELP4-P22]n (n=1, 2, 3) (e.g. Figure 1-3 As shown), after double digestion with Bgl II and Xho I, target bands with lengths of approximately 2016 bp, 2391 bp, and 2766 bp were observed (as shown). Figure 4 (As shown).

[0036] 2. Purification of the fusion protein: The recombinant plasmid pHRELP20-[HRELP4-P22]n (n=1, 2, 3) was transformed into Escherichia coli ER2566. Strains expressing the correct plasmid were screened. 1 mL of the positive strain was inoculated into 250 mL of self-induction medium and cultured at 37 ℃ and 220 rpm for 22-24 h. After harvesting, the bacterial cells were sonicated to disrupt their structure. The cell pellet was resuspended in 25 mL of 0.1 M HAc / NaAc (pH 4.0) buffer and incubated overnight at 4 ℃. The pellet was then incubated at 25 ℃ and 12000 rpm for 30 min. The supernatant was transferred, and 11 mL of 1.5 M Tris-HCl (pH 8.8) and 5 M NaCl buffer were added. After mixing and standing at room temperature for 2 h, the protein pellet was collected by centrifugation, yielding the HRELP20-[HRELP4-P22]n (n=1, 2, 3) fusion protein (hereinafter referred to as the ternary fusion protein) (e.g., ...). Figure 5 (As shown).

[0037] Example 2: In this embodiment, a pCIR vector was constructed, its expression was induced, and total RNA was extracted. The pCIR vector contains a T4 phage thymidine synthase self-splicing intron to promote the formation of circular RNA. To promote the translation of the circular RNA into a protein, the ribosomal entry site of human rhinovirus A1 was incorporated into the circular RNA coding sequence. The tetraploid coding sequence of P22 B-box, TGGCGCTGACAAAGCGCCAATTGGCGCTGACAAAGCGCCAATTGGCGCTGACAAAGCGCCAATTGGCGCTGACAAAGCGCCAAT (as shown in SEQ ID NO. 23), was incorporated to enable the circular RNA to bind efficiently and specifically to the HRELP20-[HRELP4-P22]n (n=1, 2, 3) fusion protein.

[0038] The CIR expression cassette sequence was designed, and the pUC57-CIR plasmid was synthesized by Shanghai Sangon Biotech Co., Ltd. The pUC57-CIR plasmid was digested with Xba I and Sal I enzymes, and the CIR fragment was recovered. The pET28a plasmid was digested with Xba I and Xho I, and the pET28a vector was recovered. The pET28a vector was then ligated to the CIR fragment to obtain the pCIR plasmid (e.g., pCIR expression cassette sequence). Figure 6 (As shown). Subsequently, the reporter gene mCherry coding sequence (including the nucleotide sequence of the restriction enzyme sites as shown in SEQ ID NO. 24, where a BamHI restriction site is incorporated upstream and an XhoI restriction site is incorporated downstream) was cloned into the BamHI-XhoI space of the above pCIR to obtain the pCIR-mCherry expression vector (as shown). Figure 7 (As shown). Among them, the mCherry coding sequences known in the art can all be used for the vector construction of this application, and this application does not limit the specific sequence.

[0039] The recombinant plasmid pCIR-mCherry was transformed into E. coli ER2566. Positive clones were screened and inoculated into 20 ml LB broth for 1 mM IPTG induction. After 6 h, 2 mL of the sample was taken, and total RNA was extracted using the Trizol method. The presence of mCherry circular RNA was verified by RT-PCR using primer pair (upstream primer: 5'-GAGCTGGTACTGCATGCACGCAATG-3' (as shown in SEQ ID NO.25); downstream primer: 5'-GATCCCATGATCACAGTATATGTTA-3' (as shown in SEQ ID NO.26)). The RT-PCR product was analyzed by agarose gel electrophoresis, and a target band of approximately 1148 bp was visible (as shown in SEQ ID NO.26). Figure 8 (As shown).

[0040] The TRIzol method for extracting total RNA includes the following steps: Take 1-4 mL of bacterial culture, centrifuge at 5000 g for 5 min at 4℃, discard the LB supernatant, and collect the bacterial precipitate; Add 1 mL of TRIzol to the precipitate and vortex vigorously for 30-60 s; let stand at room temperature for 5 min; add 200 μL of chloroform (0.2 times the volume) to each 1 mL of TRIzol, tighten the cap, shake vigorously for 15 s until the liquid turns milky white, and let stand at room temperature for 3 min.

[0041] Centrifuge at 4 ℃, 12000 g for 15 min; after centrifugation, the mixture separates into three layers: an upper colorless aqueous phase (RNA), a middle white protein / genomic DNA layer, and a lower red organic phase (protein / lipid). Carefully aspirate approximately 300-350 μL of the supernatant aqueous phase and transfer it into a new RNase-free centrifuge tube; Add 0.5 mL of isopropanol (0.5 times the original TRIzol volume) to the aqueous phase, gently invert to mix; let stand at room temperature for 10 min; Centrifuge at 4 ℃ and 12000 g for 10 min. A white gelatinous RNA precipitate will be visible at the bottom of the tube. Slowly aspirate all the supernatant. Add 1 mL of pre-cooled 75% RNase-free ethanol, gently invert to suspend the precipitate; centrifuge at 4 ℃ and 7500 g for 5 min, and discard the supernatant; Instantaneous low-speed centrifugation, even if the pipette aspirates residual ethanol at the bottom; After drying upside down at room temperature for 5-10 min, add 30 μL of RNase-free DEPC water, incubate in a water bath at 55-60 ℃ for 5 min to aid dissolution, mix thoroughly by blowing and stirring, and store at -80 ℃ for later use.

[0042] In this embodiment, total RNA was also extracted using an alkaline lysis method, the steps of which included: Take 1.5 mL of overnight bacteria, centrifuge at 2000 rpm for 1 min, and discard the supernatant; Add 250 μL Solution I (50 mM glucose; 25 mM Tris-HCl pH 8.0; 10 mM EDTA pH 8.0), and vortex thoroughly to break up the bacterial cells without clumping. Add 250 μL Solution II, gently invert 5-6 times, and let stand at room temperature for 3-5 minutes until the solution becomes viscous and clear; Add 350 μL Solution Ⅲ (1.5 mol / L potassium acetate solution, pH 4.8), gently invert to mix, a white flocculent precipitate will appear, incubate on ice for 5 min; Centrifuge at 12000 rpm and 4 ℃ for 10 min; Carefully aspirate the supernatant into a new enzyme-free EP tube to obtain the E. coli alkaline lysis buffer containing total RNA. Store at -80°C for later use.

[0043] Example 3: Delivery System Function Verification In this embodiment, the ternary fusion protein obtained in Example 1 is combined with the total RNA obtained in Example 2 to obtain a ternary fusion protein-circular RNA complex. The complex is then transfected into cells for efficient delivery. The total RNA contains the nucleotide sequence of the target gene. In this embodiment, mCherry is used as an example, serving as the target gene, to verify the function of the delivery system of this application.

[0044] Among them, the circular RNA is designed with a B-box motif homologous to the P22 protein, which can specifically recognize and bind to the circular RNA, greatly improving the purification efficiency of the circular RNA; the cell-penetrating peptide TAT and the P22 polypeptide are used to achieve efficient delivery of the circular RNA.

[0045] This embodiment includes the following steps: (1) Take 1 mL of HRELP20-[HRELP4-P22]n (n=1, 2, 3) protein dissolved in 0.1 M HAC / NaAC (pH4.0) buffer obtained in Example 1, and add 450 µl of 1.5 M Tris-HCl (pH8.8) 5 M NaCl buffer to precipitate the protein.

[0046] (2) The total RNA extracted by the Trizol method obtained in Example 2 was dissolved in 150µl PBS, and 300µl of total RNA was taken to resuspend the protein precipitate. The protein was bound at room temperature for 30 min to obtain the ternary fusion protein-circular RNA complex of the Trizol group.

[0047] (3) Take 1200 µl of the supernatant from the RNA extraction obtained by the alkaline lysis method in Example 2 to resuspend the protein precipitate. Incubate at room temperature for 30 min, centrifuge at 10000 rpm for 5 min, discard the supernatant, and add 300 µl of PBS to redissolve the precipitate, obtaining the ternary fusion protein-circular RNA complex of the "alkaline lysis group". This avoids the formation of large clumps of the ternary fusion protein-circular RNA complex, thus preventing any impact on delivery efficiency. The alkaline lysis method yields a crude extract containing RNA. The protein does not dissolve under neutral pH conditions. After resuspending the protein in the crude extract, the circular RNA specifically binds to the protein, forming the ternary fusion protein-circular RNA complex. This method makes RNA purification and delivery exceptionally simple and significantly reduces costs.

[0048] (4) RT-PCR was performed on the bound samples using the primer pairs shown in SEQ ID NO.24 and SEQ ID NO.25 to verify whether the mCherry circular RNA was specifically bound and purified by the HRELP20-[HRELP4-P22]n (n=1, 2, 3) protein. The verification results are as follows: Figure 9 As shown, mCherry circular RNA has been specifically purified.

[0049] (5) Cell transduction experiments were performed. 100µg, 300µg, and 500µg of HRELP20-[HRELP4-P22]n (n=1, 2, 3) protein obtained in Example 1 were combined with 30µg of total RNA extracted by the Trizol method obtained in Example 2 to obtain ternary fusion protein-RNA complexes. The ternary fusion protein-RNA complexes were incubated with 293T cells, and the expression of mCherry red fluorescence was observed after 48 hours. The results for the HRELP20-[HRELP4-P22]1-circular RNA complex are shown below. Figure 5 As shown, the results for the HRELP20-[HRELP4-P22]2-circular RNA complex are as follows: Figure 6 As shown, the results for the HRELP20-[HRELP4-P22]3-circular RNA complex are as follows: Figure 7 As shown.

[0050] (6) 100µg, 300µg, and 500µg of the HRELP20-[HRELP4-P22]n (n=1, 2, 3) protein obtained in Example 1, and 500µg of the total RNA extracted from *E. coli* in Example 2 were respectively combined with the total RNA extracted by the alkaline lysis method obtained in Example 2 to obtain a ternary fusion protein-circular RNA complex. The ternary fusion protein-circular RNA complex was incubated with HEK 293T cells, and the expression of mCherry red fluorescence was observed after 48 hours. The results for the HRELP20-[HRELP4-P22]1-circular RNA complex are as follows: Figure 10 As shown, the results for the HRELP20-[HRELP4-P22]2-circular RNA complex are as follows: Figure 11 As shown, the results for the HRELP20-[HRELP4-P22]3-circular RNA complex are as follows: Figure 12 As shown.

[0051] A control group was set up, and HEK 293T cells were incubated with RNA and 300 µg of HRELP20-[HRELP4-P22]n (n=1, 2, 3) protein, respectively. After 48 hours, the expression of mCherry red fluorescence was observed, and the results were as follows: Figure 13 As shown.

[0052] like Figure 10 As shown in the cell transfection experiment, the results showed that 100 μg of HRELP20-[HRELP4-P22]1 protein in the HRELP20-[HRELP4-P22]1-circular RNA complex combined with cell lysates obtained by alkaline lysis resulted in high fluorescence expression levels after transfection, while 300 μg of HRELP20-[HRELP4-P22]1 in the Trizol group showed weak fluorescence expression levels.

[0053] like Figure 11 As shown, the fluorescence expression levels of the basic cleavage group in the HRELP20-[HRELP4-P22]2-circular RNA complex were also higher, with the highest fluorescence expression level of 100 μg HRELP20-[HRELP4-P22]2 protein.

[0054] like Figure 12 As shown, the HRELP20-[HRELP4-P22]3-circular RNA complex showed high fluorescence expression in 100 μg of HRELP20-[HRELP4-P22]3 protein in the alkaline cleavage group, while only 500 μg of HRELP20-[HRELP4-P22]3-circular RNA complex Trizol group showed a small amount of fluorescence expression.

[0055] like Figure 13 As shown, neither the pure RNA control group nor the pure HRELP20-[HRELP4-P22]n (n=1, 2, 3) protein control group expressed fluorescence. Incubation of HEK 293T cells with different doses of the protein-RNA complex resulted in mCherry red fluorescence, but the fluorescence intensity did not show a correlation with the number of P22 tandem repeats or the protein dose.

[0056] Through the specific implementation schemes described above, this invention successfully constructs a rapid purification and efficient cell transduction system for circular RNA expression. This system not only effectively and rapidly purifies recombinant proteins but also efficiently delivers circular RNA into cells and tissues, demonstrating broad application prospects.

[0057] Example 4: Male Kunming rats weighing approximately 25 g were used. The hair on the backs of the rats was removed, and they were randomly divided into 4 groups: 6 rats in each experimental group and 8 rats in each control group.

[0058] The first group of mice served as a blank control group: each mouse was injected intradermally with 10 μg of total RNA extracted by the TRIzol method as shown in Example 2, and 300 μg of HRELP20-[HRELP4-P22]1, 300 μg of HRELP20-[HRELP4-P22]2, and 300 μg of HRELP20-[HRELP4-P22]3 protein samples obtained by the method in Example 1. The second group of mice was the Trizol group: 300 μg of ternary fusion protein-circular RNA complex prepared from total RNA extracted by the Trizol method obtained in Example 2 was injected intradermally. The third group of mice was the alkaline lysis group: 300 μg of a ternary fusion protein-circular RNA complex prepared from total RNA extracted by alkaline lysis was injected intradermally.

[0059] Mice were subcutaneously injected with 150 μL of sample into each side of their back. After injection, they were returned to their cages and housed separately. The mice were euthanized by cervical dislocation 72 hours later, and the skin tissue from the injection sites was harvested, frozen sections were prepared, and the expression of red fluorescence was observed.

[0060] Among them, the results of injecting the HRELP20-[HRELP4-P22]1-circular RNA complex are as follows: Figure 14 As shown, the results of injecting the HRELP20-[HRELP4-P22]2-circular RNA complex are as follows: Figure 15 As shown, the results of injecting the HRELP20-[HRELP4-P22]3-circular RNA complex are as follows: Figure 16 As shown, the results of the first control group are as follows: Figure 17As shown. The results showed that the ternary fusion protein-circular RNA complexes prepared from total RNA extracted by the Trizol method and the alkaline lysis method could both be expressed in skin tissue, and the expression level of the complex prepared by the alkaline lysis method was higher than that of the Trizol method (e.g., ...). Figures 14-17 As shown), injection of simple RNA and simple protein did not produce red fluorescence (as shown). Figure 17 (As shown). In addition, the red fluorescence was mainly located in the hair follicle, which may be related to the use of the ribosome entry site of human rhinovirus A1.

[0061] The above embodiments are for illustrative purposes only and are not intended to limit the invention. Those skilled in the art can make various changes and modifications without departing from the scope of the invention. Therefore, all equivalent technical solutions should also fall within the scope of the invention.

Claims

1. A rapid delivery system for a target gene, characterized in that, include: A ternary fusion protein, wherein the ternary fusion protein comprises: Transmembrane peptides are peptides configured to mediate the entry of fused polypeptide or protein molecules across the cell membrane into the cell. Elastin-like polypeptides configured to respond to environmental factors; preferably, the environmental factors are selected from one or more of temperature, pH, and salt concentration, and Sequence-specific RNA-binding peptides configured to recognize and bind to sequence-specific RNA; and A sequence-specific RNA coupled to a target gene; preferably, the target gene and the sequence-specific RNA are loaded onto a circular RNA.

2. The A rapid delivery system according to claim 1, characterized in that, The membrane-penetrating peptide comprises 4-100 amino acid residues.

3. The rapid delivery system according to claim 2, characterized in that, The amino acid sequence of the transmembrane peptide is selected from any of the amino acid sequences shown in SEQ ID NO. 1-10, or mutants of any of the amino acid sequences shown in SEQ ID NO. 1-10, or tandem repeat sequences of one or more of SEQ ID NO. 1-10 or their mutants.

4. The rapid delivery system according to claim 1, characterized in that, The amino acid sequence of the elastin-like polypeptide includes a tandem repeat sequence of VPGXG and / or VAPGXG; preferably, X is any non-proline amino acid.

5. The rapid delivery system according to claim 4, characterized in that, The amino acid sequence of the elastin-like polypeptide is shown in SEQ ID NO.

13.

6. The rapid delivery system according to claim 1, characterized in that, Sequence-specific RNA-binding peptides consist of 10-100 amino acid residues.

7. The rapid delivery system according to claim 6, characterized in that, The amino acid sequence of the sequence-specific RNA-binding polypeptide is selected from any of the amino acid sequences shown in SEQ ID .14-16, or mutants of any of the amino acid sequences shown in SEQ ID .14-16, or tandem repeat sequences of one or more of SEQ ID .14-16 or mutants thereof.

8. The rapid delivery system according to claim 1, characterized in that, The sequence-specific RNA sequence comprises 10-200 ribonucleotides.

9. The rapid delivery system according to claim 8, characterized in that, The sequence-specific RNA is selected from any of the RNA sequences shown in SEQ ID.17-20, or mutants of any of the RNA sequences shown in SEQ ID.17-20, or tandem repeat sequences of one or more of SEQ ID.17-20 or their mutants.

10. Methods for rapid intracellular delivery of target genes, including: Loading the target gene into the rapid delivery system as described in any one of claims 1-9 specifically includes: The target gene is constructed into an expression vector capable of expressing circular RNA, wherein the circular RNA includes sequence-specific RNA; The ternary fusion protein is bound to the circular RNA to obtain a ternary fusion protein-circular RNA complex; wherein the ternary fusion protein includes a transmembrane peptide, an elastin-like polypeptide, and a sequence-specific RNA-binding polypeptide. The ternary fusion protein-circular RNA complex is mixed with target cells and incubated, or the ternary fusion protein-circular RNA complex is directly delivered to a designated tissue of the subject; preferably, the delivery method is selected from injection.

Images