KASP molecular markers linked to cauliflower orange ball gene and application

Abstract

The application discloses a KASP molecular marker linked with loose cauliflower orange ball genes and application, and belongs to molecular breeding technology, and specifically, the KASP molecular marker is a G to A mutation at 1,484,557 bp of cauliflower No. 8 chromosome, the KASP molecular marker corresponds to the genotype: A: A is a genotype with an orange ball phenotype, G: G and G: A are genotypes without the orange ball phenotype. Based on the marker, a kit for identifying orange ball cauliflower is developed, and through verification, the marker has a coincidence rate of 100% with white ball and orange ball phenotypes in genotype identification of 1289 single plants, the application can be effectively applied to molecular marker assisted selection breeding of loose cauliflower ball color traits, and significantly improves selection accuracy and breeding efficiency; meanwhile, the application provides an important tool and genetic basis for cloning of orange ball related genes and functional analysis.

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding of cauliflower, and relates to a KASP molecular marker linked to the orange ball gene of cauliflower and its application. Background Technology

[0002] brocoli( Brassica oleracea var. botrytis As an important vegetable crop of the Brassicaceae family, Brassica oleracea is increasingly favored by consumers for its rich nutritional value and good marketability. In recent years, with the continuous upgrading of consumer demand, colored cauliflower has received more and more attention due to its unique color and high nutritional quality. Among them, orange cauliflower, rich in carotenoids and other nutrients, not only has high edible and health benefits, but also has good prospects for development and utilization in fresh consumption, processing, and high-quality vegetable breeding.

[0003] In the development of the cauliflower industry, floret color is one of the most important characteristics determining its marketability and competitiveness. Compared with traditional white cauliflower, orange floret varieties have a novel appearance and outstanding nutritional quality, better meeting current consumer demand for functional and specialty vegetables. Carotenoids, as important fat-soluble pigments in plants, not only participate in plant growth and development and photosynthesis but are also important precursors of vitamin A for the human body. Therefore, cultivating orange cauliflower varieties with stable floret color and high carotenoid content has become an important direction in current cauliflower quality breeding.

[0004] However, the mechanism of orange flower head formation in cauliflower is quite complex, and current research on this topic is relatively limited. Existing studies mainly focus on the classic orange mutant. Or While genetic analysis of orange-flowered head mutants is important, research on key gene localization, molecular mechanism analysis, and molecular marker development for novel orange-flowered head mutants, especially those with genetic patterns different from previously reported materials, remains lacking. In molecular breeding practice, stable, accurate, and directly usable efficient molecular markers for orange-flowered head traits are still scarce, which to some extent limits the efficiency of targeted improvement of this trait.

[0005] In our previous research, we created an orange ball mutant 'K-7' from the cauliflower inbred line 'JL-137' via EMS mutagenesis. This invention uses this mutant as the main material to conduct localization of orange ball-related genes and development of linkage molecular markers. Summary of the Invention

[0006] The primary objective of this invention is to provide a molecular marker linked to the orange head gene for the orange head phenomenon in cauliflower, thus providing a new approach for screening orange head mutants.

[0007] The specific plan is as follows: The first aspect of this invention involves constructing a segregating population based on a loosely structured high-generation inbred line of cauliflower and its EMS-induced orange-head mutant for gene mapping. This process identifies chromosomal regions closely linked to the orange-head phenotype, and corresponding molecular markers are developed within these candidate regions. Furthermore, the following KASP molecular markers linked to the cauliflower orange-head gene are designed and validated targeting key single-base mutation sites of the candidate genes: a G-to-A mutation at 1,484,557 bp on cauliflower chromosome 8; A:A represents the genotype with the orange-head phenotype, while G:G and G:A represent the genotypes without the orange-head phenotype.

[0008] Another aspect of the present invention is the development of specific primers and kits for identifying and screening orange-spherical cauliflower based on the aforementioned KASP molecular marker. The specific primers designed for this mutation site are as follows: Forward primer Primer_AlleleX (OC-1): 5'-ACTCATCATACTCTCTATGAACCTG-3'; (SEQ ID NO.1); Forward primer Primer_AlleleX (OC-2): 5'-ACTCATCATACTCTCTATGAACCTA-3' (SEQ ID NO.2); Reverse primer Primer_Common: GGGACAGGGGAATCTAAACTTGAT (SEQ ID NO.3); In the preferred embodiment of the kit, primer adapters were designed for fluorescent PCR, and the 5' ends of the two forward primers were each connected to a different fluorescent adapter sequence. The 5' end of the forward primer OC-1 is linked to the FAM fluorescent adapter sequence, FAM: GAAGGTGACCAAGTTCATGCT; The 5' end of the forward primer OC-2 is ligated with a HEX fluorescent adapter sequence. The adapter sequences are as follows: HEX: GAAGGTCGGAGTCAACGGATT.

[0009] In a further optimized version of the kit, for added convenience, the kit also includes reagents required for the PCR reaction.

[0010] Another objective of this invention is to provide applications of the aforementioned molecular markers, which are beneficial for the breeding of orange-headed cauliflower materials and lay the foundation for cloning orange-headed genes and studying the molecular mechanisms of plant growth and development. Specifically: The molecular markers described are used for identification and auxiliary identification of cauliflower orange ball material.

[0011] Furthermore, the molecular markers are used for screening breeding of orange flower heads in cauliflower, especially for screening orange flower head mutants.

[0012] This invention also discloses a method for identifying loose-type orange florets of cauliflower, characterized in that the method comprises the following steps: (1) Extract genomic DNA from the cauliflower material to be tested; (2) Using the genomic DNA of the cauliflower to be tested as a template, perform PCR amplification using any of the kits described in claims 2 to 5; (3) Fluorescence detection and analysis of PCR amplification products: If the PCR product only detects the fluorescent signal corresponding to primer OC-2 with the fluorescent adapter sequence, the detection site is A:A genotype, and it is determined to have the orange ball phenotype.

[0013] If the PCR product of the sample only detects the fluorescent signal corresponding to primer OC-1 which is linked to the fluorescent adapter sequence, the detection site is the G:G genotype, and it is determined that it does not have the orange ball phenotype. If two fluorescent signals corresponding to primers OC-1 and OC-2, which are connected to fluorescent adapter sequences, are detected simultaneously, the detection site is the G:A genotype, and the material is identified as a heterozygous material that does not have the orange sphere phenotype.

[0014] The molecular markers were applied using Touchdown PCR.

[0015] Furthermore, the Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.

[0016] The material to be tested is a seed, or cauliflower tissue at different growth and development stages.

[0017] The beneficial effects of this invention are: This invention utilizes BSA-seq population mapping combined with traditional genetic linkage analysis to successfully identify a molecular marker closely linked to the orange head trait in cauliflower. The key mutation site is located at 1,484,557 bp on chromosome 8, representing a single-base mutation from G to A. We further developed the corresponding KASP molecular marker, which can be used to rapidly and accurately distinguish between the orange and white head phenotypes of cauliflower and their corresponding genotypes. This molecular marker allows for efficient screening of target plants in the early breeding stages, significantly reducing the scale of field planting and the workload of later phenotypic identification, thereby improving the accuracy of selection and the breeding process. This invention not only has significant application value for breeding practices related to the orange head trait in cauliflower but also provides valuable genetic resources for theoretical research on plant growth and development. Attached Figure Description

[0018] Figure 1 The figures show the phenotypic diagrams of the wild-type white-headed cauliflower material 'JL-137' and the orange-headed mutant 'K-7' in this invention. In the figures, A: wild-type white-headed cauliflower JL-137; B: orange-headed mutant K-7.

[0019] Figure 2 The figure shows the population mapping results for 'K-7' and 'JL-137' in this invention. In the figure, A: BSA mapping results; B: Schematic diagram of marker development and linkage mapping within the candidate region of this invention. White: White sphere; Orange: Orange sphere, Chr1-9 represent chromosome numbers, and the orange sphere gene is located at the anterior end of chromosome 8.

[0020] Figure 3 This figure shows partial results of genotyping using the molecular markers of this invention in the F2 population constructed from 'K-7' and 'JL-137'. In the figure, A: the PCR product is the fluorescence signal corresponding to primer OC-2 with a fluorescent adapter sequence, indicating a homozygous orange globulin; B: the PCR product is the fluorescence signal corresponding to primer OC-1 with a fluorescent adapter sequence, indicating a homozygous white globulin; C: the PCR product has both fluorescent signals from primers OC-1 and OC-2 with fluorescent adapter sequences, indicating a heterozygous white globulin. Detailed Implementation

[0021] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the embodiments. Unless otherwise specified, the materials, reagents, instruments and methods used in the following embodiments are all conventional materials, reagents, instruments and methods in the art, and can be obtained through commercial channels.

[0022] The cauliflower germplasm involved in the following exemplary embodiments of the present invention was provided by the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences, and can be guaranteed to be sold for at least 20 years.

[0023] Example 1: Obtaining the molecular marker linked to the cauliflower orange seed gene 1. Construction of segregated groups The high-generation inbred line of cauliflower 'JL-137' (white ball, Figure 1 A) was used as the parent plant, and its mutant 'K-7' (orange ball) was used. Figure 1 B) is the male parent. 'JL-137' and 'K-7' are crossed to obtain the F1 generation. After self-pollination of the F1 generation, the F2 population is obtained. Among them, the wild-type 'JL-137' has white flower heads, while the mutant 'K-7' has light orange flower heads and light yellow flowers.

[0024] 2. Identification of flower head color After the bulbs form, the color of the bulbs can be determined. Those that are consistent with the wild type 'JL-137' are white bulbs, and those that are consistent with the mutant 'K-7' are orange bulbs.

[0025] 3. Preliminary localization of the orange ball gene In this study, 20 white-globose (dominant phenotype) plants and 20 orange-globose (recessive phenotype) plants were selected from the F2 population constructed by JL-137×K-7. Leaves from these plants were mixed to form a white-globose pool (W-pool) and an orange-globose pool (O-pool). Five plants from each parent were used to construct parental pools, with JL-137 being dominant and K-7 recessive. Total DNA was extracted from the four pools (JL-137, K-7, W-pool, and O-pool) using the CTAB method. Libraries were constructed using the TruSeq DNA Sample Preparation kit (Illumina), and genome resequencing was performed on the Illumina NovaSeq 6000 platform. The obtained sequencing data were aligned using BWA MEM, and variant detection was performed using Samtools. The filtering conditions were: base quality value ≥30, alignment quality value ≥30, sequencing depth of parental samples ≥2 and ≤40, and sequencing depth of F2 pool samples ≥2 and ≤80. After the above screening, a total of 427,082 differentially expressed SNPs were obtained. These differentially expressed SNPs were mainly distributed in the category with an allele frequency AF=0.99, indicating that they were highly differentiated in the population. Furthermore, with a sliding window of 1 Mb and a step size of 100 kb, genomic window analysis was performed using the SNP-index of the recessive pool, and a Δ(SNP-index) distribution map was plotted.

[0026] The results showed that the Δ(SNP-index) in the white region of the whole genome was close to the background value, while in the 0-7 Mb interval of chromosome 8, the Δ(SNP-index) deviated significantly and formed a significant peak, indicating that this region was closely related to the orange flower head trait. Based on this, this region was identified as a candidate interval.

[0027] 4. Fine mapping of the orange-globulin gene To further refine the mapping of genes controlling the orange-ball trait, this study expanded the F2 population size and, based on parental resequencing data and the cauliflower reference genome C... 8 (NGDC, https: / / ngdc.cncb.ac.cn / gwhgwh / The KASP molecular marker was developed based on the alignment results of GWHBJSH00000000.

[0028] By genotyping the expanded population and identifying key exchange individuals and their phenotypes, the gene was ultimately located within the interval 1,444,345-1,551,442 bp on chromosome 8. Figure 2 B).

[0029] Further analysis of variations within the interval revealed a site at 1,484,557 bp that perfectly matched the G / C→A / T preference of EMS mutagenesis, exhibiting a G→A transition. Moreover, it was fully linked to the orange flower head phenotype in the F2 population, and this marker was named the Cau-OC marker.

[0030] 5. Development of molecular markers linked to the orange sphere gene Primers were developed based on the aforementioned Cau-OC marker. Label-specific primers were designed at both ends of the 1,484,557 bp site on chromosome 8. The 3' end of the forward primer was placed at the SNP site, i.e., the 1,484,557 bp site, to ensure that it could specifically recognize the target allele. The reverse primer was designed starting 80–120 bp downstream of the SNP site (complementary to the template strand).

[0031] The following specific primers were selected from the designed primers. Forward primer OC-1: 5'-ACTCATCATACTCTCTATGAACCTG-3'; (Seq ID No. 1) Forward primer OC-2: 5'-ACTCATCATACTCTCTATGAACCTA-3'; (Seq ID No. 2) Reverse primer Primer_Common: GGGACAGGGGAATCTAAACTTGAT. (Seq ID No. 3); To facilitate detection using fluorescent PCR, different fluorescent adapter sequences were attached to the 5' ends of the two forward primers. The 5' end of the forward primer OC-1 is ligated with a FAM fluorescent adapter sequence, FAM: GAAGGTGACCAAGTTCATGCT; (Seq ID No. 4); The 5' end of the forward primer OC-2 is ligated with a HEX fluorescent adapter sequence. The adapter sequences are as follows: HEX: GAAGGTCGGAGTCAACGGATT; (Seq ID No. 5).

[0032] Obtain primer combinations suitable for fluorescent PCR: Forward primer OC-1: GAAGGTGACCAAGTTCATGCTACTCATCATACTCTCTATGAACCTG; (Seq ID No. 6) Forward primer OC-2: GAAGGTCGGAGTCAACGGATTACTCATCATACTCTCTATGAACCTA; (Seq ID No. 7) Reverse primer Primer_Common: GGGACAGGGGAATCTAAACTTGAT. (Seq ID No. 3); The Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ per cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles. The sample to be tested was a leaf.

[0033] Genotyping was performed on 1289 individual plants from the F2 population constructed using the above-mentioned Cau-OC-labeled fluorescent PCR combination.

[0034] The results showed that the distribution of the three genotypes was as follows: 290 plants were homozygous for A:A, 692 plants were heterozygous for G:A, and 307 plants were homozygous for G:G.

[0035] Phenotypic data verification showed that the genotype and phenotype of each individual plant were completely consistent, with a concordance rate of 100%. Figure 3 ).

[0036] The flower head phenotype and genotype of the Cau-OC marker in the F2 population (partial results) are shown in Table 1.

[0037] Table 1. Flower head phenotypes and genotypes of Cau-OC markers in the F2 population (partial results)

[0038] The results above indicate that the Cau-OC marker developed in this study has good universality and accuracy, and can be effectively applied to genotype prediction, phenotypic identification, and molecular marker-assisted screening of the orange ball trait in cauliflower.

Claims

1. A KASP molecular marker linked to the loosely packed cauliflower orange ball gene, characterized in that, The KASP molecular marker is a mutation from G to A at 1,484,557 bp on chromosome 8 of cauliflower. The genotypes corresponding to the KASP molecular marker are: A:A, which is the genotype with an orange ball phenotype, and G:G and G:A, which are the genotypes without an orange ball phenotype.

2. A kit for screening or identifying loose-leaved orange cauliflower material, characterized in that, It has primers that are specific to the KASP molecular marker of claim 1.

3. The reagent kit according to claim 2, characterized in that, The specific primers are as follows: Forward primer OC-1: 5'-ACTCATCATACTCTCTATGAACCTG-3'; Forward primer OC-2: 5'-ACTCATCATACTCTCTATGAACCTA-3'; Reverse primer Primer_Common: GGGACAGGGGAATCTAAACTTGAT.

4. The reagent kit according to claim 3, characterized in that, The 5' ends of the two forward primers are also connected to different fluorescent adapter sequences; The 5' end of the forward primer OC-1 is linked to the FAM fluorescent adapter sequence, FAM: GAAGGTGACCAAGTTCATGCT; The 5' end of the forward primer OC-2 is ligated with a HEX fluorescent adapter sequence. The adapter sequences are as follows: HEX: GAAGGTCGGAGTCAACGGATT.

5. The kit according to any one of claims 2 to 4, characterized in that, It also contains reagents needed for PCR reactions.

6. The use of the kit according to any one of claims 2 to 5 in the identification or auxiliary identification of loose cauliflower orange ball material.

7. A method for identifying loose-type orange florets of cauliflower, characterized in that, The method includes the following steps: (1) Extract genomic DNA from the cauliflower material to be tested; (2) Using the genomic DNA of the cauliflower to be tested as a template, perform PCR amplification using any of the kits described in claims 2 to 5; (3) Fluorescence detection and analysis of PCR amplification products: If the PCR product only detects the fluorescent signal corresponding to primer OC-2 with the fluorescent adapter sequence, the detection site is A:A genotype, and it is determined to have the orange ball phenotype. If the PCR product of the sample only detects the fluorescent signal corresponding to primer OC-1 which is linked to the fluorescent adapter sequence, the detection site is the G:G genotype, and it is determined that it does not have the orange ball phenotype. If two fluorescent signals corresponding to primers OC-1 and OC-2, which are connected to fluorescent adapter sequences, are detected simultaneously, the detection site is the G:A genotype, and the material is identified as a heterozygous material that does not have the orange sphere phenotype.

8. The method according to claim 7, characterized in that, Touchdown PCR was used; the Touchdown PCR amplification program was as follows: 94℃ for 15 min; 95℃ for 20 s; 65℃-56℃ for 60 s, 10 cycles, with the annealing extension temperature decreasing by 0.8℃ in each cycle; 94℃ for 20 s; 57℃ for 60 s, 26 cycles.

9. The method according to claim 7 or 8, wherein the material to be tested is a seed, or cauliflower tissue at different growth and development stages.

Images