Specific pcr primer pairs for qtl molecular marker for amplifying the trait of pig feed intake and application thereof

Abstract

The application discloses a specific PCR primer pair of a QTL molecular marker for amplifying and regulating pig feeding behavior and application thereof, belongs to the field of animal genetics and breeding and reproduction and livestock and poultry molecular marker assisted breeding technology, and the specific PCR primer pair comprises a first primer pair and a second primer pair; the first primer pair is targeted to a SNP site 6_3186382 of a pig chromosome 6; and the second primer pair is targeted to a SNP site 6_6674972 of the pig chromosome 6. The application can amplify the corresponding core SNP sites of the QTL molecular marker respectively, and then uses the same to prepare a PCR kit, adopts a feeding behavior directional breeding scheme of an advantageous genotype screening, adapts to the production and use requirements of an Inner Mongolia large-scale pig core breeding farm, and realizes directional breeding of the feeding behavior.

Description

Technical Field

[0001] This invention belongs to the fields of animal genetics, breeding and reproduction, and molecular marker-assisted breeding of livestock and poultry, specifically involving specific PCR primer pairs for amplifying QTL molecular markers that regulate pig feed intake traits and their applications. Background Technology

[0002] Feed input accounts for 60%-70% of the total cost of pig farming. Duroc pigs, as the terminal sire line for three-way crossbreeding in China, have feed consumption behavior that directly determines feed conversion efficiency. Existing breeding technologies for feed consumption traits have three inherent drawbacks: 1. Traditional phenotypic determination relies on continuous monitoring for more than 30 days using Velos electronic feeding stations. The overall cost of equipment purchase, dedicated pen support, and manual recording of feeding is high. Moreover, effective determination can only be carried out in the mid-to-late growth stage of pigs weighing 50-100kg. It is impossible to screen superior feed-eating individuals in advance for weaned piglets aged 25-30 days. The generation interval of breeding is long, which limits the speed of genetic improvement of the population.

[0003] 2. Existing literature only reports on single feeding-related functional genes in a scattered manner, and there are no dual-linked QTL markers, making it impossible to simultaneously target and improve two core feeding indicators: average daily feeding time and single feeding rate. In particular, Duroc, Large White, and Long White exhibit stable genetic differentiation in feeding behavior: Large White "feeds frequently but in small amounts", Long White "feeds rapidly", and Duroc "feeds frequently but in small amounts". However, current technology lacks supporting molecular typing techniques to achieve early screening of this feeding phenotype.

[0004] 3. Many national-level core pig breeding farms in Inner Mongolia Autonomous Region lack a complete set of molecular typing technologies for weaned piglets that are suitable for local standardized breeding groups and can be implemented in low-cost grassroots laboratories. Existing testing solutions rely on large-scale high-throughput sequencing equipment, which has high barriers to promotion and restricts the development of targeted breeding of feed-saving Duroc paternal lines. Summary of the Invention

[0005] In view of this, the purpose of this invention is to overcome the shortcomings of existing related technologies and provide a specific PCR primer pair for amplifying QTL molecular markers that regulate pig feeding traits and its application, enabling the amplification of major QTL intervals and corresponding core SNP sites that regulate Duroc's average daily feeding time and average feeding rate; and then using the PCR kit made from it, a feeding behavior-oriented breeding program with dominant genotype screening can be adopted to meet the production and use needs of large-scale pig breeding farms in Inner Mongolia, and realize feeding behavior-oriented selection and breeding.

[0006] To achieve the above objectives, the present invention provides specific PCR primer pairs for amplifying QTL molecular markers that regulate pig feeding traits (mean daily feeding time traits and mean feeding rate), including a first primer pair and a second primer pair; The first primer pair targets the SNP site 6_3186382 on chromosome 6 of the pig reference genome Sscrofa11.1. This SNP site is associated with regulating the average daily feeding time trait in Duroc pigs. Upstream F1: 5'-CCTCTTGTCCTCTGAGCCTT-3', downstream R1: 5'-CAACACAGGCGGATGGATAC-3', and the amplification product is 217bp in length. The second primer pair targets the SNP site 6_6674972 on chromosome 6 of the pig reference genome Sscrofa11.1. This SNP site is associated with regulating the average feed intake rate trait in Duroc pigs. The upstream F2 is 5'-TCTCCCATCACCTACTGCAC-3', and the downstream R2 is 5'-CTTGCCAGTTCCCCATTCAC-3'. The amplified product is 249 bp in length.

[0007] In the preferred embodiment, the QTL molecular markers regulating the average daily feeding time and feeding rate in Duroc pigs comprise two consecutive physical regions of chromosome 6: The first QTL interval is SSC63.18Mb-3.23Mb. The core SNP site within the interval is 6_3186382, with an allelic mutation type of T / G. The SNP molecular marker nucleotide sequence is: CCTGCTCCCGCCTGGCTTTG [G / T]GGAGGTAGGCCCCAGGTCTC. The candidate gene for the interval is COX4I1. The second QTL interval is SSC66.67Mb-6.84Mb. The core SNP site within the interval is 6_6674972, with an allelic mutation type of C / T. The SNP molecular marker nucleotide sequence is: CTCCAGGCCAAGCTGGTCCA [C / T]GGAACTGCAGGGCTCAGCGC. The candidate gene for the interval's function is CMIP.

[0008] In the preferred technical solution, SNP locus 6_3186382 contains three genotypes: GG, TG, and TT; its full length is 41 bp; the corresponding genomic location is: Sscrofa11.1, chromosome 6, 3186362–3186402; the 21st base is an SNP locus, exhibiting G / T polymorphism. The reference genome (Sscrofa11.1) has G at this position, which mutates to T. SNP locus 6_6674972 contains three genotypes: CC, CT, and TT; its full length is 41 bp; the corresponding genomic location is: Sscrofa11.1, chromosome 6, 6674952–6674992; the 21st base is an SNP locus, exhibiting C / T polymorphism. The reference genome (Sscrofa11.1) has C at this position, which mutates to T.

[0009] Another object of the present invention is to provide a PCR kit for detecting the genotype of SNP sites, comprising specific PCR primer pairs, PCR premix, porcine ear tissue genomic DNA extract, 70% washing ethanol, positive control Duroc porcine DNA template, and sterile negative control aqueous solution; wherein the PCR premix comprises Taq DNA polymerase, deoxyribonucleoside triphosphate (dNTP), and magnesium ion buffer.

[0010] Another object of the present invention is to provide a genotype detection method for a PCR kit, comprising the following steps: Step S1: Collect a small amount of ear tissue samples from Duroc weaned piglets aged 25-30 days; Step S2: Extract and purify genomic DNA from the sample, and detect the DNA UV absorbance ratio OD260 / 280; Step S3: Use two sets of specific PCR primer pairs from the PCR kit to independently perform PCR amplification for each of the two SNP sites; Step S4: The amplified products are sequenced using the dideoxy chain termination method to determine the genotypes of individual SNP loci 6_3186382 and SNP loci 6_6674972.

[0011] Another object of the present invention is to provide the application of QTL molecular markers in targeted molecular selection, which includes the following steps: Step S1: Collect a small amount of ear tissue samples from Duroc weaned piglets aged 25-30 days; Step S2: Extract and purify genomic DNA from the sample, and detect the DNA UV absorbance ratio OD260 / 280; Step S3: Use two sets of specific PCR primer pairs from the PCR kit to independently perform PCR amplification for each of the two SNP sites; Step S4: The amplified products are sequenced using the dideoxy chain termination method to determine the genotypes of individual SNP loci 6_3186382 and SNP loci 6_6674972.

[0012] Step S5: Select individuals carrying both the 6_3186382GG genotype and the 6_6674972CC genotype to form a breeding population.

[0013] The present invention, by adopting the above technical solution, has at least the following beneficial effects: (1) The provided QTL intervals, corresponding SNP molecular markers, specific PCR amplification primers, and integrated genotyping kits for the two segments of the SSC6 chromosome that regulate the average daily feeding time (ATPD) and average feeding rate (AFR), respectively, are disclosed. A genotyping method based on a small amount of ear tissue DNA from weaned piglets and its application in targeted breeding based on feeding behavior are also disclosed. The two target QTL intervals are SSC63.18–3.23Mb and SSC66.67–6.84Mb, with core SNPs 6_3186382 (T / G) and 6_6674972 (C / T) respectively. The candidate genes for interval function are COX4I1 and CMIP, respectively. This invention eliminates the need for long-term testing at electronic feeding stations for more than 30 days during the 50-100kg stage; genotyping can be completed with only 25-30 day old weaned piglets. It allows for targeted screening of Duroc individuals with the "few feedings, frequent feedings" characteristic, and is suitable for the selection of feed-saving terminal paternal lines in large-scale pig breeding farms in Inner Mongolia.

[0014] (2) The primer pairs of the present invention use the upstream and downstream genomic flanking sequences of the target SNP as templates, and are screened by gradient PCR amplification and verified by Sanger sequencing. The amplification bands are single and the genotyping peaks are clear and stable.

[0015] (3) By using the present invention, the detection node can be moved forward to the stage of piglets aged 25 to 30 days after weaning, eliminating the need for continuous measurement at electronic feeding stations for more than 30 days during the mid-to-late growth stage of 50 to 100 kg, shortening the generation interval of breeding by 1 / 3, and greatly reducing the investment in pig farm pens, equipment, and manual measurement.

[0016] (4) The molecular marker association of the present invention has high reliability: SNP6_3186382 association P=8.31×10⁻ 8 The association between SNP6_6674972 and P=6.45×10⁻ 8 Both markers reached the genome-wide reference significance level; the heritability range of the two feeding behavior traits, ATPD and AFR, was 0.35-0.48, which are considered to be medium- to high-heritable traits.

[0017] (5) Quantifiable indicators improved by population selection: The average feed conversion ratio (FCR) of the GG+CC double homozygous genotype population was 2.38, and the average of the other mixed genotype populations was 2.51. After two generations of targeted breeding, the average number of feedings per day decreased by 18.6%, and the single feeding rate decreased by 12.4%. The frequency of the G allele in the population increased from 0.32 in the basic population to 0.76, and the frequency of the C allele increased from 0.35 in the basic population to 0.79. The proportion of highly efficient feeders in the population increased by 68%.

[0018] (6) Low threshold for implementation at the grassroots level: The complete typing process can be completed with only conventional PCR instruments and Sanger sequencing equipment, without the need for large-scale high-throughput sequencing platforms, making it suitable for use in supporting laboratories of small and medium-sized pig farms in Inner Mongolia.

[0019] (7) Targeted breeding of Duroc individuals with low feed consumption can alleviate the pressure of competition between humans and livestock for food, while reducing nitrogen pollutant emissions from livestock manure.

[0020] In summary, this invention is universally applicable and convenient, and can be used for mainstream pig breeds such as Duroc, Large White, and Landrace. It can be directly used for the breeding of feed-saving pigs, helping the pig industry to reduce costs, increase efficiency, and achieve green development. Attached Figure Description

[0021] Figure 1 The images show the Manhattan diagram and QQ diagram of the feeding behavior traits in Example 1.

[0022] Figure 2 This is a diagram showing the diurnal variation of single feeding behavior in Duroc, Large White, and Landrace pigs in Example 1.

[0023] Figure 3 This is an association analysis of different genotypes at the 6_3186382 locus in pigs with the average daily feed intake time pattern in Example 1.

[0024] Figure 4 This is an association analysis of different genotypes at the 6_6674972 locus in pigs with the average feed intake rate phenotype in Example 2. Detailed Implementation

[0025] Exemplary embodiments will now be described in detail, examples of which are illustrated in the accompanying drawings. When the following description relates to the drawings, unless otherwise indicated, the same numerals in different drawings denote the same or similar elements. The embodiments described in the following exemplary embodiments do not represent all embodiments consistent with the present invention. Rather, they are merely examples of apparatuses and methods consistent with some aspects of the invention as detailed in the appended claims.

[0026] The relevant terms used in this invention are explained as follows: Example 1: Association Validation of SSC6QTL with Double SNP Population GWAS This embodiment mainly studies: the major QTL intervals of the average daily feed intake time trait ATPD and the average feed intake rate trait AFR in Duroc pigs regulated by two SSC6 chromosome segments, SNP molecular markers, specific PCR amplification primers, genotyping kits, as well as the standardized operation method for genotyping based on a small amount of ear tissue DNA from weaned piglets, and the application of feed intake behavior-oriented breeding.

[0027] 1. Source and size of the experimental animal population: The experimental population consisted of Duroc boars raised in a standardized manner at the Chifeng National Pig Core Breeding Farm in Inner Mongolia, with a total sample size of 2,841 heads. All individuals were transferred to the Velos testing station at a uniform weight of 40kg, and their feed intake and growth phenotypes (ADFI, ADG, ATPD, ANVD, ATPV, AFPV, and AFR) were collected during the 50-100kg period.

[0028] 2. Pretreatment to ensure complete feed phenotype ① Merge multiple fragmented feeding records from electronic feeding stations; ② Remove abnormal feeding data; (single feeding duration <1s or >30min; single feeding amount is negative; single feeding amount exceeds the physiological upper limit of a single pig's single feeding (>3.5kg); multiple feeding records with completely overlapping timestamps at the same time point; feeding start and end times are reversed (end time is earlier than start time); the total number of daily feeding records for an individual is 0, with no feeding behavior data; the total daily feeding amount is <0.2kg, with no effective feeding; the total daily feeding amount is >12kg, exceeding the physiological upper limit of Duroc boars for this stage; original feeding records marked abnormally by the equipment fault flag field; paired data rows with missing weight but existing feeding records; equipment repeated acquisition noise: 3 or more independent feeding records generated by the same pig within the same minute.) ③ Use robust regression models to identify outlier samples with abnormal weight; ④ Use linear interpolation to fill in the missing weight data for each age group; ⑤ A fixed-effects model with single-feed intake correction was used: FI = β0 + β1BW + β2T + β3BW × T + e The meanings of each letter in the above model are as follows: FI: Corrected single feed intake; β0: Model intercept, a fixed constant term; β1: Regression coefficient corresponding to body weight (BW); BW: Live weight of the pig on the day of birth; β2: The regression coefficient corresponding to the age T in days; T: Number of days (age) of pigs kept at the feeding station; β3: Regression coefficient of the interaction term between body weight and age; BW×T: Interaction term between body weight and age; e: Model stochastic residuals, representing individual random errors.

[0029] 3. Genotyping, filling and quality control: 50K microarray, with 193 Duroc WGS data as the filling reference panel, and Beaglev 5.2.2 software was used for filling; the quality control thresholds were R² > 0.9 and MAF > 0.05, and finally 6,235,124 valid SNP markers were obtained for GWAS analysis.

[0030] 4. GWAS Analysis Model and Threshold Setting: A GEMMAv1.93.3 linear mixture model was used, with the principal components of the top three genomes in the population PCA as fixed effects to correct for population stratification; the significance threshold for whole-genome analysis was uniformly set at P=5×10⁻. 8 The target traits analyzed were ATPD and AFR.

[0031] 5. Corresponding quantitative experimental observation results: The genetic correlation between ANVD (average number of feedings per day) and AFPV (feed intake per feeding) ranged from -0.83 to -0.95, showing a strong negative correlation; the genetic correlation between RFI (remaining feed intake) and ATPD (average daily feeding time or average daily feeding time trait) ranged from 0.31 to 0.43, showing a significant positive correlation.

[0032] like Figure 1 The graph shows: (a) average total daily feeding time; (b) average daily feeding frequency; (c) average feeding time per feeding; (d) average feeding amount per feeding; and (e) average feeding rate. The left side is the Manhattan plot, and the right side is the corresponding QQ plot, used to assess population stratification and model reliability. The red and blue lines represent genome-wide significance (P < 5 × 10⁻⁸) and genome-wide reference significance (P < 5 × 10⁻⁶), respectively. It can be seen that the -log10(P) values ​​for both intervals on chromosome SSC6 exceed the blue genome-wide reference significance line; the association P for SNP6_3186382 is 8.31 × 10⁻⁸. 8 The association between SNP6_6674972 and P=6.45×10⁻ 8 Both loci reached the blue genome-wide reference significance level.

[0033] like Figure 2 As shown: (a) average duration of each feeding session (TPV); (b) average feed intake per feeding session (FPV); (c) average feed rate per feeding session (FR) represent their changes over time. It can be seen that throughout the entire 24-hour period, the average TPV of Duroc pigs and the average FPV of feed intake per feeding session are generally higher than those of Large White and Landrace pigs, which directly confirms the "few feedings, many feedings" feeding characteristics of the Duroc breed; the peak FR of Landrace pigs throughout the day is significantly higher than that of the other two breeds, while Large White pigs exhibit low feed intake per feeding session and high feeding frequency.

[0034] like Figure 3The association analysis results between mutation site 6_3186382 and the ATPD trait are shown below. Genotypic and phenotypic association analysis was performed on the target mutation site 6_3186382 and the ATPD trait in a Duroc population (sample size N = 2,841). The results showed that individuals with different genotypes at this mutation site exhibited extremely significant differences in the ATPD phenotype (ANOVA p = 4.17 × 10⁻¹³), indicating a clear additive genetic effect. Specific phenotypic data are as follows: GG genotype: 1,395 individuals, mean ATPD phenotype 66.17 ± 0.28, median 65.34; TG genotype (heterozygous): 1,202 individuals, mean ATPD phenotype 63.65 ± 0.30, median 62.92; TT genotype: 244 individuals, mean ATPD phenotype 61.87 ± 0.64, median 61.19. With the mutation from G to T alleles, the ATPD phenotype of individuals showed a decreasing trend (GG>TG>TT). Specifically, the ATPD of GG homozygotes was significantly higher than that of TT homozygotes (mean approximately 4.31 units higher), indicating that the G allele is the effector allele increasing ATPD, while the T allele is the effector allele decreasing ATPD. These results confirm that the genotypes described in the claims can clearly reflect and regulate the feeding trait.

[0035] like Figure 4As shown, the results of association analysis between the mutation site 6_6674972 and the AFR trait: Genotype-phenotype association analysis was performed for the target mutation site 6_6674972 with the feed intake trait FR in a Duroc population (sample size N = 2,841). The results showed that individuals with different genotypes at this site exhibited significant inter-group differences in the FR phenotype (ANOVA p = 9.58 × 10-4), and a clear additive gene effect was presented. The specific phenotypic data are as follows: CC genotype: the number of individuals is 675, the mean AFR phenotype is 0.037181±0.000240, and the median is 0.036901; CT genotype (heterozygote): the number of individuals is 1,458, the mean AFR phenotype is 0.037748±0.000161, and the median is 0.037151; TT genotype: the number of individuals is 708, the mean AFR phenotype is 0.038438±0.000248, and the median is 0.038128. As the allele C mutates to T, the AFR phenotypic value of individuals shows a gradually increasing trend (CC<CT<TT). Among them, the mean AFR phenotype of TT homozygotes is increased by about 3.38% compared with CC homozygotes (the absolute difference is 0.001257), indicating that the T allele is an effect allele that increases the AFR phenotype, and the C allele is an effect allele that reduces AFR. The results of this quantitative analysis further confirm the practical value of this mutation site in marking and selecting traits related to pig feeding behavior.

[0036] 6. Statistical data of population phenotypic grouping: The total test sample consists of 1200 weaned Duroc boars, the average FCR of the GG+CC double homozygous genotype population is 2.38, the average FCR of the TG / TT mixed genotype population is 2.51, and the phenotypic difference between the two groups is extremely significant.

[0037] Further, the procedures for DNA extraction from ear tissue of weaned piglets, independent two-locus PCR, and Sanger sequencing genotyping are as follows: 1. Complete standardized operation steps for genomic DNA extraction from ear tissue: ① Sampling: Cut 0.2 cm² of ear tissue from a 25 to 30-day-old weaned piglet, and place it in a 1.5 mL sterile centrifuge tube; ② Lysis: Add 500 μL of DNA lysis solution provided with the kit, perform lysis in a 55°C constant-temperature water bath for 30 min, and invert and mix the centrifuge tube once every 10 min; ③ Rough separation: Perform high-speed centrifugation at 12000 r / min for 10 min, and carefully draw 400 μL of the clear supernatant from the upper layer and transfer it to a brand new sterile centrifuge tube; ④ Nucleic acid precipitation: Add an equal volume of pre-cooled isopropanol, gently invert and mix, and let stand at -20°C for 15 min to complete DNA precipitation; ⑤ Washing and purification: Centrifuge at 12000r / min for 8min and discard the supernatant. Wash the precipitate twice with 70% anhydrous ethanol, and let it stand for 5min each time. ⑥ Drying and dissolving: Invert and air dry at room temperature for 10 minutes to remove residual ethanol, then add 50 μL of sterile ultrapure water to fully dissolve the DNA; ⑦ Purity screening: The OD260 / 280 ratio was measured using a UV spectrophotometer, and only qualified DNA in the range of 1.8~2.0 was retained for PCR amplification.

[0038] 2. Standard 20μL single-tube PCR reaction system (two sites are prepared separately and independently): 10 μL of concentrated PCR reaction premix containing Taq DNA polymerase, dNTPs, and a magnesium ion buffer system; 0.5 μL of upstream primer corresponding to the site; 0.5 μL of downstream primer corresponding to the site; 2 μL of purified template DNA; and sterile ultrapure water to bring the total volume to 20 μL.

[0039] 3. Standardized PCR thermal cycling amplification program: Pre-denaturation at 95℃ for 5 minutes; Cyclic phase: 95℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 40s, for a total of 35 cycles; Final extension: 72℃ constant temperature for 5 minutes.

[0040] 4. Sequencing and genotyping verification experiment: 300 amplified PCR products from piglets were randomly selected for parallel repeat Sanger sequencing (dideoxy chain termination DNA sequencing) for genotyping. The genotype matching rate was 99.9%.

[0041] Application Example: Targeted Breeding of Feed Consumption Traits in Large-Scale Pig Farms in Inner Mongolia 1. Experimental materials: 28-day-old weaned Duroc boars from the Chifeng National Pig Breeding Farm in Inner Mongolia, with a total sample size of 1200 heads, under standardized basic diet and standardized pen feeding and management conditions.

[0042] 2. Complete breeding operation process: ① A small amount of ear tissue was collected from all experimental piglets, and DNA extraction, dual-site independent PCR amplification, Sanger sequencing and genotyping were completed strictly according to Example 2; ② Individuals carrying both the homozygous genotypes 6_3186382GG and 6_6674972CC were selected and formed into an independent core breeding group; the remaining mixed genotype piglets were set up as a control group and raised in the same environment. ③ Both groups were fed together until they reached 100kg slaughter weight, and all feeding behaviors and feed efficiency indicators were fully measured. ④ Two consecutive generations of targeted breeding were carried out, and the process of ear tissue sampling, typing, and selection of dominant individuals for breeding was repeated every year.

[0043] 3. Quantitative observation data from two generations of selective breeding: After the first generation of targeted breeding was completed, the average number of times the population ate per day decreased by 18.6%, the rate of feeding per feeding decreased by 12.4%, and the overall feed conversion ratio of the population decreased from 2.42 to 2.31. After two generations of breeding, the frequency of the dominant G allele increased from 0.32 in the basic population to 0.76, and the frequency of the dominant C allele increased from 0.35 in the basic population to 0.79. The proportion of individuals with the dominant GG+CC haplotype who feed efficiently increased by 68%.

[0044] Example 2

[0045] 1. Experimental population basis: All experimental animals were obtained from the 2020-2024 batches of breeding boars from the Chifeng National Pig Core Breeding Farm in Inner Mongolia, with a total sample size of 9705 heads; including 3097 Duroc, 3871 Large White, and 2737 Landrace. All pigs were fed a standardized diet and managed in a standardized manner. At 40kg / 90 days of age, they were transferred to the Velos electronic feed intake measurement station. Invalid feed intake records during the first 3 days of environmental adaptation were uniformly removed, and only individuals with a valid measurement period of ≥30 days were included in the subsequent phenotypic analysis.

[0046] 2. Feed intake phenotype collection and standardized quality control process: A total of 5,966,889 original feed intake records were collected from the electronic feeding station; an error judgment standard for abnormal feed intake was established, and the specific abnormal original data are as follows: ① Single feeding duration < 1 second or > 30 minutes; ② Single feeding amount is negative; ③ Single feeding amount exceeds the physiological upper limit of a single pig's single feeding (> 3.5 kg); ④ Multiple feeding records at the same time point have completely overlapping timestamps; ⑤ Feeding start and end times are reversed (end time is earlier than start time); ⑥ The total number of daily feeding records for an individual is 0, with no feeding behavior data; ⑦ Daily total feeding amount < 0.2 kg, with no effective feeding; ⑧ Daily total feeding amount > 12 kg, exceeding the physiological upper limit of Duroc boars' feeding at this stage; ⑨ Original feeding records with abnormal markings in the equipment fault flag field; ⑩ Paired data rows with missing weight but existing feeding records; ⑪ Three or more independent feeding records are generated for the same pig within the same minute (equipment duplicate acquisition noise).

[0047] Multiple fragmented feeding records were merged. Then, a single-feed intake correction fixed-effects model was used to correct phenotypic bias. The model formula is FI=β0+β1BW+β2T+β3BW×T+e. In the model, BW is the fixed covariate of individual weight during the measurement phase, T is the fixed effect of age on the day of feeding, BW×T is the fixed effect of the interaction between weight and age, β0 is the model intercept, and e is the random residual. The GLM least squares method using SAS software was used to eliminate systematic environmental interference from weight and age to obtain the standardized corrected single-feed intake. A robust regression model was then used to identify outlier samples with abnormal weight, and linear interpolation was used to fill in the missing weight data for each age. After unified quality control correction, the total error rate of the Duroc original feeding data was 5.198%, Large White 3.608%, and Long White 3.872%, all of which were below the set quality control threshold of 5.20%.

[0048] 3. Genotyping and Filling: All 9705 experimental boars were genotyped using the KPSPorcineBreedingChipplus50KSNP chip. Sex chromosomes and markers with unknown chromosome positions were uniformly removed, and 45852 valid autosomal markers were retained after quality control. Genotyping was performed on 2841 Duroc boars, and a filling reference panel was constructed using WGS sequencing data from 193 Duroc boars (the average sequencing depth of this population was 16.6×). Genotyping was completed using Beaglev 5.2.2 software. Post-filling quality control standards were: filling accuracy R² > 0.9, minor allele frequency MAF > 0.05. Finally, 6235124 high-quality whole-genome SNPs were retained for GWAS association analysis.

[0049] 4. Genome-wide association analysis: GEMMA v1.93.3 beta was used for association analysis, and a linear mixture model was employed. The principal components of the PCA of the top three genomes in the population were used as fixed effects to correct for population stratification interference. The significance threshold for genome-wide association analysis was uniformly set at P=5×10⁻⁻⁻⁶. 8 The target traits for this association analysis were the average daily feeding time (ATPD) and the average feeding rate (AFR).

[0050] The experiment yielded the following results: two major QTL intervals related to food intake, along with their corresponding SNPs and candidate genes: QTL1: SSC 63.18Mb to 3.23Mb, core SNP marker 6_3186382, allele mutation type T / G; functional candidate gene COX4I1 within the interval; this site contains three genotypes: GG, TG, and TT.

[0051] QTL2: SSC 66.67Mb to 6.84Mb, core SNP marker 6_6674972, allele mutation type C / T; functional candidate gene CMIP within the interval; this site contains three genotypes: CC, CT, and TT.

[0052] The calculation formulas for each indicator in the above embodiments are as follows:

[0053] This refers to the total time pigs spend on feeding on average each day during the measurement period (unit: minutes / day or seconds / day).

[0054]

[0055] : No. Total time spent per day.

[0056] : Total number of days effectively measured (Days).

[0057] 2. Average daily feeding frequency (ANVD) This refers to the average number of times pigs enter the feeding station per day during the testing period (unit: times / day).

[0058]

[0059] Total Number of Visits: The cumulative number of visits during the measurement period.

[0060] : Total number of days effectively measured (Days).

[0061] 3. Average time per feeding session (ATPV) This refers to the average time a pig spends / eats each time it enters the feeding station (unit: minutes / time or seconds / time).

[0062]

[0063] Total feeding time within the measurement period.

[0064] : The total number of times the food was consumed cumulatively within the measurement period.

[0065] 4. Average Feed Volume Per Feast (AFPV) This refers to the average amount of feed consumed by pigs each time they enter the feeding station (unit: grams / time or kilograms / time).

[0066]

[0067] Total Feed Intake (g) during the measurement period.

[0068] : The total number of times the food was consumed cumulatively within the measurement period.

[0069] 5. Average Feeding Rate (AFR) This refers to the amount of feed a pig consumes per unit of time during the feeding process (unit: grams per minute, g / min).

[0070]

[0071] : Cumulative total feed intake (g) during the measurement period.

[0072] : Total feeding time (min) within the measurement period.

[0073] Regarding the mutation sites 6_3186382 and 6_6674972 in the above embodiments, the binding positions of their primers on the reference genome Sscrofa11.1, the specific locations of the SNP sites in the amplified fragment, and the complete amplicons sequences are further described below:

[0074] I. Mutation site 6_3186382 1. Primer sequence and binding site:

[0075] 2. Amplification product information Amplification product length: 217 bp Genomic range corresponding to the amplified product: chr6:3186302–3186518 (positive strand) The distance from the 3' end of the upstream primer F to the SNP site is 61 bp. The distance from the 3' end of the downstream primer R to the SNP site is 136 bp. 3. SNP locus information SNP locus: 6_3186382 Genome location: Sscrofa11.1 chr6:3186382 Allelic mutation: G / T The reference genome (Sscrofa11.1) shows G at this position, which is mutated to T. 41 bp flanking sequence: CCTGCTCCCGCCTGGCTTTG[G / T]GGAGGTAGGCCCCAGGTCTC The 41 bp flanking sequence corresponds to the following position: chr6:3186362–3186402 The position of the SNP in the 41 bp flanking sequence: position 21. SNP position in amplification product: 81st position The 41 bp flanking sequence is located at positions 61–101 in the amplification product. 4. Complete amplicon sequence (217 bp) CCTCTTGTCCTCTGAGCCTTTGCACATTCTGTTCCTGTCACCTGGCCTGCTCCCGCTTGGCCTGCTCCCGCCTGGCTTTGGGGAGGTAGGCCCCAGGTCTCCCAGGCTGGAGCAAGGACTCTCCTCTGTGCTCCTGGCCTCCGTCAGCTTCACCTGGGTCACCAGCCTCTGAGCGGGTGTGGACCCTATTTGGCCTTGTATCCATCCGCCTGTGTTG II. Mutation site 6_6674972 1. Primer sequences and binding sites

[0076] 2. Amplification product information Amplification product length: 249 bp Genomic range corresponding to the amplification product: chr6:6674844–6675092 (positive strand) The distance from the 3' end of the upstream primer F to the SNP site is 109 bp. The distance from the 3' end of the downstream primer R to the SNP site is 120 bp. 3. SNP locus information SNP locus: 6_6674972 Genome location: Sscrofa11.1 chr6:6674972 Allelic mutation: C / T The reference genome (Sscrofa11.1) has a position of C at this location, which is mutated to T. 41 bp flanking sequence: CTCCAGGCCAAGCTGGTCCA[C / T]GGAACTGCAGGGCTCAGCGC The 41 bp flanking sequence corresponds to the following position: chr6:6674952–6674992 The position of the SNP in the 41 bp flanking sequence: position 21. SNP position in amplification product: 129th position The 41 bp flanking sequence is located at positions 109–149 in the amplification product. 4. Complete amplicon sequence (249 bp) TCTCCCATCACCTACTGCACCGGCAACGCCCATCCCTGCGAGTGGGGCAGTGTCCTCCTGGGAAGCACAGCGCTTGTGGGAGCCAGAGGGGGCGGCACCTGCTGGGTTCTCCAGGCCAAGCTGGT CCATGGAACTGCAGGGCTCAGCGCAGGGCCGGAGGGAGTGGACAGCAAGGCCCCTCTACCTGGGGTGCCAGGAACCAGGGTTCTGGGGGGCAGCGGGTAATAGTGTGAATGGGTGAACTGGCAAG

[0077] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A specific PCR primer pair for amplifying QTL molecular markers regulating feed intake traits in pigs, characterized in that, Including the first primer pair and the second primer pair; The first primer pair targets the SNP site 6_3186382 on chromosome 6 of the pig reference genome Sscrofa11.

1. This SNP site is associated with regulating the average daily feeding time trait in Duroc pigs. Upstream F1: 5'-CCTCTTGTCCTCTGAGCCTT-3', downstream R1: 5'-CAACACAGGCGGATGGATAC-3', and the amplification product is 217bp in length. The second primer pair targets the SNP site 6_6674972 on chromosome 6 of the pig reference genome Sscrofa11.

1. This SNP site is associated with regulating the average feed intake rate trait in Duroc pigs. The upstream F2 is 5'-TCTCCCATCACCTACTGCAC-3', and the downstream R2 is 5'-CTTGCCAGTTCCCCATTCAC-3'. The amplified product is 249 bp in length.

2. The specific PCR primer pair according to claim 1, characterized in that, The QTL molecular markers controlling pig feed intake traits comprise two consecutive physical regions of pig chromosome 6: The first QTL interval is SSC63.18Mb-3.23Mb. The core SNP site within the interval is 6_3186382, with an allelic mutation type of T / G. The SNP molecular marker nucleotide sequence is: CCTGCTCCCGCCTGGCTTTG [G / T]GGAGGTAGGCCCCAGGTCTC. The candidate gene for the interval is COX4I1. The second QTL interval is SSC66.67Mb-6.84Mb. The core SNP site within the interval is 6_6674972, with an allelic mutation type of C / T. The SNP molecular marker nucleotide sequence is: CTCCAGGCCAAGCTGGTCCA [C / T]GGAACTGCAGGGCTCAGCGC. The candidate gene for the interval's function is CMIP.

3. The specific PCR primer pair according to claim 2, characterized in that, SNP locus 6_3186382 contains three genotypes: GG, TG, and TT; SNP locus 6_6674972 contains three genotypes: CC, CT, and TT.

4. A PCR kit for detecting the genotype of a SNP locus, characterized in that, It contains the specific PCR primer pair as described in claim 1.

5. A genotype detection method using a PCR kit, characterized in that, It includes the following steps: Step S1: Collect a small amount of ear tissue samples from Duroc weaned piglets aged 25-30 days; Step S2: Extract and purify genomic DNA from the sample, and detect the DNA UV absorbance ratio OD260 / 280; Step S3: Use two sets of specific PCR primer pairs from the PCR kit to independently perform PCR amplification for each of the two SNP sites; Step S4: The amplified products are sequenced using the dideoxy chain termination method to determine the genotypes of individual SNP loci 6_3186382 and SNP loci 6_6674972.

6. The application of QTL molecular markers in targeted molecular selection, characterized in that, It includes the following steps: Step S1: Collect a small amount of ear tissue samples from Duroc weaned piglets aged 25-30 days; Step S2: Extract and purify genomic DNA from the sample, and detect the DNA UV absorbance ratio OD260 / 280; Step S3: Use two sets of specific PCR primer pairs from the PCR kit to independently perform PCR amplification for each of the two SNP sites; Step S4: The amplified products are sequenced using the dideoxy chain termination method to determine the genotypes of individual SNP loci 6_3186382 and SNP loci 6_6674972. Step S5: Select individuals carrying both the 6_3186382GG genotype and the 6_6674972CC genotype to form a breeding population.

Images