Application of SNP molecular marker related to chicken motile sperm concentration trait, SNP primer and kit

Abstract

The application relates to the technical field of molecular breeding, and particularly relates to application of a SNP molecular marker related to a chicken active sperm concentration trait, a SNP primer and a kit. The SNP molecular marker is located at the 32260877th position of a chicken No. 4 chromosome, and the alleles are T and C; the SNP molecular marker can quickly identify the semen quality of a cock individual, so as to screen cocks with high active sperm concentration, is used for assisted breeding of local chicken semen quality traits, is beneficial to accelerating the genetic improvement process of local chickens, and has a wide application prospect.

Description

Technical Field

[0001] This invention relates to the field of molecular breeding technology, and in particular to the application of SNP molecular markers related to the trait of chicken sperm motility, SNP primers and kits. Background Technology

[0002] In poultry production, semen quality is an important indicator for measuring the reproductive capacity of breeding roosters. It directly affects the fertilization rate of hatching eggs, the quality of chicks, and the economic benefits of chicken farms. Breeding and selecting breeding roosters with excellent semen quality is an important part of breeding work and is of great significance to poultry breeding.

[0003] Shandong boasts abundant local chicken breeds, but the utilization rate of germplasm resources is low. Systematic selection of roosters has not been conducted, frequently resulting in roosters with low reproductive rates. Traditional breeding relies primarily on phenotypic and family selection, with rooster selection mainly focusing on body shape and secondary sexual characteristics. This method has significant limitations, including long selection cycles, insufficient accuracy of testing results, and the inability to identify recessive superior genes, thus hindering genetic progress and failing to meet the demands of modern high-efficiency breeding. Single nucleotide polymorphisms (SNPs) are differences in single nucleotides between functional and non-functional regions of the genome. They are a widely existing type of genetic variation, and with the development of molecular biology techniques, SNPs play a crucial role in functional gene analysis, genetic mechanism research, and marker-assisted breeding.

[0004] The Wenshang Lufeng chicken, as one of the local chicken breeds, is an excellent local chicken breed resource with speckled feathers. It has the characteristics of good adaptability, tolerance to roughage, strong disease resistance, good egg production performance, beautiful carcass appearance, and excellent meat quality. The Shandong Provincial Local Chicken Breed Resource Live Gene Bank has established a conservation and breeding group for the Wenshang Lufeng chicken and carried out some breeding work, mainly targeting egg production and meat production performance. However, systematic breeding of the reproductive traits of roosters has not been carried out, which has affected its breeding progress.

[0005] Based on this, we systematically explored SNP molecular markers closely related to the quality traits of chicken semen and deeply analyzed their regulatory molecular mechanisms. This research aims to accelerate the genetic improvement of local chicken breeds and has significant theoretical and practical value for comprehensively improving the breeding level of local chicken breeds. Summary of the Invention

[0006] This invention provides an application of SNP molecular markers related to the trait of sperm motility in chickens, SNP primers, and a kit. It was found that position 32260877 on chromosome 4 of the Wenshang Luhua chicken can be used as an SNP molecular marker for early selection of roosters with high sperm motility, which can accelerate the genetic improvement process of local chickens, reduce feeding and breeding costs, and solve the problems existing in the prior art.

[0007] One of the technical solutions adopted in this invention is: An application of an SNP molecular marker in selective breeding of chickens with motile sperm concentration is provided. The SNP molecular marker is located at position 32260877 on chromosome 4 of chicken, with alleles T and C. The SNP molecular marker is used to identify rooster individuals with different motile sperm concentration traits, thereby screening for roosters with high motile sperm concentration.

[0008] Furthermore, the SNP molecular marker is located in the nucleotide sequence shown in SEQ ID No. 1 below; SEQ ID No. 1: TTAGTGGTAGTAGGTGGGTTAAGCGCTTTGCAAACTGCATCTACTTCCTTT.

[0009] Furthermore, in the above applications, when the allele at position 32260877 is T, the genotype at that locus is TT, and the rooster exhibits a high concentration of motile sperm. When the allele at position 32260877 is C, the genotype at that locus is CC, and the rooster exhibits low concentration of motile sperm. When the genotype at position 32260877 is TC, the rooster has a moderate concentration of motile sperm.

[0010] Furthermore, in the above applications, individuals with the TT genotype at Chr4: 32260877 had a higher concentration of motile sperm than individuals with the CC or TC genotypes, with the reference genome version being GRCg7b.

[0011] Furthermore, in the above applications, the use of the SNP molecular markers for breeding or assisted breeding of roosters with high sperm motility concentration includes the following steps: (1) Extract genomic DNA from rooster samples; (2) Allele detection was performed on the genotype at position 32260877 on chromosome 4; (3) Obtain the SNP corresponding locus genotype of the sample to be tested, and select individuals with the TT genotype for breeding.

[0012] Furthermore, the roosters mentioned are Wenshang Luhua chickens, Laiwu black chickens, and Shouguang chickens.

[0013] The second technical solution adopted in this invention is: SNP primers for selecting the concentration trait of chicken motile sperm are provided, the primers comprising a forward primer with a nucleotide sequence as shown in SEQ ID No. 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID No. 3, the primers being used to amplify the SNP molecular marker described in claim 1.

[0014] SEQ ID No.2: CCCTTACAGGTCAGGTGCTT; SEQ ID No. 3: CAGTGCAGACCGAAGTCAGG.

[0015] Furthermore, the amplification reaction system also includes Taq, dNTP Mix, DNA template, and ddH2O. The reaction program is as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 30 cycles; 72℃ for 5 min, and storage at 4℃.

[0016] The third technical solution adopted in this invention is: A kit is provided for detecting SNP molecular markers associated with the trait of active sperm concentration in roosters, containing the SNP primers described above.

[0017] Furthermore, the SNP primers or kits described above are used in the early identification and breeding selection of sperm motility in roosters, wherein the roosters are Wenshang Luhua chickens, Laiwu black chickens, and Shouguang chickens.

[0018] Furthermore, the motile sperm concentration characteristics include sperm concentration (CON), sperm motility (MOT), and motile sperm concentration (MSC).

[0019] The beneficial effects of this invention are: 1. This invention utilizes resequencing technology to genotype SNP loci in 342 Wenshang Lufeng roosters. GWAS analysis revealed SNP molecular markers associated with sperm motility concentration in Wenshang Lufeng chickens. Specifically, T was the dominant allele in chickens with high sperm motility concentration, while C was the inferior allele in chickens with low sperm motility concentration. Selecting individuals with the T allele using these SNP molecular markers can improve the sperm motility concentration of the entire population.

[0020] 2. The SNP molecular markers of this invention are used for the breeding of Wenshang Luhua chickens to detect the motile sperm concentration trait. This invention can predict the level of motile sperm concentration early, quickly, at low cost, and effectively. It has broad application prospects in chicken breed improvement and can achieve excellent economic value. Attached Figure Description

[0021] Figure 1 Manhattan plot of GWAS results for motile sperm concentration in Example 1; Figure 2 The difference in genotypic and phenotypic effects at the significantly associated site Chr4: 32260877 in Example 1; Figure 3 This is a diagram of the Sanger sequencing results for the amplified target fragment in Example 2. Detailed Implementation

[0022] To clearly illustrate the technical features of this solution, the invention will be described in detail below through specific embodiments and in conjunction with the accompanying drawings.

[0023] In the following technical description, the terms "sperm concentration (CON)" and "sperm motility (MOT)" are core indicators for evaluating the quality and reproductive performance (fertilization rate) of rooster semen. "Sperm concentration" refers to the number of sperm per milliliter of semen, while "sperm motility" refers to the sperm's ability to move, usually assessed as the "percentage of progressively motile sperm." Forwardly motile sperm have strong motility and the ability to swim and penetrate, which is crucial for fertilization. The term "motile sperm concentration (MSC)" refers to the number of progressively motile sperm per unit volume of semen; this indicator integrates the key biological characteristics of sperm concentration and motility. In the description of this invention, the terms "high motile sperm concentration," "low motile sperm concentration," and "medium motile sperm concentration" are used to distinguish between high, medium, and low differences in motile sperm concentration data calculated from sample sperm concentration and sperm motility.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of this application.

[0025] The first aspect of this application provides a SNP molecular marker associated with the sperm motility trait in roosters. This SNP molecular marker was obtained by GWAS analysis following sequencing of a population of 342 Wenshang Lufeng chickens using resequencing technology. The SNP molecular marker is located at Chr4 of the GRCg7b nucleotide sequence shown in SEQ ID NO.1, with alleles T and C, and genotypes including TT, CC, and TC. This SNP molecular marker can be used to identify and detect Wenshang Lufeng chicken individuals with different sperm motility traits, and can provide a basis for screening Wenshang Lufeng chickens with high sperm motility.

[0026] SEQ ID NO. 1: TTAGTGGTAGTAGGTGGGTTAAGCGCTTTGCAAACTGCATCTACTTCCTTT.

[0027] When the above SNP molecular markers were used for selective breeding of Wenshang Lufeng chickens to select for the sperm motility trait, when the allele at position 32260877 was T, the genotype was TT, and the Wenshang Lufeng chickens exhibited high sperm motility; when the allele at position 32260877 was C, the genotype was CC, and the Wenshang Lufeng chickens exhibited low sperm motility; and when the genotype at position 32260877 was TC, the Wenshang Lufeng chickens exhibited moderate sperm motility. That is, individuals with the Chr4: genotype TT at position 32260877 exhibited a higher sperm motility trait than individuals with genotypes CC or TC.

[0028] The second aspect of this application provides SNP primers for selecting the motile sperm concentration trait of Wenshang Luhua chickens. These primers are used to amplify the aforementioned SNP molecular markers. The primers include primer F with the nucleotide sequence shown in SEQ ID No. 2: CCCCTTACAGGTCAGGTGCTTT; and primer R with the nucleotide sequence shown in SEQ ID No. 3: CAGTGCAGACCGAAGTCAGG.

[0029] The DNA of Wenshang Lufeng chickens was amplified by PCR using the primers described above to obtain gene fragments containing corresponding SNP molecular marker sites. The genotypes of polymorphic sites of SNP molecular markers were detected in these gene fragments. When the allele at position 32260877 was T, the genotype at the site was TT, indicating that the Wenshang Lufeng chicken had a high concentration of motile sperm. When the allele at position 32260877 was C, the genotype at the site was CC, indicating that the Wenshang Lufeng chicken had a low concentration of motile sperm. When the genotype at position 32260877 was TC, the Wenshang Lufeng chicken had a moderate level of motile sperm.

[0030] A third aspect of this application provides a kit containing the primers described above, which also includes premixes commonly used in the art. These premixes include, but are not limited to, Phusion® Ultra Fidelity PCR Premix and Platinum Direct PCR Universal Premix.

[0031] The fourth aspect of this application provides the application of the primers and kits described above in the identification and selection of Wenshang Luhua chickens with high sperm motility concentration, with the following steps: (1) Extract genomic DNA from the Wenshang Luhua chicken samples to be tested; (2) Amplify the DNA from step (1) using the primers described above to obtain a gene fragment containing the SNP molecular marker; perform allele detection on the genotype at position 32260877 on chromosome 4; (3) Obtain the SNP corresponding locus genotype of the sample to be tested, and select individuals with the TT genotype for breeding.

[0032] The technical solution of the present invention will be further explained and described below through specific embodiments.

[0033] Example 1: Genome-wide association analysis of motile sperm concentration trait in Wenshang Luhua chickens

[0034] 1. Phenotypic data collection and genotyping

[0035] The experimental group consisted of 342 Wenshang Luhua chickens from the Egg-Laying Chicken Breeding Engineering and Equipment Research Base, all raised and managed under the same conditions. Semen was collected from the roosters at 38 weeks of age at regular intervals of 3 days, for a total of 3 measurements. Semen quality was determined using an iSpermmCASA sperm analyzer, including sperm concentration (CON) and sperm motility (MOT), and the motile sperm concentration (MSC) phenotypic trait was calculated. Semen was collected from each rooster using the dorsal-abdominal massage method, collected in 1.5 ml centrifuge tubes, and placed in a 37°C water bath. 10 μL of raw semen was pipetted and diluted 20 times with preheated physiological saline before measurement.

[0036] Blood was collected from the wing veins of all experimental groups using EDTA anticoagulant tubes, and DNA was extracted using the conventional phenol-chloroform method. DNA concentration and purity (OD260 / OD280, OD260 / OD230) were determined using a NanoDrop 2000 spectrophotometer, and DNA integrity was assessed by agarose gel electrophoresis. After quality control, a 350bp library was constructed, and basic reads were obtained using the DNBSEQ-T7 sequencing platform (PE150) at a sequencing depth of 10×. After raw data quality control and filtering, the data was aligned to the chicken reference genome GRCg7b using BWA software, and SNP mutations in each sample were detected using GATK HaplotypeCaller (v4.0.4.0). Using PLINK software (v1.90b6.26), quality control was performed according to the following criteria. SNPs obtained from the initial filtering were selected for subsequent analysis: autosomes 1-28 and chromosome Z were selected; gene deletion rate (GENO) < 0.05; minor allele frequency (MAF) > 0.05; Hardy-Weinberg equilibrium (HWE) > 1e-6; and individual sample missing rate (MIND) < 0.05. A total of 342 individuals and 8,491,661 biallelic SNPs were retained for subsequent analysis.

[0037] 2. Phenotypic Data Analysis

[0038] The semen quality phenotypic values ​​were subjected to Johnson transformation, and the KS test showed that the phenotypic values ​​were normally distributed. Descriptive statistical analysis was performed on the population to obtain key statistics such as mean ± standard deviation and coefficient of variation. Heritability was estimated using the latest version of GCTA (v1.95.0) and REML (restricted maximum likelihood method). The results are shown in Table 1. Finally, valid phenotypic data from 342 chickens were obtained for subsequent analysis.

[0039] Table 1: Descriptive statistics and heritability of semen quality traits

[0040] 3. Genome-wide association analysis

[0041] Based on whole-genome resequencing data, association analysis of MSC traits was performed using a linear mixture model (LMM) in GEMMA (v0.98.5) software, yielding the following results. Figure 1 The analytical model is as follows: y = Wα + Xβ + u + e, where y is the phenotypic value matrix, W is the covariance matrix, and in this study, all components of principal component analysis (PCA) are included as covariates in the fixed effects matrix W. α is the vector of corresponding coefficients including the intercept, X is the SNP genotype vector, β is the effect size of the SNP, u is the random effect, and e is the error effect.

[0042] Wald test was used to screen SNPs associated with the trait. The Bonferroni method was used to correct the GWAS results. Using PLINK (v1.9) software, LD filtering was performed to calculate the number of valid independent SNPs across the genome, which was 130,683. Therefore, 0.05 / 130,683 = 3.826052e-07 and 1 / 130,683 = 7.652105e-06 were used as the thresholds for genome-wide significance and potential significant association, respectively. The Manhattan plot and QQ plot of the GWAS results were visualized using the CMplot package.

[0043] Depend on Figure 1 It was observed that 4 SNPs reached significant association at the genome-wide level, and 230 SNPs reached potentially significant association, mainly concentrated on chromosomes 4 and 10. Among them, the T / C at position 32260877 of Chr4 (rs13514256) was a potentially significant association site with the sperm motility trait in 38-week-old roosters. Candidate genes for this SNP were identified and annotated. IQCM Gene.

[0044] 4. SNP genotype-phenotypic effect analysis

[0045] Genotypic and phenotypic effects of SNPs were analyzed. Figure 2It is evident that the TT genotype at the rs13514256 locus is significantly higher than the TC and CC genotypes.

[0046] Example 2 Primer design and validation for SNP sites

[0047] For the T / C nucleotide site at position 32260877 of chromosome 4 obtained in Example 1, primer combinations for detecting this site were designed using Oligo7 software for PCR detection of this SNP site. The primers include primer F (nucleotide sequence shown in SEQ ID No. 2): CCCCTTACAGGTCAGGTGCTTT, and primer R (nucleotide sequence shown in SEQ ID No. 3): CAGTGCAGACCGAAGTCAGG.

[0048] Based on the DNA sequencing results in Example 1, genomic DNA from three individuals with SNP sites of TT, TC, and CC genotypes was selected as templates. PCR amplification was performed using the primers described above according to the PCR reaction system and procedure below, resulting in amplified products with sequences as shown in SEQ ID NO.4.

[0049] The PCR reaction system consisted of: 1 μL Taq, 5 μL 10×Buffer, 4 μL dNTP Mix, 1 μL each of two forward and reverse primers at 10 μmol / L, 2.0 μL DNA template at 0.5 μg / μL, and 36 μL ddH2O, for a total of 50 μL.

[0050] PCR reaction program: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 30 cycles; 72℃ for 5 min, and store at 4℃.

[0051] SEQ ID NO.4: TTGCTACAAGATCAGCATAAGTTAGTGGTAGTAGGTGGGTTAAGCGCYTTGCAAACTGCATCTACTTCCTTTTAAAAGTTCCTTGGCTAACTGGCTGAGGTGGAGCTCATTGGCAAAGAGCTTATGCTTTGACTAATTCCATTAAAAGAGGACCAGGGCAGGGC AGACAAAATAGAACTCTTTATTCTTAAAGCTCAAGTGTTGAGCTTGATTTAATCATCTTATGTCTATATGAGTCTATATTAACAATAAAGCTGTTGCAAAGCATTCTATAGCTCTTATAATGTTAACAGTACTCCTGAACTTCACTCATAGCACACCTGACTTG.

[0052] The amplified products were subjected to Sanger sequencing, and the gene fragments were subjected to both forward and reverse sequencing. The resulting sequences were compared with the chicken reference genome GRCg7b to obtain the following results: Figure 3 The SNP marker site shown is mutated. The base Y in the sequence is the SNP site, where Y represents T or C, resulting in T / C polymorphism at this site.

[0053] Example 3: Validation of genotypic phenotypic differences at other variety populations

[0054] To verify the effect of the Chr4:32260877 locus on the motile sperm concentration trait in chickens, this application conducted semen quality tests on 30 Laiwu Black Chickens and 24 Shouguang Chickens from the Changqing Base of the Poultry Research Institute of Shandong Academy of Agricultural Sciences, and analyzed the effects of different genotypes at this locus on the motile sperm concentration trait.

[0055] Specifically, semen quality was determined using an iSperm mCASA sperm analyzer, including sperm concentration and sperm motility, and the concentration of motile sperm was calculated. Semen was collected from each rooster using the dorsal-abdominal massage method, collected in 1.5 ml centrifuge tubes, and placed in a 37°C water bath. 10 μL of raw semen was pipetted, diluted 20-fold with preheated physiological saline, and then measured. Blood was collected from the wing vein using EDTA anticoagulant tubes, and DNA was extracted using the traditional phenol-chloroform method. The concentration and purity of DNA (OD260 / OD280, OD260 / OD230) were detected using a NanoDrop 2000 spectrophotometer, and DNA integrity was checked by agarose gel electrophoresis. The genotype of the Chr4:32260877 locus was determined by sequencing. The concentration of motile sperm for different genotypes was statistically analyzed using Excel, and the differences in motile sperm concentration among individuals with different genotypes were analyzed using SPSS 27.0, as shown in Table 2.

[0056] Table 2: Analysis of differences in motile sperm concentration among individuals with different genotypes

[0057] Note: The values ​​in Table 2 are mean ± standard deviation. Different capital letters indicate extremely significant differences. P < 0.01), different lowercase letters indicate significant differences ( P < 0.05).

[0058] Table 2 shows that among the 54 validation group, 19 had the TT genotype, 31 had the TC genotype, and 4 had the CC genotype. For the sperm motility trait, there were significant differences among the three genotypes, and the phenotypes of TT and TC were significantly higher than those of CC. This indicates that TT can be considered a dominant genotype. This polymorphic site can be used for marker-assisted selection of trait indicators for early breeding, improving breeding efficiency and providing a reliable basis for the genetic improvement of sperm motility trait in local chickens.

[0059] The SNP molecular markers, primers, and kits provided by this invention can be used for early selection of breeding roosters with high sperm motility in local Shandong chickens such as Wenshang Luhua chicken, Laiwu black chicken, and Shouguang chicken, thereby improving the breeding process and efficiency.

[0060] The present invention has been described in detail above. The specific embodiments described above should not be construed as limiting the scope of protection of the present invention. Any alternative modifications or variations made to the embodiments of the present invention by those skilled in the art will fall within the scope of protection of the present invention. Any aspects of the present invention not described in detail are well-known techniques to those skilled in the art.

Claims

1. The application of an SNP molecular marker in the selection of chicken sperm motility concentration traits, characterized in that, The SNP molecular marker is located at position 32260877 on chromosome 4 of chicken, with alleles T and C. The SNP molecular marker is used to identify rooster individuals with different sperm motility traits, thereby screening for roosters with high sperm motility.

2. The application according to claim 1, characterized in that, The SNP molecular marker is located in the nucleotide sequence shown in SEQ ID No. 1 below; SEQ ID No. 1: TTAGTGGTAGTAGGTGGGTTAAGCGCTTTGCAAACTGCATCTACTTCCTTT.

3. The application according to claim 1, characterized in that, When the allele at position 32260877 is T, the genotype at that locus is TT, and the rooster exhibits a high concentration of motile sperm. When the allele at position 32260877 is C, the genotype at that locus is CC, and the rooster exhibits low concentration of motile sperm. When the genotype at position 32260877 is TC, the rooster has a moderate concentration of motile sperm.

4. The application according to claim 1, characterized in that, Individuals with the TT genotype at Chr4 position 32260877 had higher motile sperm concentration than individuals with the CC or TC genotypes. The reference genome version was GRCg7b.

5. The application according to claim 1, characterized in that, The selection or assisted selection of roosters with high sperm motility concentration using the aforementioned SNP molecular markers includes the following steps: (1) Extract genomic DNA from rooster samples; (2) Allele detection was performed on the genotype at position 32260877 on chromosome 4; (3) Obtain the SNP corresponding locus genotype of the sample to be tested, and select individuals with the TT genotype for breeding.

6. The application according to any one of claims 1-5, characterized in that, The chickens mentioned are Wenshang Luhua chicken, Laiwu black chicken, and Shouguang chicken.

7. An SNP primer for selecting chicken sperm motility concentration traits, characterized in that, The primers include a forward primer with a nucleotide sequence as shown in SEQ ID No. 2 and a reverse primer with a nucleotide sequence as shown in SEQ ID No. 3, and the primers are used to amplify the SNP molecular marker described in claim 1; SEQ ID No.2: CCCTTACAGGTCAGGTGCTT; SEQ ID No. 3: CAGTGCAGACCGAAGTCAGG.

8. The SNP primer according to claim 7, characterized in that, The amplification reaction procedure is as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, annealing at 55℃ for 30 s, extension at 72℃ for 1 min, for a total of 30 cycles; 72℃ for 5 min, and storage at 4℃.

9. A kit for detecting SNP molecular markers related to the concentration trait of motile sperm in chickens, characterized in that, It contains the SNP primers as described in claim 7.

10. The application of the SNP primers as described in claim 7 or the kit as described in claim 9 in the early identification and breeding selection of sperm motility in roosters, wherein the roosters are Wenshang Luhua chickens, Laiwu black chickens, or Shouguang chickens.

Images