Molecular markers for salt tolerance in alfalfa and their application

Abstract

The application discloses a molecular marker for analyzing alfalfa salt tolerance and application thereof. The molecular marker comprises A1) located at a position of 53022482 on a chromosome of chr2_3; A2) located at a position of 52997021 on the chromosome of chr2_3; A3) located at a position of 30078582 on a chromosome of chr7_3; and A4) located at a position of 9483809 on a chromosome of chr4_4. The application further provides primers, probes, chips, KASP primers and kits for detecting the above molecular markers. The application can be applied to early screening, auxiliary identification and molecular breeding of salt-tolerant alfalfa, significantly accelerates the breeding process of new salt-tolerant varieties, and has a good application prospect.

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology, specifically to molecular markers for analyzing the waterlogging tolerance of alfalfa and their applications. Background Technology

[0002] Alfalfa is one of the world's most important legume forage crops, boasting high nutritional value including protein, strong adaptability, and excellent palatability, earning it the title of "King of Forages." It is a crucial high-quality feed for ruminants such as dairy cows. Alfalfa is also an important soil improver, originally growing primarily in arid or semi-arid regions of northern China. However, with climate change, frequent summer floods in northern regions in recent years have significantly impacted alfalfa growth, resulting in substantial yield reductions. Furthermore, with the development of herbivorous livestock farming in southern my country, the demand for high-protein, high-quality forage is increasing. Introducing alfalfa to southern agricultural areas can fully utilize the abundant resources of light, heat, water, and fertilizer in the south, while also eliminating transportation costs. Compared to northern regions, southern regions are more prone to flooding, and alfalfa is highly sensitive to waterlogging stress. Generally, if waterlogging occurs for more than 24 consecutive hours during the growing season, extensive root rot and pathogen proliferation will occur, leading to a severe decline in alfalfa yield, or even complete crop failure. Alfalfa has poor waterlogging tolerance. If continuous rainfall leads to waterlogging in the fields for 2-3 days, it will cause alfalfa to die under stress, resulting in almost total loss. In normal years, the Huang-Huai-Hai Plain also experiences varying degrees of yield reduction; however, increased rainfall in 2025 led to a significant reduction in alfalfa yields, and even in Inner Mongolia, alfalfa yields were severely reduced due to waterlogging. Therefore, screening and identifying superior alfalfa germplasm with strong waterlogging tolerance will greatly promote the breeding of new waterlogging-tolerant alfalfa varieties.

[0003] Molecular markers are genetic markers based on variations in the nucleotide sequence of genetic material among individuals, directly reflecting genetic polymorphism at the DNA level. Since the 1970s, molecular marker technology has undergone three generations of development, gradually evolving from a low-throughput, high-cost technical system to a high-throughput, precise analytical tool. In the 21st century, the rise of high-throughput sequencing technology has driven the development of third-generation molecular markers, the core of which is the analysis method based on single nucleotide polymorphisms (SNPs) and insertion / deletion markers (InDels). Among them, SNPs detect variations in a single base in the genome (such as C / T or A / G). SNP markers are numerous and widely distributed, making them an important tool for studying the genetic basis of complex traits, and are also applicable to molecular breeding, etc. Marker-assisted selection (MAS) has significant advantages over traditional breeding methods, particularly in germplasm resource evaluation, backcrossing and selection, trait aggregation, and early-generation selection of breeding materials (Mondioi et al., 2009). MAS technology directly identifies genetic materials through molecular markers, unaffected by environmental conditions, and can accurately screen materials carrying superior germplasm-specific molecular markers from segregating populations, significantly improving selection efficiency and shortening breeding cycles (Guo et al., 2022). KASP (Kompetitive allele-specific PCR) is a novel gene analysis technique characterized by low cost and high throughput. It uses specific matching of primer terminal bases to accurately allelicize SNPs and InDel sites, and has been widely used in marker-assisted selection of crops such as rice, wheat, and soybean. Therefore, based on the excellent alfalfa germplasm we have screened and identified, we have further developed molecular markers unique to these excellent germplasm, which will significantly accelerate the breeding process of new alfalfa varieties and shorten the breeding cycle. Summary of the Invention

[0004] The purpose of this invention is to screen and identify superior new alfalfa germplasm with strong waterlogging tolerance, and to further develop unique molecular markers for superior new alfalfa germplasm, providing new materials for the breeding of new waterlogging-tolerant alfalfa varieties, which will also significantly accelerate the breeding process of new alfalfa varieties and shorten the breeding cycle.

[0005] To achieve the objective of this invention, the technical solution provided by this invention is: the application of molecular markers A1)-A4) in the analysis of alfalfa's waterlogging tolerance. A1) Located at position 53022482 on chromosome chr2_3, its polymorphism is A / T. When the genotype of the alfalfa being tested at this position is homozygous TTTT, the alfalfa is considered to have strong waterlogging tolerance; and / or A2) is an InDel molecular marker located at position 52997021 on chromosome chr2_3. When the alfalfa to be tested is a homozygous CTGA insertion at this locus, it is determined that the alfalfa to be tested has strong waterlogging tolerance. A3) is located at position 30078582 on chromosome chr7_3, and its polymorphism is T / A. When the genotype of the alfalfa being tested at this position is homozygous AAAA, the alfalfa is considered to have strong waterlogging tolerance; and / or A4) is located at position 9483809 on chromosome chr4_4, and its polymorphism is C / T. When the genotype of the alfalfa to be tested at the above position is homozygous TTTT, the alfalfa is determined to have strong waterlogging resistance. The physical location information of the molecular markers was determined based on sequence alignment of the genome of alfalfa cultivar ZM-4_V1.0 (download link: https: / / figshare.com / s / fb4ba8e0b871007a9e6c).

[0006] Furthermore, the nucleotide sequence of the molecular marker A1 is shown in SEQ ID NO.1-SEQ ID NO.2; The nucleotide sequence of molecular marker A2 is shown in SEQ ID NO.3; The nucleotide sequences of molecular marker A3 are shown in SEQ ID NO.4-SEQ ID NO.5; The nucleotide sequences of molecular marker A4 are shown in SEQ ID NO.6-SEQ ID NO.7.

[0007] This invention also provides primers for analyzing the waterlogging tolerance of alfalfa, with nucleotide sequences as shown in SEQ ID NO. 8-SEQ ID NO. 9, or / and As shown in SEQ ID NO.10-SEQ ID NO.11, or / and As shown in SEQ ID NO.12-SEQ ID NO.13, or / and SEQ ID NO.14-SEQ ID NO.15 are shown.

[0008] The present invention also provides a molecular probe assembly for analyzing the waterlogging tolerance of alfalfa, the molecular probe assembly detecting the molecular markers in the test sample.

[0009] The present invention also provides a molecular chip for analyzing the waterlogging tolerance of alfalfa, the molecular chip comprising the above-described primers and / or the molecular probe combination described above.

[0010] The present invention also provides a KASP for analyzing the waterlogging tolerance of alfalfa, the sequence of which is shown in SEQ ID NO.16-SEQ ID NO.18, or As shown in SEQ ID NO.19-SEQ ID NO.21, or As shown in SEQ ID NO.22-SEQ ID NO.24, or SEQ ID NO.25-SEQ ID NO.27 are shown.

[0011] A kit for analyzing the waterlogging tolerance of alfalfa, comprising the primers, and / or the molecular probe combination, and / or the molecular chip, and / or the KASP.

[0012] The present invention further provides a method for analyzing the waterlogging tolerance of alfalfa, by applying the primers and / or the molecular probe combination, and / or the molecular chip, and / or the KASP, and / or the kit to detect the sample to be tested.

[0013] The present invention also provides a method for cultivating alfalfa plants with strong waterlogging tolerance, by using the primers, and / or the molecular probe combination, and / or the molecular chip, and / or the KASP, and / or the kit to detect the sample to be tested, and selecting plants with strong waterlogging tolerance for cultivation. Preferably, plants with strong waterlogging tolerance are selected from those with a homozygous TTTT genotype located at position 53022482 on chromosome cchr2_3; and / or Select plants with the CTGA homozygous genotype inserted at position 52997021 on chromosome chr2_3; and / or Select plants with the homozygous AAAA genotype located at position 30078582 on chromosome chr7_3; and / or Select plants with the homozygous TTTT genotype located at position 9483809 on chromosome chr4_4.

[0014] This invention also provides applications of the molecular markers, primers, molecular probe combinations, molecular chips, KASP, or kits in aspects B1)-B8): B1) Used for early screening of alfalfa plants with strong waterlogging tolerance; B2) Used as an auxiliary identification method for alfalfa varieties with strong waterlogging tolerance; B3) Molecular marker-assisted breeding for individuals with strong waterlogging tolerance in alfalfa; B4) Used for the identification and screening of superior germplasm of alfalfa plants with strong waterlogging tolerance; B5) Used for breeding new lines / variety of alfalfa with superior waterlogging resistance; B6) is used for genotyping and detection of alfalfa genotypes related to strong waterlogging tolerance; B7) is used to construct a molecular breeding screening system for alfalfa waterlogging tolerance traits; B8) Develop high-yield alfalfa varieties.

[0015] In summary, the present invention, employing the above-mentioned technical solution, has the following advantages and beneficial effects: The present invention has developed a specific molecular marker associated with alfalfa's waterlogging tolerance trait and successfully converted it into a KASP detection marker. Using this marker, accurate and efficient identification of waterlogging tolerance genotypes in breeding populations can be achieved, significantly accelerating the breeding process of new waterlogging-tolerant alfalfa varieties, reducing the workload of large-scale phenotypic screening experiments, and effectively shortening the breeding cycle. Molecular-assisted breeding using this molecular marker enables targeted screening of individuals with superior waterlogging tolerance, cultivating new alfalfa materials that can resist waterlogging stress and reduce yield losses due to waterlogging, possessing good industrialization prospects and economic potential; simultaneously, it provides a reliable molecular tool for research on the genetic mechanism of alfalfa waterlogging tolerance, the creation of waterlogging-tolerant germplasm, and the improvement of waterlogging tolerance traits in existing varieties. Attached Figure Description

[0016] Figure 1 The image shows the results of the phenotypic grading of alfalfa waterlogging tolerance, displaying the differences in branch survival rate of representative plants of different waterlogging tolerance levels (Level I to Level V) after waterlogging stress, which is used to assess the waterlogging tolerance of germplasm resources. Figure 2 This is a KASP genotyping clustering result for molecular marker A1 (chr2_3 chromosome position 53022482, A / T polymorphism). The horizontal axis represents FAM fluorescence signal intensity, and the vertical axis represents HEX fluorescence signal intensity. Figure 3 This is a KASP genotyping clustering result for molecular marker A2 (location 52997021 on chromosome chr2_3, CTGA InDel site). The horizontal axis represents FAM fluorescence signal intensity, and the vertical axis represents HEX fluorescence signal intensity. Figure 4 This is a KASP genotyping clustering result for molecular marker A3 (chr7_3 chromosome position 30078582, T / A polymorphism). The horizontal axis represents FAM fluorescence signal intensity, and the vertical axis represents HEX fluorescence signal intensity. Figure 5 This is a KASP genotyping clustering result for molecular marker A4 (chr4_4 chromosome position 9483809, C / T polymorphism). The horizontal axis represents FAM fluorescence signal intensity, and the vertical axis represents HEX fluorescence signal intensity. Detailed Implementation

[0017] The present invention will be further illustrated below with reference to a detailed description of specific embodiments. However, these embodiments are merely illustrative and should not be construed as limiting the invention. Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and can be referred to the third edition of the original book "Bioinformatics and Functional Genomics" or related books. The bioinformatics software and products used are also commercially available. Various processes and methods not described in detail are conventional methods known in the art. The source of materials used, trade names, and components that need to be listed are indicated upon their first appearance. Unless otherwise specified, the same reagents used thereafter are considered the same as those initially indicated.

[0018] The features and advantages described in the molecular marker section above also apply to molecular probe assemblies, gene chips, kits, and their applications based on molecular markers, and will not be repeated here.

[0019] The SNP referred to in this invention is Single Nucleotide Polymorphism, which mainly refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level. The single nucleotide variation includes variations caused by a single base conversion, transversion, insertion, or deletion.

[0020] It should be noted that the molecular markers referred to in this invention are all heritable and detectable DNA sequences or proteins, including but not limited to molecular markers based on molecular hybridization, such as RFLP and Minisatellite DNA; molecular markers based on PCR technology, such as RAPD, STS, SSR, and SCAR; DNA markers based on restriction enzyme digestion and PCR technology; molecular markers based on DNA microarray technology, such as SNP; and analytical marker technologies developed based on EST databases. The molecular markers provided by this invention can be used for genome mapping, gene localization studies, map-based gene cloning, species phylogenetics, and systematic classification.

[0021] Example 1: Obtaining Molecular Markers To screen and identify superior germplasm with strong waterlogging tolerance, we selected 122 individual alfalfa plants with good waterlogging tolerance in the laboratory. These plants were transplanted to the field in September 2024. After waterlogging stress in 2025, 16.39% of the plants showed strong waterlogging tolerance (Level V), and six of these plants exhibited very strong waterlogging tolerance without showing obvious stress symptoms. The waterlogging tolerance grading is shown in Table 1. The five levels of waterlogging tolerance for alfalfa are shown below. Figure 1 As shown.

[0022] Table 1

[0023] New alfalfa germplasm with strong waterlogging tolerance can effectively resist waterlogging disasters and significantly reduce the impact of waterlogging on alfalfa yield, thus possessing great economic potential. As an excellent new waterlogging-tolerant germplasm, it lays the material foundation for the breeding of new waterlogging-tolerant alfalfa varieties; it can also be used as breeding parent material for the improvement of other varieties.

[0024] Based on the newly identified waterlogged-tolerant alfalfa germplasm, we further developed unique molecular markers for this new germplasm. We selected 350 alfalfa germplasm resources and 6 waterlogged-tolerant alfalfa germplasm resources, and extracted DNA. After the DNA passed the tests, fragments of 350 bp in length were randomly fragmented using a Covaris instrument. Library construction was performed using the TruSeq Library Construction Kit (strictly using the reagents and consumables recommended in the instructions). The DNA fragments underwent end repair, polyA tailing, sequencing adapter addition, purification, and PCR amplification to complete the entire library preparation. The raw data obtained from Illumina sequencing is called Raw Reads, which contain sequencing sequences (reads) and their corresponding sequencing quality information. Quality control was performed using the default parameters of FASTP to filter out unqualified reads, and the resulting clean reads were used for subsequent analysis. Based on the clean reads, we used Sentieon software (parameters "bwa mem -k 32 -M -R") to perform reference genome alignment analysis, and the alignment results were sorted and deduplicated using Samtools. Sentieon was used to detect SNPs and InDels. Then, ANNOVAR software was used to annotate the SNP sites, determining the regions of the variant sites on the genome and the mutation types. Finally, the resequencing data from 350 alfalfa germplasms were 15 times the genome size, with a total of 8,809,449 SNPs and 962,558 InDels annotated.

[0025] Bioinformatics analysis was performed to compare the SNPs and InDels of a new water-tolerant alfalfa germplasm No. 1 (hereinafter referred to as Water-Tolerant No. 1) with those of 355 other alfalfa accessions. The results showed that Water-Tolerant No. 1 had 543 SNPs and 7 InDels; Water-Tolerant No. 2 (hereinafter referred to as Water-Tolerant No. 2) had 541 SNPs and 5 InDels; Water-Tolerant No. 3 (hereinafter referred to as Water-Tolerant No. 3) had 430 SNPs and 6 InDels; Water-Tolerant No. 4 (hereinafter referred to as Water-Tolerant No. 4) had 505 SNPs and 4 InDels; and Water-Tolerant No. 5 (hereinafter referred to as Water-Tolerant No. 5) had 457 SNPs and 4 InDels. The specific molecular markers of the new alfalfa germplasm 6 (hereinafter referred to as 6-water-resistant alfalfa) are 330 SNPs and 6 InDels.

[0026] Based on the genome resequencing analysis results, we selected one SNP and two InDels from the 'NaiZi 1' genome and designed the following primers:

[0027] The primers for the 15 SNPs and 3 InDels of the stain-resistant No. 2 are designed as follows:

[0028]

[0029] The primers for the 5 SNPs and 5 InDels of the stain-resistant No. 3 are designed as follows:

[0030]

[0031] The primers for the stain-resistant No. 4 primer (15 SNPs and 3 InDels) are designed as follows:

[0032]

[0033] The primers for the stain-resistant No. 5 primer, which contains 6 SNPs and 3 InDels, are designed as follows:

[0034] The primers for the stain-resistant No. 6 primer, which has 10 SNPs and 4 InDels, are designed as follows:

[0035]

[0036]

[0037] After high-fidelity enzyme PCR (system as shown below), the DNA was extracted by 1.0% agarose gel electrophoresis under UV light and then recovered via sol-gel extraction. The recovery procedure follows the instructions from Bomeide Biotechnology's kit, using 30 μL of water to dissolve and recover the DNA. The recovered DNA was ligated to the T vector using Bomeide Biotechnology's pBM16A Toposmart Cloning Kit, following the manufacturer's instructions. 5-10 μL of the ligation product was transformed into competent *E. coli* cells, plated on penicillin-resistant LB agar plates, and incubated overnight at 37°C inverted for plaque PCR identification. PCR-positive clones were then sequenced.

[0038] The PCR system and procedure are as follows:

[0039] T-vector cloning and sequencing confirmed that one SNP of the 'Naizi 1' strain was homozygous and unique to it (corresponding primer A1_35-2-F / R); 14 clones located at position 53022482 (double-underlined position) on chromosome chr2_3 were all T-vectors. Cloning and sequencing of the other two sites showed that they were heterozygous; therefore, we believe that these two sites are not unique InDels sites of the 'Naizi 1' strain. The nucleotide sequences of this site (SEQ ID NO.1, SEQ ID NO.2): Chr2_3 195bp (single underscore indicates primer position) TCCAAACCCACCTCAACCCT AAGGCCAAAACTACCTCAAAAGCCAAAACTCTCTTCCAACATCATCCACTGCAGC A / T CAAACCAAAAAAACACACCAAACCAAGAAAAACCAACCAACGATGTAAACTCAAATCTAAAAGCATTCTCAGCAGCACTAGCACTCTCATCAATCCTCA TCTCATCACCACTCCCCGCT .

[0040] We selected 15 SNPs and 3 InDels from the 'NaiZi 2' gene and designed primers for T-vector cloning and sequencing. This confirmed that all 18 sites, including the 15 SNPs and 3 InDels from 'NaiZi 2', were non-homozygous sites. Therefore, we believe these 18 sites are not unique InDels sites of 'NaiZi 1'. No sites unique to 'NaiZi 2' were identified.

[0041] T-vector cloning and sequencing confirmed that one InDel site of the 'Naizi 3' gene was homozygous and unique to it (corresponding primer A3_17-2-F / R); 11 clones located at position 52997021 (double-underlined position) on chromosome chr2_3 were all CTGA. Sequencing of the other 9 clones showed that they were all non-homozygous sites; therefore, we believe that these 9 sites are not unique SNPs or InDels sites of the 'Naizi 3' gene. The nucleotide sequence of this InDel molecular marker is as follows (SEQ ID NO.3): Chr2_3 672bp (Underlined text indicates primer position) AGGGTTCGGGTGCACAATGG CCCTTCTCCAACAAAGTATCTGCTGCTCAACCACATTTGATGTCTTTTGAGGTTTCTCAAGATGATAATACAAAGATCTTATCTGATCCCATAACATCTGCTGGTTTTATGACTCCAGACGCATTTGACTCTAGTAAAAAACTCTCTGCTG CTGA ACCTCAGGTTTGATGCTACCCTTTCGGTGCTGTTTAGGCTTTAAATTTTGATACAACATCAGTGTATTTTTTTTTACATAGTTACACTGTCAACAAATCATCAATCATATGTATCGTTTTTAATGATCGACGGTTATGATGGATTGACAGTGTAACTTTTTTTACATTGAGGGTGTATATGAATTAAATCGTTAACTTAAAGTAAAATAAGTTTATGAACATGTAACATTTGGATGAT CCAGGTGTGTTCTAACTTCTAACTTCTAATCTGTTTGGGTATTCTAATTTTAAGTCAACTTTGTTTGTAGCATACTAATAAATCCTCAAATTAAAATAAAAATAATTACAAGTTGTTTTGCAATATCTCATATCTTAATATACAATATCTTACATTCAATACACATCAGCTGATGACTTTTTGCCTTTCCCTTCCTTCTATTGATTGTTTGTCATTACTGTTTAGAAATCTTTCAATCATGA TGGGCAAGGTGGCTTTCACT .

[0042] We selected 15 SNPs and 3 InDels from Naizhe 4, designed primers for T-vector cloning and sequencing, and confirmed that 18 sites, including the 15 SNPs and 3 InDels from Naizhe 2, were non-homozygous sites. Therefore, we believe that these 18 sites are not unique InDels sites of Naizhe 1. No sites unique to Naizhe 4 were identified.

[0043] T-vector cloning and sequencing confirmed that one SNP from the 'Naizi 5' strain was homozygous and unique to it (corresponding to primer 4-7-582-F / R); 14 clones located at position 30078582 (double-strike position) on chromosome chr7_3 were all A. Sequencing of the other 8 clones showed that they were all non-homozygous; therefore, we believe that these 8 sites are not unique SNPs or InDels sites of 'Naizi 5'. The nucleotide sequence of this SNP molecular marker is as follows (SEQ ID NO.4, SEQ ID NO.5): Chr7_3 131bp (Underlined text indicates primer position) GGGTTGCAGCCTAGACAAATTGC TATATGGTTTCAGAATAGAAGAGCAAGATGCAAAACAAAGGAACTTGAGAA T / A GAATATGAAGTCCTCAAGAAGAAATTTGAA GCTGTCAAGGATGAAAATGATGCACT .

[0044] T-vector cloning and sequencing confirmed that one SNP in *Nystatin 6* was homozygous and unique to it (corresponding to primer 4-20-809-F / R); 13 clones located at position 9483809 (double-strike position) on chromosome chr4_4 were all T-vectors. Sequencing of the other 13 clones showed that they were all non-homozygous. Therefore, we believe that these 13 sites are not unique SNPs or InDels sites of *Nystatin 6*. The nucleotide sequence of this SNP molecular marker is as follows (SEQ ID NO. 6, SEQ ID NO. 7): Chr4_4 265bp (Underlined text indicates primer position) GGACAAGGGCTGAAACTTGAGAAACCA AATCTACAGAAATTTGTCCAAAATCTGACCAGTC C / TTAGGAAGCTGTATCTCGATGGTGTAAGTATAAAAGCTCAGGGACAAGAATGGAGCAATGCTTTGTTGCCACTGCGTAACCTCCAAGTATTGAGTATGTCTTATTGTGATCTATCAGGACCCCTTGATTCTTCCCTAACAAGACTAAAGAACTTATCAGTCATTATTCTTGATGCGAACAAATT TTCGTCCCCGATGCCAGACA .

[0045] Example 2: Application of the SNP obtained by this invention (1) 93 alfalfa germplasm resources were used as experimental materials, including 3 materials of the known waterlogging resistant No. 1 (genotype homozygous TTTT at position 53022482 on chromosome chr2_3) and 90 materials with normal / low waterlogging resistance. All materials were tetraploid. (2) 93 alfalfa germplasm resources were used as experimental materials, including 3 materials with strong waterlogging resistance (Chr2_3 chromosome 52997021 position, CTGA insertion homozygous genotype) and 90 materials with normal / low waterlogging resistance. All materials were tetraploid. (3) 93 alfalfa germplasm resources were used as experimental materials, including 3 materials of the known waterlogging resistant No. 5 (genotype homozygous AAAA at position 30078582 on chromosome chr7_3) and 90 materials with normal / low waterlogging resistance. All materials were tetraploid. (4) 93 alfalfa germplasm resources were used as experimental materials, including 3 materials of the known waterlogging resistant No. 6 (genotype homozygous TTTT at position 9483809 on chromosome 4_4) and 90 materials with normal / low waterlogging resistance. All materials were tetraploid.

[0046] After confirming the specific molecular marker sites of the new moisture-resistant germplasm through cloning and sequencing (as in Example 1), further KASP marker development was conducted for these specific molecular marker sites. Primers were designed using the KASP primers assay design tool (https: / / primerdigital.com / tools / kasp.html), with fluorescent adapter sequences GAAGGTGACCAAGTTCATGCT (FAM fluorescent adapter sequence) and GAAGGTCGGAGTCAACGGATT (HEX fluorescent adapter sequence) ligated to the 5′ end of the specific primers. Specific primers are shown in the table below.

[0047]

[0048]

[0049] Using Vazyme's CAUP Genotyping The Probe Master Mix (without Rox) reagent was used in the PCR experiment on the SLAN-965 real-time PCR system. The PCR system and procedure are as follows: PCR system and procedure

[0050] Experimental results are as follows Figure 2 - Figure 5 As shown, the typing results indicate that: (1) The genotypes at position 53022482 on chromosome chr2_3 of the 93 materials can be divided into two categories: one is the TTTT genotype with all four alleles being T, with a total of 3 samples; the other is the non-TTTT genotype containing at least one A allele (e.g., ATTT, AATT, AAAT, etc.), with a total of 90 samples. Combined with the field waterlogging tolerance phenotype identification data, all plants with the TTTT genotype showed strong waterlogging tolerance, while all plants containing the A allele showed weak or normal waterlogging tolerance, with an accuracy rate of 100%.

[0051] (2) The genotypes of the 93 materials at position 52997021 (InDel locus) on chromosome chr2_3 can be divided into two categories: one is the CTGA insertion homozygous genotype, with a total of 3 samples; the other is the non-CTGA insertion homozygous genotype (including no insertion or heterozygous insertion), with a total of 90 samples. Combined with the field waterlogging tolerance phenotype identification data, all plants with the CTGA insertion homozygous genotype showed strong waterlogging tolerance, while all plants without the insertion homozygous genotype showed weak or normal waterlogging tolerance, with an accuracy rate of 100%.

[0052] (3) The genotypes at position 30078582 on chromosome chr7_3 of the 93 materials can be divided into two categories: one is the AAAA genotype with all four alleles being A, with a total of 3 samples; the other is the non-AAAA genotype containing at least one T allele (such as AATT, ATTT, etc.), with a total of 90 samples. Combined with the field waterlogging tolerance phenotypic identification data, all plants with the AAAA genotype showed strong waterlogging tolerance, while all plants containing the T allele showed weak or normal waterlogging tolerance, with an accuracy rate of 100%.

[0053] (4) The genotypes at position 9483809 on chromosome chr4_4 of the xx samples can be divided into two categories: one is the TTTT genotype with all four alleles being T, a total of 3 samples were detected; the other is the non-TTTT genotype containing at least one C allele (e.g., CCTT, CCCC, etc.), a total of 90 samples were detected. Combined with the field waterlogging tolerance phenotype identification data, all plants with the TTTT genotype showed strong waterlogging tolerance, while all plants containing the C allele showed weak or normal waterlogging tolerance, with an accuracy rate of 100%.

[0054] These developed KASP molecular markers will greatly assist in future breeding and variety development using new moisture-resistant germplasm, significantly reducing workload and accelerating the breeding process.

[0055] Example 3: Industrial Application of the SNP of the Invention Based on the unique molecular marker sites for high waterlogging tolerance of early-flowering alfalfa obtained in Example 1 of this invention, and the designed specific amplification primers, molecular probes, gene chips, and detection kits for screening waterlogging-tolerant alfalfa can be industrially prepared using existing conventional and mature technologies in the field. Specifically: based on the upstream and downstream specific sequences of the molecular marker sites, site-specific fluorescent probes are synthesized according to conventional probe synthesis processes; the probes are immobilized on a solid-phase carrier, and a detection chip is prepared using existing chip fabrication processes; based on the allelic differences of the molecular marker sites; and the specific amplification primers, reaction buffer, polymerase, dNTPs, and chromogenic reagents are packaged in conventional proportions to obtain the matching detection kit.

[0056] The method for detecting alfalfa waterlogging tolerance using the above-mentioned molecular probes, chips, or kits includes the following steps: (1) collecting alfalfa tissue samples to be tested and extracting genomic DNA as template DNA; (2) using the specific primers of this invention to perform PCR amplification on the template DNA to obtain PCR amplification products (amplification procedure as in Example 1); (3) sequencing and chip hybridization detection of the PCR amplification products; (4) determining the genotype of the individual to be tested at the molecular marker site based on the sequencing results and chip hybridization signals, and evaluating and screening alfalfa plants with strong waterlogging tolerance based on the genotype.

[0057] Therefore, the molecular markers, detection primers, KASP, probes, and chips of this invention can be used for early screening of alfalfa plants with strong waterlogging tolerance, auxiliary identification of alfalfa varieties with strong waterlogging tolerance, molecular marker-assisted breeding of alfalfa plants with strong waterlogging tolerance, identification and screening of superior germplasm of alfalfa plants with strong waterlogging tolerance, breeding of new alfalfa lines / varieties with superior waterlogging tolerance, detection and typing of alfalfa genotypes related to strong waterlogging tolerance, and construction of a molecular breeding screening system for alfalfa with strong waterlogging tolerance and breeding of high-yield alfalfa varieties. It covers all aspects from the identification, detection, and screening of alfalfa waterlogging tolerance to auxiliary breeding, germplasm evaluation, variety breeding, and molecular breeding applications.

[0058] The above description is merely a preferred embodiment to aid in understanding the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and variations. Any alterations or modifications made by those skilled in the art based on this description without departing from the spirit of the present invention should also fall within the scope of the present invention.

Claims

1. Application of molecular markers A1-A4 in analyzing the waterlogging tolerance of alfalfa: A1) is located at position 53022482 on chromosome chr2_3, and its polymorphism is A / T, where, When the genotype of the alfalfa being tested at the stated location is homozygous TTTT, the alfalfa is determined to have strong waterlogging tolerance; and / or A2) is an InDel molecular marker located at position 52997021 on chromosome chr2_3. When the alfalfa to be tested is a homozygous CTGA insertion at this locus, it is determined that the alfalfa to be tested has strong waterlogging tolerance. A3) is located at position 30078582 on chromosome chr7_3, and its polymorphism is T / A. When the genotype of the alfalfa being tested at this position is homozygous AAAA, the alfalfa is considered to have strong waterlogging tolerance; and / or A4) is located at position 9483809 on chromosome chr4_4, and its polymorphism is C / T. When the genotype of the alfalfa to be tested at the above position is homozygous TTTT, the alfalfa is determined to have strong waterlogging resistance. The physical location information of the molecular markers was determined based on sequence alignment of the genome of alfalfa cultivar ZM-4_V1.

0.

2. The application according to claim 1, characterized in that, The nucleotide sequences of the molecular marker A1 are shown in SEQ ID NO.1-SEQ ID NO.2; The nucleotide sequence of molecular marker A2 is shown in SEQ ID NO.3; The nucleotide sequences of molecular marker A3 are shown in SEQ ID NO.4-SEQ ID NO.5; The nucleotide sequences of molecular marker A4 are shown in SEQ ID NO.6-SEQ ID NO.

7.

3. Primers for analyzing the waterlogging tolerance of alfalfa, characterized in that, Its nucleotide sequence is shown in SEQ ID NO.8-SEQ ID NO.9, or / and As shown in SEQ ID NO.10-SEQ ID NO.11, or / and As shown in SEQ ID NO.12-SEQ ID NO.13, or / and SEQ ID NO.14-SEQ ID NO.15 are shown.

4. A molecular probe assembly for molecular alfalfa waterlogging resistance, characterized in that, The molecular probe combination detects the molecular markers in the sample to be tested.

5. A molecular chip for analyzing the waterlogging tolerance of alfalfa, characterized in that, The molecular chip includes the primers described in claim 3. And / or the molecular probe combination as described in claim 4.

6. KASP for analyzing the waterlogging tolerance of alfalfa, characterized in that, The sequence of the KASP is shown in SEQ ID NO.16-SEQ ID NO.18, or As shown in SEQ ID NO.19-SEQ ID NO.21, or As shown in SEQ ID NO.22-SEQ ID NO.24, or SEQ ID NO.25-SEQ ID NO.27 are shown.

7. A kit for analyzing the waterlogging tolerance of alfalfa, comprising the primers of claim 3, and / or the molecular probe combination of claim 4, and / or the molecular chip of claim 5, and / or the KASP of claim 6.

8. A method for analyzing the waterlogging tolerance of alfalfa, comprising using the primers of claim 3, and / or the molecular probe combination of claim 4, and / or the molecular chip of claim 5, and / or the KASP of claim 6, and / or the kit of claim 7 to detect the sample to be tested.

9. A method for cultivating alfalfa plants with strong waterlogging tolerance, characterized in that, The primers described in claim 3, and / or the molecular probe combination described in claim 4, and / or the molecular chip described in claim 5, and / or the KASP described in claim 6, and / or the kit described in claim 7 are used to detect the test samples, and plants with strong waterlogging resistance are selected for cultivation. Preferably, plants with strong waterlogging tolerance are selected from those with a homozygous TTTT genotype located at position 53022482 on chromosome cchr2_3; and / or Select plants with the CTGA homozygous genotype inserted at position 52997021 on chromosome chr2_3; and / or Select plants with the homozygous AAAA genotype located at position 30078582 on chromosome chr7_3; and / or Select plants with the homozygous TTTT genotype located at position 9483809 on chromosome chr4_4.

10. The application of the molecular marker of claim 1, the primer of claim 3, the molecular probe combination of claim 4, the molecular chip of claim 5, the KASP of claim 6, or the kit of claim 7 in aspects B1)-B8): B1) Used for early screening of alfalfa plants with strong waterlogging tolerance; B2) Used as an auxiliary identification method for alfalfa varieties with strong waterlogging tolerance; B3) Molecular marker-assisted breeding for individuals with strong waterlogging tolerance in alfalfa; B4) Used for the identification and screening of superior germplasm of alfalfa plants with strong waterlogging tolerance; B5) Used for breeding new lines / variety of alfalfa with superior waterlogging resistance; B6) is used for genotyping and detection of alfalfa genotypes related to strong waterlogging tolerance; B7) is used to construct a molecular breeding screening system for alfalfa waterlogging tolerance traits; B8) Develop high-yield alfalfa varieties.

Images