Application of CaABR1 gene in regulating carotenoid synthesis and / or color of pepper fruit, recombinant vector and primer pair

Abstract

The application relates to the technical field of genetic engineering and plant molecular breeding, and provides a pepper fruit color regulation method CaABR1 application of a gene in regulating pepper fruit carotenoid synthesis or / and regulating pepper fruit color, a recombinant vector and a primer pair, the nucleotide sequence of the gene is shown as SEQ ID NO:1, the recombinant vector contains a pepper CaABR1 gene specific silencing fragment, the nucleotide sequence of the gene specific silencing fragment is shown as SEQ ID NO:2, and the primer pair is shown as SEQ ID NO:3 and SEQ ID NO:4. CaABR1 The application discloses a pepper fruit color regulation method CaABR1 The application discloses a pepper fruit color regulation method CaABR1 CaABR1 CaABR1 CaABR1 CaABR1 CaABR1 CaAB The application discloses a pepper fruit color regulation method The application discloses a pepper fruit color regulation method

Description

Technical Field

[0001] This application relates to the fields of genetic engineering and plant molecular breeding technology, specifically to a... CaABR1 Application of genes in regulating carotenoid synthesis and / or regulating color in chili pepper fruits, recombinant vectors and primer pairs. Background Technology

[0002] chili( Capsicum annuum L . Chili peppers are a globally important vegetable and condiment crop. Their fruit color is not only a key agronomical trait for variety identification but also a crucial indicator of commercial value and nutritional quality. Therefore, regulating carotenoid biosynthesis is an important breeding objective for improving the color of chili pepper fruits and enhancing their marketability. Mature chili pepper fruits exhibit vibrant colors such as red, orange, and yellow. These colors primarily originate from the accumulation of carotenoids, including capsanthin, capsanthin, β-carotene, and lutein. Among these, capsanthin and capsanthin are unique carotenoid components of red chili peppers, accounting for 40% to 60% of the total carotenoids in mature fruits. Carotenoids in chili peppers are mainly synthesized via the methyl erythritol 4-phosphate (MEP) pathway. Enzymes encoding key structural genes in this pathway include phytoene synthase (PSY1), phytoene dehydrogenase (PDS), zeta-carotene dehydrogenase (ZDS), lycopene β-cyclase (LCYB), lycopene ε-cyclase (LCYE), and capsanthin / capsaicin synthase (CCS). CCS is a rate-limiting enzyme specific to chili peppers, catalyzing the conversion of lycopene to capsanthin and capsaicin. Although the functions of these structural genes are relatively well understood, how upstream transcription factors synergistically regulate this metabolic pathway remains a hot topic and a challenge in current research.

[0003] Currently known transcription factors regulating carotenoid synthesis in fruits mainly include the MYB, MADS-box, NAC, and ERF families. Among them, ERF transcription factors, as the largest subfamily within the AP2 / ERF superfamily, have been widely confirmed to participate in the regulation of carotenoid metabolism during fruit ripening in fruits and vegetables other than peppers. For example, overexpression of ERF in citrus fruits... CitERF061 It can significantly increase carotenoid content, and this factor directly binds to... PSY1 , PDS , CRTISO , LCYB , CCD4 The expression of key structural genes such as ERF23 is highly correlated with the expression of carotenoid synthesis genes (LYCE, LYCB2, CCD1, NCED2) in grapefruit; and in tomatoes... SlPti4Downregulation of ERF expression led to increased lycopene and decreased β-carotene content, indicating that ERFs have a fine-tuning effect on carotenoid clades. These studies suggest that ERF transcription factors have a universal and important function in regulating fruit carotenoid synthesis. In peppers, 175 ERF family members have been identified at the genomic level, divided into subfamilies such as AP2, RAV, DREB, and ERF. However, current research on the function of pepper ERF genes mainly focuses on stress responses (such as drought, salinity, and low temperature) and leaf development; research on the function of CaERF genes in regulating fruit carotenoid synthesis and influencing fruit color remains lacking. In particular, during the color change of ripe pepper fruit, it is crucial to understand which CaERF members are activated by ethylene signaling and how they regulate key genes in carotenoid synthesis (especially...). CaCCS The exact mechanism remains unclear. In conclusion, identifying and regulating CaERF transcription factors that control carotenoid synthesis in pepper fruits, clarifying their regulatory mechanisms, and developing corresponding molecular breeding techniques have significant theoretical value and application prospects. Summary of the Invention

[0004] The present invention aims to solve the above-mentioned problems in the prior art and provide a solution. CaABR1 Application of genes in regulating carotenoid synthesis and / or color regulation in chili pepper fruits, recombinant vectors and primer pairs.

[0005] To achieve the above objectives, the first aspect of this application provides a CaABR1 The application of the gene in regulating carotenoid synthesis and / or regulating pepper fruit color, the CaABR1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0006] In the above application, preferably, the regulation is positive regulation. CaABR1 Genes promote the synthesis of carotenoids in chili pepper fruits, giving the fruits their red color.

[0007] The above-mentioned application, preferably, includes: suppressing CaABR1 Gene expression results in low carotenoid content and / or orange pepper fruit.

[0008] Of the above applications, the preferred method is to use virus-induced gene silencing technology to inhibit the growth of chili peppers. CaABR1 Gene expression.

[0009] Of the above applications, the preferred method is to use virus-induced gene silencing technology to inhibit the growth of chili peppers. CaABR1 Gene expression includes the following steps:

[0010] (1) Constructing a vehicle carrying chili peppers CaABR1VIGS recombinant vector for gene-specific silencing fragments; CaABR1 The nucleotide sequence of the gene-specific silencing fragment is shown in SEQ ID NO: 2; (2) The VIGS recombinant vector was introduced into Agrobacterium to obtain an infected bacterial solution; (3) Infect pepper seedlings with the aforementioned infecting bacterial solution; (4) Cultivate infected chili plants to obtain orange-colored chili fruits and / or chili fruits with low carotenoid content.

[0011] In the above application, preferably, the VIGS recombinant vector is used to transport the VIGS... CaABR1 The recombinant plasmid pTRV2 was obtained by ligating the gene-specific silencing fragment into the pTRV2 vector. CaABR1 .

[0012] The second aspect of this application provides a method for silencing chili peppers. CaABR1 A VIGS recombinant vector containing the gene of pepper. CaABR1 Gene-specific silencing fragments, the CaABR1 The nucleotide sequence of the gene-specific silencing fragment is shown in SEQ ID NO: 2.

[0013] Preferably, the recombinant vector described above is a vector for transporting the aforementioned recombinant material. CaABR1 The recombinant plasmid pTRV2 was obtained by ligating the gene-specific silencing fragment into the pTRV2 vector. CaABR1 .

[0014] Preferably, the primer pair used to amplify the specific silenced fragment in the above-mentioned recombinant vector is: Forward primer F1: 5'-GTGAGTAAGGTTACCGAATTCCAGTCCACAACAAGATTAGCCAT-3'; Reverse primer R1: 5'-CGTGAGCTCGGTACCGGATCCAGGAAATGTATGTGAATGCAAGAC-3'.

[0015] Preferably, the recombinant vector described above is constructed using the following method: (1) Amplification to obtain the nucleotide sequence of chili pepper as shown in SEQ ID NO:2 CaABR1 Gene-specific silencing fragments; (2) The pTRV2 vector was digested with EcoRI and BamHI. (3) The specific silencing fragment described in step (1) is ligated into the pTRV2 vector digested in step (2) to obtain the recombinant plasmid pTRV2: CaABR1 .

[0016] A third aspect of this application provides a method for amplifying chili peppers. CaABR1 Primer pairs for gene-specific silencing fragments, said primer pairs comprising: Forward primer F1: 5'-GTGAGTAAGGTTACCGAATTCCAGTCCACAACAAGATTAGCCAT-3'; Reverse primer R1: 5'-CGTGAGCTCGGTACCGGATCCAGGAAATGTATGTGAATGCAAGAC-3'.

[0017] Compared with the prior art, this application has the following beneficial effects: (1) This invention discloses for the first time the chili pepper CaABR1 A novel function of gene regulation in fruit carotenoid synthesis: First-ever validation of this function in chili peppers using transcriptome sequencing combined with VIGS technology. CaABR1 Genes positively regulate carotenoid synthesis in fruits, determining the biological function of the red fruit trait. Using the high-generation inbred line 6421 of red-fruited peppers as a background, silencing genes... CaABR1 Following gene modification, the pepper fruit changed from its normal red color to orange, and the carotenoid content decreased significantly. This discovery fills a gap in the functional research on the pepper ERF transcription factor family in regulating fruit carotenoid synthesis and provides a new gene target for improving pepper fruit color.

[0018] (2) This invention provides a rapid and accurate method for identifying the function of color-related genes in chili pepper fruits. Addressing the current situation of long genetic transformation cycles and complex operations in chili peppers, this invention establishes a method based on VIGS technology. CaABR1 Gene silencing system. This system uses pepper cotyledons as the injection target, and can observe intuitive phenotypic changes in the color of mature fruits as early as 120 days after injection. It does not require stable genetic transformation, has a short cycle, high throughput, and low cost, and provides an efficient technical tool for studying the mechanism of pepper fruit color formation and for the rapid functional identification of genes related to carotenoid metabolism.

[0019] (3) This invention constructs pTRV2: CaABR1 Recombinant vectors can be used not only for chili peppers CaABR1 Gene function research can also be conducted through silencing. CaABR1 Genetic creation of chili germplasm materials with different carotenoid contents provides a new technical approach for breeding chili varieties with different fruit colors, and has good scientific research application value and industrialization prospects. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The empty control plants and silent plants of pepper 6421 (TRV: CaABR1 Fruit phenotype and VIGS infection verification photos: Figure 1 A represents the fruit of a dormant plant. Figure 1 B represents the fruit of the control plant (without a growth vector). Figure 1 C is a gel image used to verify VIGS infection.

[0022] Figure 2 The empty control plants and silent plants of pepper 6421 (TRV: CaABR1 In the fruit CaABR1 The results of qRT-PCR detection of gene expression levels are shown in the figure. This indicates that the expression levels between the two are extremely significant. Detailed Implementation

[0023] To facilitate understanding of this application, the following description will be more comprehensive and detailed in conjunction with the accompanying drawings and preferred embodiments, but the scope of protection of this application is not limited to the following specific embodiments.

[0024] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of this application.

[0025] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0026] Example 1: 1. Chili peppers CaABR1 Gene screening and acquisition Using the high-generation inbred line 6421 (wild type, red fruit) of pepper and its EMS-induced orange-fruit mutant E55 as materials (6421 and E55 have been published in "Li Liyuan, Wu Lili, Huang Hurong, et al. Comparison and quality analysis of color of wild-type pepper and fruit color mutant at different developmental stages [J]. Food Science, 2024, 45(9):16-21."), fruit tissues at three developmental stages—green fruit, color-changing fruit, and mature fruit—were collected. Total RNA was extracted using a plant total RNA extraction kit, and first-strand cDNA was synthesized using a reverse transcription kit. The operation steps were performed according to the kit instructions.

[0027] Transcriptome sequencing was performed on the above samples, and a member of the ERF transcription factor family that was significantly downregulated in E55 fruit was identified and named [name missing]. CaABR1 Download from NCBI (https: / / www.ncbi.nlm.nih.gov). CaABR1 The CDS sequence, and its nucleotide sequence is shown in SEQ ID NO:1. Using cDNA from young leaves of 6421 as a template, high-fidelity enzyme amplification was performed. CaABR1 The full-length CDS of the gene was obtained, and sequencing confirmed that the sequence was correct.

[0028] SEQ ID NO: 1: 2. Chili peppers CaABR1 Cloning of the VIGS gene silencing fragment Young leaves of plant variety 6421 were collected, and total RNA was extracted using a plant total RNA extraction kit. First-strand cDNA was synthesized using a reverse transcription kit. Using pepper cDNA as a template, according to... CaABR1 VIGS-specific primers were designed based on the gene CDS sequence: forward primer F1: 5'-GTGAGTAAGGTTACCGAATTCCAGTCCACAACAAGATTAGCCAT-3' (SEQ ID NO:3) and reverse primer R1: 5'-CGTGAGCTCGGTACCGGATCCAGGAAATGTATGTGAATGCAAGAC-3' (SEQ ID NO:4) to amplify the target fragment. The PCR amplification system is shown in Table 1, and the amplification program is shown in Table 2.

[0029] Table 1: Amplification System

[0030] Table 2: Amplification Procedure

[0031] The amplified product was detected by 1% agarose gel electrophoresis, and the target fragment was recovered and purified. Sequencing results showed that the nucleotide sequence of this specific fragment is shown in SEQ ID NO:2.

[0032] SEQ ID NO:2 CAGTCCACAACAAGATTAGCCATTTCATCAGCACTACCAGCTTCACAATTCCCATTAATGTCTGCAACGGTACCGACAACGCCACCATCATTTTTTCCAATCATATAATCTACCTCAGCATCAAAATCAACCTCCGCTGCAGCAACAACAG CTTTTTCCGAGCTCAGAAGTAGCTAGAGATTATTGGGAATACTCGCAATTACTTCAAAATCCAATAGATTTCCATGGACAACAATCTTCATTATTAGAGCAAATGCTATTAGCTTCATCAATGGGAGTCTTGCATTCACATACATTTCCT 3. Construction of recombinant vector pTRV2:CaABR1 and empty vector TRV The pTRV1 and pTRV2 vectors used in this embodiment were constructed and stored according to the method reported by Liu et al. (Plant Journal, 2002, 31(6):777-786). The pTRV1 vector (GenBank accession number AF406990) provides viral replication and systemic propagation functions, and the pTRV2 vector (GenBank accession number AF406991) is used for inserting the target gene fragment. Both vectors can be obtained from ABRC (… Arabidopsi Obtain from the Biological Resource Center (Stock No. CD3-1040).

[0033] (1) The pTRV1 and pTRV2 vectors were double-digested using EcoRI and BamHI. The double digestion system is shown in Table 3. Digestion conditions: 37℃ water bath for 30 min. The digestion products were recovered after digestion.

[0034] Table 3: Double enzyme digestion system

[0035] (2) After enzyme digestion CaABR1 The specific fragment was ligated into the linearized pTRV2 vector, and the ligation system is shown in Table 4. The centrifuge tubes were gently tapped to mix, and then placed in a PCR instrument at 50°C for 15 min for ligation.

[0036] Table 4: Connection System

[0037] (3) The ligation product was transformed into *E. coli* DH5α competent cells, plated on LB agar plates containing 50 mg / L kanamycin, and incubated overnight at 37°C. Single clones were selected for colony PCR verification of positive clones. After sequencing confirmation, plasmids were extracted to obtain the recombinant vector, named pTRV2. CaABR1 .

[0038] (4) Take 3 μL of pTRV2 that meets the requirements for sequencing: CaABR1 The recombinant plasmid and the pTRV2 empty vector plasmid were added to 100 μL of GV3101 competent cells. After gentle mixing, the cells were incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, at 37°C for 5 min, and on ice for 5 min. Then, 700 μL of antibiotic-free liquid LB medium was added, and the cells were cultured at 28°C with shaking at 200 rpm for 3 h. After centrifugation at 6000 rpm for 1 min at room temperature, most of the supernatant was removed, and the cells were plated on LB agar plates containing 50 μg / mL Rif and 50 μg / mL Kan, and incubated upside down at 28°C for 48–72 h. Single clones with normal growth were selected for colony PCR identification, and positive single clones were used for subsequent experiments.

[0039] 4. Agrobacterium-mediated VIGS infection (1) The contents of pTRV1, pTRV2 and pTRV2: CaABR1 Agrobacterium strains were divided into LB liquid medium (containing 50 mg / L kanamycin and 50 mg / L rifampin) and cultured in the dark at 28°C with shaking until the bacterial culture reached OD. 600 The value is 0.8-1.0. Take the bacterial suspension, centrifuge at 5000 rpm for 10 min at room temperature, and collect the bacterial cells. Resuspend the bacterial cells in an equal volume of infection buffer (10 mM MES, 10 mM MgCl2, 200 μM acetylsalicylic acid, pH 5.6) and adjust the OD value. 600 Up to 1.0. pTRV1 was then mixed with empty pTRV2 vector and pTRV2: CaABR1 Mix in equal proportions to form complete empty TRV control and TRV: CaABR1 Silent carrier. The mixed bacterial culture was incubated in the dark at 28°C for 4 hours.

[0040] (2) Prepare 6421 seedlings at the cotyledon stage (approximately 15 days old, with cotyledons fully expanded and true leaves not yet exposed) before inoculation. Take a 1 mL disposable syringe (without the needle), draw up the infection solution, and slowly inject it into the back of the cotyledons. Stop the injection when the entire cotyledon appears water-soaked. Inject at least 30 seedlings for each treatment. Infected seedlings are cultured in the dark at 22°C for 2 days, and then transferred to a growth chamber (22°C, 16 h light / 8 h dark, 60% humidity) for further culture. Control plants (TRV-infected plants) are inoculated with infection solution containing empty vector.

[0041] 5. Analysis of gene silencing effects (1) Phenotypic survey After 120 days of infection, the color characteristics of the pepper fruits were investigated, and the carotenoid content in the mature fruits was determined.

[0042] The ripe fruit of the empty vector control group (TRV) turned red, while the fruit of the silent treatment group (TRV: CaABR1 The ripe fruit is orange. Figure 1 A, Figure 1 B) indicates silence CaABR1 Genes can change the color of chili peppers from red to orange.

[0043] Take 0.1 g of mature fruit from both the empty vector control group and the silenced treatment group, grind them into a homogenate, add 5 mL of 95% ethanol, and continue grinding until the tissue turns white. Let it stand for 3 min. Filter into a volumetric flask and make up to 25 mL with 95% ethanol. Measure the absorbance of the extract at 665, 649, and 470 nm.

[0044] The formula for calculating carotenoid content is as follows: Chla (chlorophyll a content) = (13.95A) 665 - 6.88A 649 ) × 25 / 0.2; Chlb (chlorophyll b content) = (24.96A) 649 - 7.32A 665 ) × 25 / 0.2; Carotenoid content = (1000A) 470 - 2.05Chla - 114.8Chlb) × 25 / (245 × 0.2).

[0045] Table 5: Carotenoid content in the empty vector control group and the silenced treatment group

[0046] As shown in Table 5, the carotenoid content in the mature fruit of the control group was significantly higher than that in the silent treatment group.

[0047] (2) VIGS infection verification RNA was extracted from fruits in both the control and silenced groups, and then reverse transcribed into first-strand cDNA using the RevertAid™ FirstStrand cDNA Synthesis kit. PCR was used to amplify whether the PTRV1 and PTRV2 vectors had invaded the pepper. The primers for PTRV1 identification were (Primer F: TTACAGGTTATTTGGGCTAG (SEQ ID NO:9); Primer R: CCGGGTTCAATTCCTTATC (SEQ ID NO:10)), and the primers for PTRV2 identification were (Primer F: TGTTTGAGGGAAAAGTAGAGAACGT (SEQ ID NO:11); Primer R: TTACCGATCAATCAAGATCAGTCGA (SEQ ID NO:12)). The PCR amplification system is shown in Table 1, and the amplification program is shown in Table 2. The results showed that specific bands of TRV1 and TRV2 could be detected in both groups of samples. Figure 1 C) proves that the virus infection was successful and can be used for subsequent phenotypic analysis.

[0048] (2) Determination of relative expression level of target gene The empty vector control group (TRV) and the silencing group (TRV:) were extracted using a plant total RNA extraction kit. CaABR1RNA from mature fruits was reverse transcribed into first-strand cDNA using the RevertAid™ First Strand cDNA Synthesis kit. Primers were designed based on the silenced sequence (Primer F: 5'-CAGGGAGGAGAGTGGGGTTA-3' (SEQ ID NO:5), Primer R: 5'-GTCCAGCCCATGATCCTGAG-3' (SEQ ID NO:6)). The housekeeping gene β-actin7 was used as an internal control gene (Primer F: 5'-ATTGGGATGGAAGCTGCGGG-3' (SEQ ID NO:7), Primer R: 5'-CCAGGGAACATGGTGGAGCC-3' (SEQ ID NO:8)) to correct for cDNA template cell copy number. The expression level of the target gene at the transcriptional level was detected using Roche quantitative PCR. To eliminate errors caused by differences in plant growth, each sample was tested in triplicate, and the results were averaged. The qRT-PCR reaction system is shown in Table 6, and the reaction procedure is shown in Table 7.

[0049] Table 6: qRT-PCR reaction system

[0050] Table 7: qRT-PCR reaction procedure

[0051] The results are as follows Figure 2 As shown, compared with the empty vector control group (TRV), the silent treatment group (TRV: CaABR1 ) in the plant CaABR1 The relative expression level of the gene's mRNA decreased significantly by about 80%, indicating a good silencing effect and suggesting that the gene has been effectively silenced.

[0052] The above are merely preferred embodiments of this application. It should be noted that this application is not limited to the above embodiments. For those skilled in the art, several improvements and modifications can be made without departing from the principles of this application. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should also be considered within the scope of protection of this application.

Claims

1. CaABR1 The application of genes in regulating carotenoid synthesis and / or regulating pepper fruit color is characterized by, The CaABR1 The nucleotide sequence of the gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The regulation mentioned is a positive regulation.

3. The application according to claim 2, characterized in that, The application includes: by inhibiting CaABR1 Gene expression was used to obtain pepper plants with low carotenoid content and / or orange fruit.

4. The application according to claim 3, characterized in that, Using virus-induced gene silencing technology to inhibit chili peppers CaABR1 Gene expression.

5. The application according to claim 4, characterized in that, Using virus-induced gene silencing technology to inhibit chili peppers CaABR1 Gene expression includes the following steps: (1) Constructing a vehicle carrying chili peppers CaABR1 VIGS recombinant vector for gene-specific silencing fragments; CaABR1 The nucleotide sequence of the gene-specific silencing fragment is shown in SEQ ID NO: 2; (2) The VIGS recombinant vector was introduced into Agrobacterium to obtain an infected bacterial solution; (3) Use the aforementioned infecting bacterial solution to infect pepper cotyledons; (4) Cultivate infected pepper plants to obtain pepper fruits with orange color and / or low carotenoid content.

6. The application according to claim 5, characterized in that, The VIGS recombinant vector is used to deliver the... CaABR1 The recombinant plasmid pTRV2 was obtained by ligating the gene-specific silencing fragment into the pTRV2 vector. CaABR1 .

7. A type of chili pepper for use in silencing chili peppers CaABR1 A gene recombination vector, characterized in that, The recombinant vector contains chili peppers. CaABR1 Gene-specific silencing fragments, the CaABR1 The nucleotide sequence of the gene-specific silencing fragment is shown in SEQ ID NO:

2.

8. The recombinant vector as described in claim 7, characterized in that, The recombinant vector is used to deliver the... CaABR1 The recombinant plasmid pTRV2 was obtained by ligating the gene-specific silencing fragment into the pTRV2 vector. CaABR1 .

9. The recombinant vector as described in claim 7, characterized in that, The primer pair used to amplify the specific silenced fragment is: Forward primer F1: 5'-GTGAGTAAGGTTACCGAATTCCAGTCCACAACAAGATTAGCCAT-3'; Reverse primer R1: 5'-CGTGAGCTCGGTACCGGATCCAGGAAATGTATGTGAATGCAAGAC-3'.

10. A method for amplifying chili peppers CaABR1 Primer pairs for gene-specific silencing fragments, characterized in that, The primer pair is: Forward primer F1: 5'-GTGAGTAAGGTTACCGAATTCCAGTCCACAACAAGATTAGCCAT-3'; Reverse primer R1: 5'-CGTGAGCTCGGTACCGGATCCAGGAAATGTATGTGAATGCAAGAC-3'.

Images