A primer, a probe and a kit for detecting a BRAF gene V600E mutation based on an epitope probe qPCR technology

Abstract

The application relates to primers, probes and kits for detecting a BRAF gene V600E mutation based on an extension probe qPCR technology, the primers comprising: an outer side forward primer, an outer side reverse primer, an inner side mutation-specific primer and a universal forward primer; and the probes comprising a universal mutation reporter probe and an internal reference probe. The inner side mutation-specific primer is connected with a target-independent extension sequence at a 5' end, and only when the primer specifically recognizes a mutant template and is extended, can the universal forward primer and the universal mutation reporter probe be activated to output a fluorescence signal, and the internal reference probe monitors total DNA amplification efficiency. The application has high sensitivity and high specificity, can stably detect a mutation frequency as low as 0.2% (in a genomic DNA standard sample), and is suitable for tumor precise medication guidance and the like.

Description

Technical Field

[0001] This invention belongs to the field of nucleic acid detection technology, and specifically relates to primers, probes and kits for detecting BRAF gene V600E mutation based on epitaxial probe qPCR technology. Background Technology

[0002] BRAF V600E mutation is one of the most important tumor driver gene variants in clinical practice, widely found in melanoma, colorectal cancer, thyroid cancer, and various other solid tumors. This mutation leads to constitutive activation of BRAF protein kinase activity, continuously activating the MAPK signaling pathway and driving tumor development and progression. More importantly, several targeted therapies against BRAF V600E mutations have been approved for marketing, making accurate detection of this mutation a key molecular pathological basis for guiding precision treatment, predicting efficacy, and monitoring drug resistance.

[0003] Researchers have developed several commercially viable methods for detecting the BRAF V600E mutation based on allele-specific PCR (AS-PCR). Classic AS-PCR employs a four-primer system (e.g., Huo, Naxin, et al. BatchPrimer3: A High Throughput Web Application for PCR and Sequencing Primer Design. BMC Bioinformatics, 2008.): two outer primers amplify the common region containing the mutation site, while the 3' ends of the other two inner primers are precisely anchored to specific bases in the wild-type and mutant alleles, respectively. Genotype is determined by analyzing the band distribution of amplified products of different lengths using gel electrophoresis after PCR. However, electrophoresis is cumbersome, prone to aerosol contamination, and difficult to achieve precise quantification.

[0004] To meet the clinical demand for rapid, closed, and quantitative detection, combining the AS-PCR principle with the real-time quantitative PCR (qPCR) platform is essential. This transition has encountered a design bottleneck: in the classic AS-PCR system, attempting to use fluorescent probes to specifically indicate the amplification of the inner primer associated with the mutation site reveals that probe placement is impossible. The product amplified by an inner primer and its corresponding outer primer is entirely contained within the longer fragment amplified by the two outer primers. Therefore, any probe designed onto the sequence of the inner primer amplification product will also bind to the amplification products of the two outer primers, resulting in a complete loss of allele specificity in the fluorescent signal.

[0005] To address this challenge, Amplification Refractory Mutation System PCR (ARMS-PCR) was developed and has become the technology used in mainstream commercial kits (such as those from Xiamen AmoyDx Biotechnology). ARMS-PCR simplifies the system, typically using one outer primer and one allele-specific inner primer for amplification, with an additional deliberate mismatch introduced at the penultimate or third-to-last position of the inner primer's 3' end to enhance specificity. Its fluorescent probe is designed within the amplification region. While this design successfully enables detection via Ct values ​​within a closed system, it comes at a significant cost: firstly, the system forgoes another outer primer, preventing the provision of abundant template for the inner primer through pre-amplification, thus reducing detection sensitivity; secondly, the highly stringent mismatch design, while inhibiting wild-type extension, may also hinder the effective extension of mutant templates to some extent, increasing the risk of non-specific amplification. Therefore, compared with the classic four-primer AS-PCR architecture, the simple fluorescent ARMS-PCR method suffers a theoretical loss in detection sensitivity and specificity, which in particular limits its performance in detecting low-abundance mutations (such as <1% mutation allele frequency).

[0006] To overcome the limitations of ARMS-PCR in terms of ultrasensitivity and precise quantification, researchers have explored various technical approaches. One approach focuses on enhancing the specificity of the PCR reaction itself, such as introducing peptide nucleic acids (PNAs) or locked nucleic acids (LNAs) as high-affinity blocking agents or modifying primers; developing high-resolution detection chemistry based on probe competitive binding or enzyme digestion kinetic optimization; and introducing chemically modified base analogs into primers to enhance mismatch discrimination. These methods have all improved performance to some extent, but none have solved the problem of achieving quantitative PCR while maintaining the two outer primers of AS-PCR. Summary of the Invention

[0007] The technical problem to be solved by this invention is to provide primers, probes and kits for detecting BRAF gene V600E mutation based on epitaxial probe qPCR technology. Based on the classic four-primer AS-PCR architecture, the invention achieves a seamless transition from gel electrophoresis to real-time fluorescence quantitative detection through "epitaxy probe" design, fundamentally improving the specificity and sensitivity of the detection system.

[0008] This invention provides primers for detecting the V600E mutation of the BRAF gene based on epitaxial probe-based qPCR technology, wherein the primers comprise:

[0009] Outer positive primer: TCTCTTACCTAAACTCTTCATAATGCTTG;

[0010] Outer reverse primer: AACTCAGCAGCATCTCAGGGCCAAAAA;

[0011] Inner mutation-specific primers:

[0012] ATCTCCGTTCCTAAGGTTGGACAAAGCTTCCGATTAGGGATTCTCCATGTAAATAGGTGATTTTGGTCTAGCTACATA;

[0013] Universal forward primer: ATCTCCGTTCCTAAGGTTGGA.

[0014] This invention also provides a probe for detecting BRAF gene V600E mutations based on epitaxial probe-based qPCR technology, the probe comprising:

[0015] Universal mutation reporter probe: FAM-AGCTTCCGATTAGGGATTCTCCATG-BHQ1;

[0016] Internal reference probe: VIC-TCCTTTACTTACTACACCTCAGATATA-BHQ1.

[0017] The present invention also provides a kit for detecting BRAF gene V600E mutation based on epitaxial probe qPCR technology, comprising the primers and the probes described above.

[0018] Furthermore, it also contains hot-start Taq DNA polymerase.

[0019] Furthermore, in the 25 μL qPCR reaction system of the kit, the final concentrations of each primer are as follows: the final concentrations of the outer forward primer, the outer reverse primer, and the universal forward primer are all 0.4 μmol / L, and the final concentration of the inner mutation-specific primer is 0.24 μmol / L; the final concentration of each probe is 0.24 μmol / L.

[0020] The present invention also provides the application of the primers, probes, or kits described herein in the preparation of detection reagents for precision oncology drug guidance, oncology efficacy monitoring, or oncology drug resistance detection.

[0021] Preferably, the tumor includes one of melanoma, colorectal cancer, and thyroid cancer.

[0022] The EPAS-PCR of this invention is a novel architecture that achieves specific signal conversion and amplification based on the classic allele-specific PCR principle through the design of "extended probes". The system includes a pair of outer primers (F1 / R1) for amplifying the common region of the target, and an allele-specific inner primer (F2) with its 3' end anchored to the mutation site. The 5' end of primer F2 is connected to a manually designed "extended sequence" independent of the target template. A universal primer (F3) and a universal TaqMan probe (P2), aligned with this extended sequence, are introduced into the reaction system.

[0023] Its core working principle is as follows ( Figure 1First, the outer primers F1 / R1 pre-amplify the template, accumulating exponential amplification products containing both wild-type and mutant templates. The 3' end of the inner mutation-specific primer F2 has a complementary sequence of more than 20 bases to both the wild-type and mutant templates, differing by only two bases from the wild-type template and only one base from the mutant template. This makes its binding ability with both templates similar but its extension ability drastically different—it can extend efficiently with the mutant template but can hardly extend with the wild-type template. When the mutant template is present, the inner primer F2 (whose 3' end matches the mutation site) can extend efficiently. This extension product serves as a template, which is then bound and extended downstream by the outer reverse primer R1. The sequence of this newly formed strand generated by R1 extension is inversely complementary to the extended sequence at the 5' end of primer F2 and subsequent universal elements (F3 / P2). Therefore, this strand can serve as a template, binding with the universal primer F3 and initiating extension. Once this step occurs, a classic TaqMan qPCR amplicon is formed, using F3 and R1 as primer pairs and P2 as the detection probe. The accumulated fluorescence signal (FAM channel) is generated by the P2 probe. The original sequence design of probe P2 and primer F3 is aligned with the extended sequence of F2. They cannot directly bind or initiate amplification on their own. Only when F2 successfully recognizes the mutation and triggers the above-mentioned cascade extension will its reverse complementary strand be generated, thereby "activating" this universal F3 / R1 / P2 amplification and reporter system. The exponential amplification product of the wild-type template competes with the mutant template for binding to the inner primer F2, effectively inhibiting the non-specific amplification product generated after F2 binds to the wild-type template and thus preventing the generation of non-specific fluorescence signal from the source. If the outer forward primer F1 is missing, this system is equivalent to the conventional ARMS-PCR architecture. Without the exponential amplification product of the wild / mutant template as a competing substrate, the trace amount of non-specific amplification product generated by F2 binding to the wild-type template will quickly initiate exponential amplification, exceeding the fluorescence threshold and forming a false positive signal. This design ensures strict targeting of the fluorescent signal to the specific recognition event of the mutant allele, while utilizing a universal primer-probe system to amplify the signal and fundamentally avoid background interference. Another probe located in the outer primer product region (P1, such as the VIC channel) serves as an internal control to monitor total DNA amplification efficiency.

[0024] If conventional ARMS-PCR technology is used for this detection, i.e., the system lacks the outer forward primer F1, the wild / mutant template exponential amplification system mediated by F1 / R1 cannot compete with the mutant template for binding to the inner specific primer F2. The trace amount of non-specific amplification product generated by the binding of the inner primer to the wild-type template will quickly enter the exponential amplification stage, resulting in false positives. At the same time, this architecture abandons the pre-amplification basis of the two outer primers, and there is no sufficient target template to provide amplification support for the inner primers. In addition, the artificial mismatch introduced by conventional ARMS-PCR to improve specificity will further hinder the extension of the mutant template. Even if the inner primer and the mutant template have similar binding ability, efficient extension amplification cannot be achieved. Ultimately, low-abundance mutant templates are difficult to detect, and the specificity and sensitivity of the detection are greatly impaired, making it impossible to achieve the accurate identification of low-frequency mutations as described in this invention.

[0025] To enhance the sensitivity and specificity of detection, conventional ARMS-PCR methods typically introduce an additional blocking probe. This probe, based on LNA base modification, exhibits high binding specificity and a higher Tm value with wild-type templates, while showing weaker binding affinity and a lower Tm value with mutant templates. It specifically binds to the mutation site region of the wild-type template, blocking the binding of the specific primer to the wild-type template and subsequent amplification, without affecting the binding and amplification of the specific primer to the mutant template, thus improving detection performance. From a theoretical design perspective, the system of this invention is fully compatible with the application of this blocking probe, requiring no adjustments to existing primer-probe combinations. That is, based on the inherently high sensitivity and specificity of this system, the inhibition effect on wild-type template can be further enhanced by stacking this blocking probe, theoretically achieving further improvements in detection performance.

[0026] Beneficial effects

[0027] The inner mutation-specific primer of this invention has an extensional sequence unrelated to the target attached to its 5' end. Only when this primer specifically recognizes the mutation template and extends can the fluorescence signal output of the universal forward primer and the universal mutation reporter probe be activated. The internal control probe monitors the total DNA amplification efficiency. This invention combines high sensitivity and high specificity, and can stably detect mutation frequencies as low as 0.2% (in genomic DNA standards), making it suitable for scenarios such as precision oncology drug guidance. Attached Figure Description

[0028] Figure 1 This is a schematic diagram illustrating the principle of EPAS-PCR in this invention.

[0029] Figure 2 This is an amplification curve of the DNA polymerase selection experiment of the present invention; wherein:

[0030] A shows that when using the Taq enzyme (Takara) with 3'→5' exonuclease activity, both wild-type and mutant templates generated amplification signals in the FAM channel;

[0031] B shows that when using the Taq enzyme (Vazyme) which lacks 3'→5' exonuclease activity, only the mutant template generates an amplification signal in the FAM channel, while the wild-type template does not.

[0032] Figure 3 This is the amplification curve of the outer forward primer F1 of this invention for necessity verification experiment; wherein:

[0033] A shows the inhibitory effect of different F1 concentrations on non-specific amplification of FAM channels under wild-type plasmid background;

[0034] B shows the promoting effect of different F1 concentrations on FAM channel-specific amplification under the background of mutant plasmids.

[0035] Figure 4 The amplification curves of the conventional ARMS-PCR system under wild-type and mutant templates are shown.

[0036] Figure 5 This is a graph showing the results of establishing the standard curve for the EPAS system of this invention; wherein:

[0037] A shows the amplification curves of wild-type plasmid gradient dilutions (VIC channel).

[0038] B shows the amplification curves (FAM channel) of the mutant plasmid gradient dilution.

[0039] Figure 6 This is a graph showing the sensitivity test results of plasmid mixture samples in this invention; wherein:

[0040] A displays a high background group (total template 1×10) 6 Amplification curves with different mutation ratios (copy / reaction);

[0041] B displays the low background group (total template 1×10) 4 Amplification curves with different mutation ratios (copy / reaction).

[0042] Figure 7 This is a graph showing the sensitivity test results of the genomic DNA standard of this invention. Detailed Implementation

[0043] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Furthermore, it should be understood that after reading the teachings of this invention, those skilled in the art can make various alterations or modifications to the invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0044] Example 1

[0045] 1. Preparation of Samples and Standards

[0046] The templates used in this study include two main categories: synthetic plasmids and commercially available genomic DNA standards.

[0047] The plasmid containing the wild-type [V600E mutant] sequence near the V600E region of the BRAF gene is: ATTATGAAATTAGATCTCTTACCTAAACTCTTCATAATGCTTGCTCTGATAGGAAAATGAGATCTACTGTTTTCCTTTACTTACTACACCTCAGATATATTTCTTCATGAAGACCTCACAGTAAAAATAGGTGATTTTGGTCTAGCTACAGT[A]GAAATCTCGATGGAGTGGGTCCCATCAGTTTGAACAGTTGTCTGGATCCATTTTGTGGATGGTAAGAATTGAGGCTATTTTTCCACTGATTAAATTTTTGGCCCTGAGATGCTGCTGAGTTACTAGAAAGTCATTGAAG. This sequence was synthesized and inserted into the pUC57 plasmid, and the pUC57 empty vector was purchased as a control (both were purchased from Shanghai Sangon Biotech Co., Ltd.). All plasmids were extracted, purified, and the correctness of the target region sequence was verified by Sanger sequencing. The plasmid was precisely quantified using a Qubit™ 4.0 fluorometer and a dsDNA HS Assay Kit, followed by the preparation of 10-fold serial dilutions with sterile double-distilled water, with concentrations ranging from 1×10⁻⁶. 1 Up to 1×10 9 Copy / μL, used for subsequent standard curve establishment and method sensitivity testing.

[0048] Genomic DNA Standards: To validate method performance against a complex background similar to clinical samples, this study also used genomic DNA standards purchased from Jingliang Technology (Shenzhen) Co., Ltd., with a BRAF V600E mutation allele frequency of 50% and a concentration of 40 ng / μL. Using genomic DNA from the human cell line SW480 (extracted from SW480 cells), which was verified as BRAF wild-type by Sanger sequencing, as the dilution background, this standard was precisely diluted proportionally to prepare a gradient standard with a total concentration of 10 ng / μL and mutation allele frequencies of 50.00%, 25.00%, 12.50%, 6.25%, 3.13%, 1.56%, 0.78%, 0.39%, 0.20%, 0.10%, 0.05%, and 0.00%.

[0049] 2. Primer design

[0050] Based on the above principles, oligonucleotide sequences were designed and optimized for the BRAF V600E (c.1799T>A) site (Table 1). All primers and probes were synthesized and purified by HPLC by Sangon Biotech (Shanghai) Co., Ltd.

[0051] Table 1. EPAS-PCR primer and probe sequences used for BRAF V600E detection

[0052]

[0053] 3. Modeled functional validation of key reactive components

[0054] To validate the EPAS-PCR reaction system, two model experiments were conducted to verify the necessity and influence of the core reaction components (DNA polymerase type and outer forward primer F1).

[0055] 3.1 Selection of DNA polymerase

[0056] Two commercially available quantitative PCR premixes were used to establish reaction systems: Premix Ex Taq™ (TakaraBio, whose Taq enzyme has 3'→5' exonuclease proofreading activity) and AceQ Universal U+ Probe Master Mix (Vazyme, whose hot-start Taq enzyme has no 3'→5' exonuclease activity). Equal volumes (1×10⁻⁶) of these premixes were used. 6 Wild-type (Wt), mutant (Mut) plasmids, empty vector (pUC57), and template-free water (NTC) were tested for copy / reaction. All primers and probes were diluted with TE buffer to a concentration of 20 μmol / L. The standard reaction system is shown in Table 2. The following was added to a 25 μL system:

[0057] Table 2

[0058]

[0059] Add water to make up to 25μL.

[0060] All real-time quantitative PCR reactions were performed on a SLAN-96S real-time quantitative PCR system from Shanghai Hongshi Medical Technology Co., Ltd. The reaction program was as follows: 95℃ pre-denaturation for 30 seconds; followed by 50 cycles of 95℃ denaturation for 10 seconds and 60℃ annealing / extension for 35 seconds. Fluorescence signals from the FAM channel (mutation reporter probe P2) and VIC channel (internal control probe P1) were acquired during the annealing / extension step.

[0061] 3.2 Verification of the necessity of the outer forward primer (F1)

[0062] Based on the determination of the optimal polymerase, the role of the outer forward primer (F1) in the EPAS-PCR system was further evaluated. Using Vazyme premix, with other component concentrations fixed, five different final concentration gradients of the F1 primer were set: 0, 0.1, 0.2, 0.5, and 1 μL. Tests were performed using Wt plasmid, Mut plasmid, puc57 empty plasmid, and template-free water (NTC), respectively. This experiment aimed to simulate the classic ARMS-PCR system (without F1) and compare its performance with that of the EPAS-PCR system.

[0063] 3.3 Results and Discussion

[0064] When using the Taq enzyme of Takara with 3'→5' exonuclease proofreading activity, both wild-type template (Wild-W5) and mutant template (Mut-M5) produced significant FAM amplification signals, showing only a difference in Ct values. Figure 2 A). This indicates that the enzyme's proofreading function corrects single base mismatches between the allele-specific primer ends and the wild-type template, thus allowing non-specific extensions and resulting in an inability to effectively distinguish between wild-type and mutant types, i.e., poor specificity.

[0065] Conversely, when using the Taq enzyme of Vazyme, which lacks 3'→5' exonuclease activity, the mutant template (Mut-M5) produced a normal mutation signal, while the mutant channel (FAM) of the wild-type template (Wild-W5) showed no amplification signal. Figure 2 B). This confirms that the enzyme does not have the property of correcting allele-specific primer end mismatches. When the primer encounters a wild-type template, the mismatch of the terminal bases effectively blocks the extension of the primer on the wild-type template, thereby achieving precise and specific recognition of mutant templates.

[0066] Conclusion: For techniques like extended probe qPCR that rely on primer end mismatches to distinguish mutations, it is essential to use Taq enzymes without 3'→5' exonuclease proofreading activity. This is a crucial prerequisite for ensuring the specificity of the detection.

[0067] The outer forward primer F1 is the core factor that distinguishes the EPAS-PCR system from the general ARMS-PCR system. To test its function, using Wild-W5 wild-type plasmid and Mut-M5 mutant plasmid as templates, a gradient of F1 primer concentrations of 0, 0.1, 0.2, 0.5, and 1 μL was set up. Figure 3Only three concentrations (0, 0.2, and 1 μL) are shown. Against a wild-type plasmid background, without F1 addition, a clear amplification signal was observed in the universal mutation reporter probe FAM after 45 cycles. Figure 3 A, amplification curve A4-FAM), indicates that the specific mutant primers can directly undergo non-specific amplification with the wild-type template, thus producing a clear FAM fluorescence signal; while after adding 0.2 μL of F1, the non-specific amplification of FAM is significantly smoother ( Figure 3 A, A6-FAM amplification curve, shows that adding 0.1 μL of F1 has a similar effect to adding 0.2 μL, while adding 1 μL of F1 can keep the FAM signal completely below the threshold for 50 cycles. Figure 3 A, A8-FAM amplification curve, the effect of adding 0.5 μL F1 is similar to that of adding 1 μL. These results suggest that although the mutant-specific primer differs from the wild-type template by two bases at the 3' end, it still has the potential to bind and amplify, and its amplification product can serve as an effective template for the mutant-specific primer, rapidly initiating amplification. However, after adding F1, F1 and R1 amplification produces a large amount of wild-type amplification product, which can bind to the mutant-specific primer F2 but cannot extend, becoming an "inhibitor" of F2's participation in non-specific amplification, thereby weakening the non-specific FAM signal. In the context of mutant plasmids, the addition of F1 significantly promotes mutant-specific amplification: the mutant products generated by F1 and R1 amplification can serve as high-quality templates for mutant-specific primers, significantly reducing the Ct value of the FAM fluorescence signal and greatly improving amplification efficiency. Figure 3 B, amplification curve B6-FAM compared to B4-FAM); however, as the F1 concentration increases, the amplification of mutation-specific primers tends to decrease ( Figure 3 B, the amplification curve B8-FAM), may be due to amplicon competition. In summary, F1 plays a crucial role in the EPAS-PCR system: it suppresses non-specific amplification, optimizing the system's sensitivity and specificity.

[0068] 4. Direct ARMS-PCR detection

[0069] To verify the key role of the outer forward primer F1 in inhibiting nonspecific amplification, this study designed a simplified detection system without F1 participation, based on the principle of conventional ARMS-PCR technology, as a control with the EPAS-PCR system of this invention.

[0070] 4.1 ARMS-PCR Primer and Probe Design

[0071] The conventional ARMS-PCR system employs a simplified three-primer / probe design, omitting the outer forward primer F1 and the universal primer / probe system. Amplification is directly performed using the mutation-specific inner primer and the outer reverse primer, with the fluorescent probe located within the amplification region.

[0072] Table 3

[0073]

[0074] The core difference between this system and the EPAS-PCR system of this invention is that it lacks the outer forward primer F1, the universal primer F3, and the universal mutation reporter probe P2. The fluorescence signal is directly generated by the extension of the mutation-specific primer and the binding of the probe. This is the conventional ARMS-PCR technology architecture that is currently widely used in clinical practice.

[0075] 4.2 Experimental Methods

[0076] An ARMS-PCR reaction system was established using Vazyme AceQ Universal U+ Probe Master Mix. The 25 μL reaction system contained 12.5 μL of 2× premix. The primers and probes were added to the final concentrations shown in the table. The templates were as follows:

[0077] Wild-type plasmid (1×10) 6 (copy / reaction);

[0078] mutant plasmid (1×10) 6 Copy / reaction, as a positive control);

[0079] pUC57 empty vector (1×10) 8 (copy / reaction);

[0080] Template-free water (NTC).

[0081] The reaction procedure was the same as in 3.1: pre-denaturation at 95°C for 30 seconds; followed by 50 cycles of denaturation at 95°C for 10 seconds and annealing / extension at 60°C for 35 seconds, with FAM channel fluorescence signals acquired at 60°C. All reactions were technically replicated three times.

[0082] 4.3 Results

[0083] Figure 4 The results showed that the mutant plasmid (labeled C2 in the figure) obtained a typical S-shaped amplification curve with a Ct value of 23.32 ± 0.40; while the wild-type plasmid (labeled C1 in the figure) showed a significant amplification signal after 41.20 ± 0.67 cycles. This indicates that in the absence of the outer forward primer F1, the mutant-specific primer underwent non-specific extension with the wild-type template and eventually initiated exponential amplification, producing false positive results. The pUC57 empty vector and the NTC control showed no amplification signal.

[0084] 4.4 Discussion

[0085] The experimental results directly correlate with the F1 necessity verification experiment of the EPAS-PCR system in section 3.2: In the experiment in 1.3.2, when the EPAS-PCR system lacked F1, non-specific amplification signals of the FAM channel also appeared after about 45 cycles in the wild-type plasmid background. Figure 3 A, curve A4); while when sufficient F1 (1 μL) was added, the FAM signal remained below the threshold for 50 cycles ( Figure 3 A, curve A8).

[0086] Conventional ARMS-PCR technology, adapted to the qPCR platform, abandons the outer forward primer in the classic four-primer AS-PCR architecture. The trade-off is significant: the absence of F1 / R1-mediated exponential amplification products from the wild-type template as a "competitive inhibitor" means that even with extremely low extension efficiency, the trace extension product accumulated after the mutation-specific primer binds to the wild-type template can gradually accumulate in subsequent cycles, eventually initiating exponential amplification and forming false positives around 40-45 cycles. This contrasts sharply with the EPAS-PCR system of this invention, which showed no wild-type non-specific signal within 50 cycles, fully demonstrating the irreplaceable role of the outer forward primer F1 in suppressing non-specific amplification and ensuring detection specificity.

[0087] It is noteworthy that, in the absence of the outer primer F1, both the ARMS-PCR system and the EPAS-PCR system without F1 can generate non-specific amplification signals in wild-type templates, but their Ct values ​​differ: ARMS-PCR exhibits false positives after 41.20 ± 0.67 cycles, while EPAS-PCR without F1 only shows amplification after approximately 45 cycles. This difference stems from the different signal generation mechanisms of the two systems. In ARMS-PCR, the fluorescence signal directly originates from the binding of the probe after extension of the mutation-specific primer, with signal generation synchronized with mutation recognition; however, the FAM signal in EPAS-PCR requires a multi-step cascade process from mutation recognition, inner primer extension, to universal primer binding and extension, and probe binding, resulting in a delay in signal generation. Therefore, even without competitive inhibition from F1, the signal cascade mechanism of EPAS-PCR still provides an additional buffer for non-specific amplification, further reducing the risk of false positives.

[0088] 5. Standard curve for amplification

[0089] 5.1 Methods for establishing standard curves

[0090] To systematically evaluate the quantitative detection capability and linear range of the EPAS system, this experiment used serially diluted wild-type (Wt) and mutant (Mut) plasmids as templates to establish standard curves in three stages. First, Wt and Mut plasmids were serially diluted 10-fold using sterile double-distilled water to construct a concentration range of 1×10⁻⁶. 1 ~1×10 9 Template gradient of copies / μL. 1 μL of template was used for each dilution as qPCR template, and three technical replicates were set up for each concentration point to ensure the reliability of the experimental results.

[0091] Two negative controls were set up to eliminate interference: ① Plasmid control: 1 μL of plasmid with a concentration of 1×10⁻⁶. 8 ① Use 1 μL of puc57 empty vector as template; ② Template-free control (NTC): Use 1 μL of sterile double-distilled water as template, and keep the other reaction conditions the same as the sample. The qPCR reaction system and conditions should be performed according to the parameters described in Section 1.3 of this experiment to ensure consistency and standardization of experimental conditions. After starting the qPCR program and completing amplification, collect real-time fluorescence data from the internal control channel (VIC) and the mutation reporter channel (FAM), and record the cycle threshold (Ct value) of each reaction well. Calculate the common logarithm of template copy number (log...). 10 Using (copy number) as the x-axis and the Ct value of the corresponding detection channel as the y-axis, linear regression analysis was performed on the following three sets of data: ① FAM channel data of Wt template; ② FAM channel data of Mut template; ③ VIC channel data of Mut template. The linearity of the standard curve was evaluated by calculating the coefficient of determination (R²), and the amplification efficiency was calculated using the formula E=10^(-1 / slope)-1. Combining R² and amplification efficiency, the linear range and amplification performance of the EPAS system were systematically evaluated.

[0092] 5.2 Results and Discussion

[0093] In this experiment, wild-type (Wt) plasmids and mutant (Mut) plasmids were serially diluted as templates. Standard curves were established three times to evaluate the quantitative ability and linear range of the EPAS system. The results of the three repeated experiments were stable and consistent.

[0094] The template concentration gradient used in the experiment was 1×10⁻⁶. 1 ~1×10 9 The concentration was measured at copies / μL, with three technical replicates at each concentration point, and plasmid control and template-free control (NTC) were also included. In the three replicate experiments, no specific amplification was observed in either of the two negative control groups (no Ct value within 50 cycles), indicating that the experiment was free from template contamination and primer dimer interference, and that the experimental system was stable and reliable.

[0095] The common logarithm of template copy number (log 10 Using (copy number) as the x-axis and the corresponding cycle threshold (Ct value) of the detection channel as the y-axis, linear regression analysis was performed on the VIC channel data of the Wt template, the VIC channel data of the Mut template, and the FAM channel data of the Mut template. Combining the amplification curve characteristics and the linear analysis results, the specific findings are as follows: Wild-type (Wt) plasmids did not show specific amplification curves in the FAM channel, indicating that the EPAS system at 1×10⁻⁶... 1 -1×10 9 Within the copy / μL concentration range, it does not induce non-specific amplification of mutation sites, exhibiting good specificity. (See [link to documentation]). Figure 5 A; it showed good amplification curves in all VIC channels, especially at 1×10 4 ~1×10 8 Within the copy number / μL concentration range, the common logarithm of the template copy number showed a good linear relationship with the Ct value, and the coefficient of determination (R²) was [missing information]. 2 The coefficient of performance (COP) is greater than 0.99, indicating excellent linear fit. The VIC amplification efficiency, derived from the slope of the regression equation, is 107%.

[0096] The mutant (Mut) plasmids all showed clear specific amplification curves in the FAM channel (P2), at 1×10⁻⁶. 1 ~1×10 9 The concentration showed a good linear relationship across the entire range of copies / μL, with 1×10⁻⁶ μL being particularly effective. 3 ~1×10 9 The linear relationship was particularly significant across the copy / μL concentration range, with a coefficient of determination (R²) > 0.98. (See...) Figure 5 B; it also showed a good amplification curve in the VIC channel (P1), at 1×10 3 ~1×10 8 Within the copy number / μL concentration range, the common logarithm of the template copy number showed a good linear relationship with the Ct value, and the coefficient of determination (R²) was [missing information]. 2 The value was greater than 0.98. It is noteworthy that the Ct value ranges for amplification of the Wt and Mut plasmids by the VIC channel differed. The Ct value range for the Wt plasmid was 9.88 cycles, while that for the Mut plasmid was 12.2 cycles, suggesting that the amplification of the Mut plasmid had a certain impact on the amplification efficiency of the EPAS system. Based on the slope of the regression equation, the VIC amplification efficiency was 103%, and the FAM amplification efficiency was 97%, indicating good amplification efficiency.

[0097] In summary, the EPAS system at 1×10 1 ~1×10 9Within a template concentration range of copies / μL, it exhibits good linearity and stable amplification efficiency, demonstrating reliable quantitative detection capabilities and meeting the needs of subsequent quantitative analysis of related samples.

[0098] 6. Plasmid sensitivity determination

[0099] 6.1 Sensitivity testing using plasmids

[0100] To determine the ability of the EPAS system to detect low-abundance mutations, this study simulated samples with different mutation frequencies by mixing different concentrations of mutant plasmids into wild-type plasmids, and systematically evaluated its detection limit.

[0101] Two total plasmid background concentrations were used in the simulated samples. In the high background group, the total plasmid concentration was maintained at 1 × 10⁻⁶ per reaction. 6 The mutant plasmids were copied, with the percentages set sequentially as 100% (S1), 33.3% (S2), 11.1% (S3)... diluted to S13 at a ratio of 1 / 3, and S14 was 0%. In the low background group, the total plasmid concentration was 1 × 10⁻⁶ per reaction. 4 The copy number and the percentage of mutant plasmids were set at the same gradient (from SS1 to SS10, and SS11 was 0%). Samples were prepared independently for each ratio, and empty vector (pUC57) and template-free water (NTC) were set up as negative controls.

[0102] All pooled samples were tested three times using the established standard curve and the optimal EPAS reaction system.

[0103] 6.2 Plasmid sensitivity test results

[0104] To evaluate the ability of the EPAS system to detect low-abundance mutations, this study simulated samples with different mutant allele frequencies by mixing wild-type and mutant plasmids of known copy numbers. A high background group was set up (total plasmid concentration: 1×10⁻⁶). 6 (copy / reaction) and low background group (total plasmid concentration: 1×10) 4 (Copy / reaction), the proportion of mutant plasmids was serially diluted by 1 / 3, from S1 to S14 (high background group) and SS1 to SS11 (low background group), and a pure wild-type negative control was set up.

[0105] See results Figure 6 In the high background group ( Figure 6 In A), mutation-specific amplification signals were detected in all seven plasmids from S1 to S7. The proportion of mutant plasmids in S7 was 0.1372%, corresponding to a theoretical absolute copy number of 1371 copies / reaction. This result indicates that the EPAS system can still stably produce positive amplification signals at this mutation abundance and absolute copy number.

[0106] In the low background group ( Figure 6 In B), mutation-specific amplification signals were detected in all SS1 to SS6. The proportion of mutant plasmids in SS6 was 0.4115%, corresponding to a theoretical absolute copy number of 41 copies / reaction. This result indicates that the EPAS system can still detect mutant plasmids even with an absolute copy number as low as 41 copies.

[0107] No significant FAM amplification signal was observed in either of the two mutant plasmid negative controls (S14 and SS11, 0% mutation), indicating that the system has good specificity. No VIC or FAM signals were detected in either the Puc57 empty vector or the NTC blank control group, indicating that the system has good specificity.

[0108] In summary, the EPAS system can detect mutation frequencies as low as 0.1372% (corresponding to 1371 copies of the mutant plasmid) in high-background samples and as low as 0.4115% (corresponding to 41 copies of the mutant plasmid) in low-background samples, demonstrating good sensitivity and stability, and is suitable for low-frequency mutation detection scenarios.

[0109] 7. Standard sensitivity testing

[0110] 7.1 Use standard samples for sensitivity testing

[0111] To evaluate the performance of the EPAS system in a complex genomic context more closely resembling clinical samples, validation and specificity tests were performed using commercially available standards and characteristic cell line DNA. Performance validation was conducted using a certified genomic DNA standard (EliteTech). This standard contained the BRAF V600E mutation at a frequency of 50% and a concentration of 40 ng / μL. Using genomic DNA from a human cell line (SW480) confirmed to be BRAF wild-type via sequencing as the dilution background, the standard was precisely diluted into a series of gradient samples with different mutation frequencies, including 50.00%, 25.00%, 12.50%, 6.25%, 3.13%, 1.56%, 0.78%, 0.39%, 0.20%, 0.10%, 0.05%, and 0.00%, with a total concentration of 10 ng / μL for each sample. Water was used as a negative control.

[0112] 7.2 Results of sensitivity test on standard samples

[0113] A BRAF V600E genomic DNA standard with a 50% mutation frequency was serially diluted against a background of human wild-type genomic DNA to obtain samples S1 to S11, with S11 containing a standard concentration of 0 for the mutation. Testing showed that Ct values ​​were obtained for S1-S8, while S9 exhibited significant amplification, with the curve very close to the fluorescence threshold. Theoretically, these samples, out of 3050 total genomes, contain 1525, 762.5, 381.25, 190.62, 95.31, 47.65, 23.82, 11.91, and 5.95 mutant genomes, respectively, with the lowest concentration being 0.2%. Figure 7 The results showed that the EPAS system could still produce positive amplification signals at this mutation abundance and absolute copy number. No visible amplification signals were observed in samples with even lower concentrations. In the NTC blank control group, no VIC or FAM signals were detected, indicating that the system has good specificity.

[0114] While mainstream real-time ARMS-PCR technology has achieved breakthroughs in closed-tube detection, its design principle has inherent flaws: the artificial mismatch introduced at the 3′ end of the primer to improve specificity often sacrifices amplification efficiency, resulting in insufficient detection of low-frequency mutations. Simultaneously, its probe must be designed within a limited amplification region and "bound" to non-specific amplification; once primer mismatch extension occurs, the probe will report a false positive signal. More importantly, ARMS-PCR abandons one of the outer primers in classic four-primer AS-PCR, losing the template enrichment effect of pre-amplification, further weakening detection sensitivity. Therefore, ARMS-PCR struggles to achieve a balance between specificity, sensitivity, and design simplicity, particularly limiting its application in ultra-low-frequency mutation detection.

[0115] The extended probe-based qPCR (EPAS-PCR) technology proposed in this invention is a systematic solution to the aforementioned shortcomings. This technology fully retains the dual outer primer pre-amplification architecture of classic four-primer AS-PCR, ensuring sufficient enrichment of low-frequency mutation templates. Simultaneously, by introducing a target-independent extended sequence at the 5′ end of the inner primer, and using universal primers and probes, the mutation recognition event is decoupled from the fluorescence signal output—the universal probe is only "activated" to generate a signal after the inner primer accurately recognizes and extends the mutation, fundamentally avoiding the risk of probe binding to non-specific amplification. More importantly, probe design is now independent of each mutation site; a single universal system can be adapted to all detections, greatly reducing design difficulty and optimization workload. In short, EPAS-PCR inherits the high sensitivity advantage of AS-PCR and achieves the closed-tube quantification function of ARMS-PCR, while overcoming the latter's trade-off between specificity and design complexity, providing a completely new solution for ultrasensitive nucleic acid mutation detection.

Claims

1. A primer for detecting the V600E mutation of the BRAF gene based on epitaxial probe-based qPCR technology, characterized in that, The primers include: Outer positive primer: TCTCTTACCTAAACTCTTCATAATGCTTG; Outer reverse primer: AACTCAGCAGCATCTCAGGGCCAAAAA; Inner mutation-specific primers: ATCTCCGTTCCTAAGGTTGGACAAAGCTTCCGATTAGGGATTCTCCATGTAAATAGGTGATTTTGGTCTAGCTACATA; Universal forward primer: ATCTCCGTTCCTAAGGTTGGA.

2. A probe for detecting BRAF gene V600E mutation based on epitaxial probe-based qPCR technology, characterized in that, The probe includes: Universal mutation reporter probe: FAM-AGCTTCCGATTAGGGATTCTCCATG-BHQ1; Internal control probe: VIC-TCCTTTACTTACTACACCTCAGATATA-BHQ1.

3. A kit for detecting BRAF gene V600E mutation based on epitaxial probe-based qPCR technology, characterized in that, It includes the primers as described in claim 1 and the probes as described in claim 2.

4. The reagent kit according to claim 3, characterized in that, It also contains hot-start Taq DNA polymerase.

5. The reagent kit according to claim 3, characterized in that, In the 25 μL qPCR reaction system of the kit, the final concentrations of each primer are as follows: the final concentrations of the outer forward primer, the outer reverse primer, and the universal forward primer are all 0.4 μmol / L, and the final concentration of the inner mutation-specific primer is 0.24 μmol / L; the final concentration of each probe is 0.24 μmol / L.

6. The use of the primers as described in claim 1, the probes as described in claim 2, or the kits as described in any one of claims 3-5 in the preparation of detection reagents for precision oncology drug guidance, oncology efficacy monitoring, or oncology drug resistance detection.

7. The application according to claim 6, characterized in that, The tumor includes one of the following: melanoma, colorectal cancer, or thyroid cancer.

Images