Specific primer pair for identifying leersia plants and application thereof

Abstract

The application relates to a specific primer pair for identifying leersia oryzoides plants and application, which is composed of a forward primer Lh_1F and a reverse primer Lh_1R, the nucleotide sequence of the forward primer Lh_1F is shown in SEQ ID NO. 1, and the nucleotide sequence of the reverse primer Lh_1R is shown in SEQ ID NO. 2. Compared with the prior art, the specific primer pair Lh_1F and Lh_1R of the application can target the intergenic high variable region of the chloroplast psbM-psbZ gene of leersia oryzoides, can generate an amplification product with a length of 174 bp, is suitable for being judged by adopting conventional gel electrophoresis, and can be effectively distinguished from rice, barnyard grass and dogtail grass and other plants similar to leersia oryzoides.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a specific primer pair for identifying Rhes oryzae and its application. Background Technology

[0002] *Leersia hexandra* is a perennial herbaceous plant belonging to the genus *Leersia* in the family Poaceae. It is commonly found in paddy fields, ditches, and other wetland environments. Some of its morphological characteristics are similar to those of closely related plants in the same genus and other wetland Poaceae plants. Accurate identification of *Leersia hexandra* can provide a foundation for plant resource surveys, community composition analysis, germplasm material management, and related ecological research.

[0003] Traditional plant classification primarily relies on morphological characteristics such as spike shape, glumes, ligules, leaf sheaths, and plant growth habits. However, when samples are in the seedling or vegetative growth stage, or lack key traits like inflorescences, the available identification information is limited. Furthermore, the growth environment, developmental stage, and preservation status can also affect some observable traits. Broken tissues, rhizomes, or dried samples are difficult to identify based on the characteristics of intact plants, thus limiting the applicability of morphological methods.

[0004] DNA barcoding and polymerase chain reaction (PCR) provide molecular methods for plant species identification. Chloroplast-encoding genes such as rbcL and matK, as well as intratranscribed spacer regions (ITS) within ribosomes, are commonly used as plant barcodes. However, these regions are relatively conserved among some closely related species, with limited variation sites. After amplification using universal barcodes, sequencing and sequence alignment are usually required, making the process and interpretation relatively complex. For example, patent CN104099417A discloses a method for establishing a RAPD reaction system for the chromium-rich plant *Leymus chinensis*. This method involves extracting total DNA from *Leymus chinensis* using the CTAB method and exploring the optimal amounts of template, primers, dNTPs, and Taq polymerase to establish the optimal RAPD reaction system for *Leymus chinensis*. In this RAPD reaction system, the template DNA volume is 0.5 μL, containing 0.5 μL of dNTPs, corresponding to a dNTP concentration of 200 μmol / L; the optimal amount of Taq polymerase is 2.0 U. However, the reproducibility of the RAPD reaction is poor, and Mg... 2+ Even slight changes in concentration, template quality, Taq enzyme, and annealing temperature can alter the bands. Therefore, repeated experiments are necessary to ensure the stability of the results and minimize their randomness, allowing the experiment to proceed smoothly. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of existing technologies for identifying Rhes oryzae plants, such as complexity and inaccuracy, and to provide a specific primer pair for identifying Rhes oryzae plants and its application.

[0006] The chloroplast genome structure of plants is relatively stable, but some intergenic regions accumulate a large number of single nucleotide variations and insertions / deletions. In this invention, by comparing the complete chloroplast sequences of *Leymus chinensis* and closely related species of the *Oryza* genus, highly variable regions with concentrated interspecific differences can be screened, and primers can be designed in relatively conserved flanking sequences. These primers must bind stably to the target sequence of *Leymus chinensis* while avoiding the formation of the desired amplification products with closely related species and other grasses.

[0007] Existing universal plant barcoding primers mainly amplify conserved marker regions, making it difficult to directly identify *Rhizophora oryzae* using only conventional PCR and gel electrophoresis. Therefore, it is necessary to screen for specific binding sites in the hypervariable regions of *Rhizophora oryzae* chloroplasts and provide synthetic primers with well-defined sequences and amplified fragments suitable for electrophoretic interpretation to simplify the identification process.

[0008] The objective of this invention can be achieved through the following technical solutions: One of the technical solutions of the present invention is to provide a specific primer pair for identifying Rheum palmatum, wherein the specific primer pair consists of a forward primer Lh_1F and a reverse primer Lh_1R. The nucleotide sequence of the forward primer Lh_1F is shown in SEQ ID NO.1. The nucleotide sequence of the reverse primer Lh_1R is shown in SEQ ID NO.2.

[0009] The second technical solution of the present invention is to provide an application of the specific primer pair as described in one of the above technical solutions in any one of the following m1)-m6): m1) Preparation of products for species identification of Leymus chinensis; m2) to prepare products for auxiliary identification of Rhizophora species; m3) Products for tracing the source of physical evidence; m4) Identification of *Leymus chinensis* species; m5) Auxiliary identification of *Leymus chinensis* species; m6) Tracing the source of physical evidence.

[0010] The third technical solution of the present invention is to provide a kit containing the specific primer pair as described in one of the above technical solutions.

[0011] The fourth technical solution of the present invention is to provide a method for preparing the reagent kit as described in the third technical solution above, including the step of separately packaging the forward primer Lh_1F and the reverse primer Lh_1R.

[0012] The fifth technical solution of the present invention is to provide the application of the reagent kit as described in the third technical solution above in any one of the following m1)-m6): m1) Preparation of products for species identification of Leymus chinensis; m2) to prepare products for auxiliary identification of Rhizophora species; m3) Products for tracing the source of physical evidence; m4) Identification of *Leymus chinensis* species; m5) Auxiliary identification of *Leymus chinensis* species; m6) Tracing the source of physical evidence.

[0013] The sixth technical solution of the present invention is to provide a DNA fragment, which is a DNA fragment amplified using the psbM-psbZ intergenic region of the Rhizophora plant as a template and the specific primer pair described in one of the above technical solutions.

[0014] The seventh technical solution of the present invention is to provide the application of the DNA fragment as described in the sixth technical solution above in any one of the following m1)-m6): m1) Preparation of products for species identification of Leymus chinensis; m2) to prepare products for auxiliary identification of Rhizophora species; m3) Products for tracing the source of physical evidence; m4) Identification of *Leymus chinensis* species; m5) Auxiliary identification of *Leymus chinensis* species; m6) Tracing the source of physical evidence.

[0015] The eighth technical solution of the present invention is to provide a method for identifying or assisting in the identification of *Leymus chinensis* species, comprising the following steps: using the genomic DNA of the plant to be tested as a template, performing PCR amplification using the specific primer pair as described in one of the above technical solutions to obtain PCR amplification products; performing gel electrophoresis detection on the PCR amplification products; and analyzing and judging based on the band size of the PCR amplification products. If the band size of the PCR amplification product is 174 bp, then the plant to be tested is Rhes oryzae.

[0016] In some specific embodiments, the PCR amplification reaction system is as follows: 0.5 μL template DNA, 1 μL upstream primer Lh_1F, 1 μL downstream primer Lh_1R, 5 μL ddH2O, 7.5 μL Taq DNA polymerase, and a total reaction volume of 15 μL.

[0017] In some specific embodiments, the PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 5 min; 4℃ for 5 min.

[0018] Compared with the prior art, the present invention has the following advantages: (1) The specific primer pairs Lh_1F and Lh_1R of the present invention can target the hypervariable region between the psbM and psbZ genes in the chloroplasts of Rhizophora leuciscus, namely the 67740-67913 segment of the reference sequence OZ205812.1, and can produce an amplification product with a length of 174 bp, which is suitable for interpretation by conventional gel electrophoresis.

[0019] (2) The specific primer pairs Lh_1F and Lh_1R of the present invention can effectively distinguish between Leymus chinensis and rice, barnyard grass and foxtail grass, and have specificity.

[0020] (3) The identification method of Li's grass provided by the present invention is simple, accurate and specific, which is conducive to its promotion and application. Attached Figure Description

[0021] Figure 1 The results show the amplification of total DNA from Rheum nobilis using the specific primer pairs Lh_1F and Lh_1R.

[0022] Figure 2 The results show the specific detection results for the specific primer pairs Lh_1F and Lh_1R. Detailed Implementation

[0023] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments. These embodiments are based on the technical solution of the present invention and provide detailed implementation methods and specific operating procedures. However, the scope of protection of the present invention is not limited to the following embodiments.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the application.

[0025] Unless otherwise specified, the materials and processes described in the following embodiments or examples are conventional materials and processes used in the art to achieve the corresponding functions.

[0026] Example 1: Chloroplast sequences of *Rhizophora stylosa* and closely related species of the *Oryza* genus were obtained from the public database of the National Center for Biotechnology Information (NCBI), with data retrieved up to August 14, 2026. The complete chloroplast reference sequence of *Rhizophora stylosa*, OZ205812.1, was used as the target sequence. Leersia japonica ( L. japonica ), Leersia oryzoides ( L. oryzoides ), Leersia virginica ( L. virginica )and Leersia perrieri ( L. perrieri Chloroplast sequences of closely related species such as Rhizophora can be used as comparison sequences. BLAST (Basic Local Alignment Search Tool) and multiple sequence alignment methods were used to screen candidate specific regions with relatively concentrated differences between Rhizophora and closely related species.

[0027] The comparison results showed that a hypervariable region exists in the intergenic region between the psbM and psbZ genes in the chloroplasts of *Hemiberlesia javanica*, which can be used for species identification. A pair of synthetic primers, Lh_1F and Lh_1R, were designed targeting the 67740–67913 region of OZ205812.1 and submitted to NCBI Primer-BLAST for specificity verification in the Nucleotide collection (nr / nt) database. The verification results did not identify any other amplification targets. The primers were synthesized by the Shanghai Synthesis Department of Beijing Qingke Biotechnology Co., Ltd.

[0028] The nucleotide sequences (5'-3') of the forward primer Lh_1F and the reverse primer Lh_1R are shown in SEQ ID NO.1 and 2, respectively. The melting temperatures of the forward primer Lh_1F and the reverse primer Lh_1R are 61.52℃ and 61.26℃, respectively, and the amplification product length is 174 bp.

[0029] SEQ ID NO.1 (Lh_1F): TACTTACGTCCTGCAGTAGTCG; SEQ ID NO. 2 (Lh_1R): CAGTGAGCGGTTGGTACTTCG.

[0030] The forward primer Lh_1F and the reverse primer Lh_1R were used to detect Rhes oryzae (collected from farmland in Minhang District, Shanghai), and the following steps were performed: Total DNA was extracted from leaf samples of *Rhizophora stylosa* using the CTAB method. The obtained total DNA was used as a template for PCR amplification using Lh_1F and Lh_1R primers. The PCR amplification reaction system consisted of: 0.5 μL template DNA, 1 μL upstream primer Lh_1F, 1 μL downstream primer Lh_1R, 5 μL ddH2O, and 7.5 μL 2×Rapid Taq Plus Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), for a total reaction volume of 15 μL. The PCR amplification program was as follows: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 5 min; 4℃ for 5 min. After PCR, the amplification products were subjected to 1% agarose gel electrophoresis at 160 V for 20 min.

[0031] Electrophoresis results are shown Figure 1 .exist Figure 1 In the image, M stands for 2K Plus DNA Marker; lane 1 shows the amplified product of total DNA from Rheum palmatum amplified using Lh_1F and Lh_1R, resulting in an amplified band of 174 bp.

[0032] Example 2 Forward primer Lh_1F and reverse primer Lh_1R were used to detect rice, Leymus chinensis, barnyard grass, and foxtail grass plant samples for comparison. Among them, the rice was Nipponbare variety, and the Leymus chinensis, barnyard grass, and foxtail grass samples were all collected from farmland in Minhang District, Shanghai.

[0033] Includes the following steps: Total DNA was extracted from each plant leaf sample using the CTAB method. Using the obtained total DNA as a template, PCR amplification was performed using Lh_1F and Lh_1R according to the PCR amplification procedure and reaction system provided in Example 1. After PCR, the amplification products were subjected to 1% agarose gel electrophoresis at 160 V for 20 min.

[0034] Test results are shown Figure 2 . Figure 2 In the diagram, M represents the 2K Plus DNA Marker; lane 1 contains total DNA from rice; lane 2 contains total DNA from Leymus chinensis; lane 3 contains total DNA from barnyard grass; and lane 4 contains total DNA from Setaria viridis. Lane 2 yielded a 174 bp amplified band, while lanes 1, 3, and 4 did not yield corresponding amplified bands.

[0035] Within the range of samples tested, the PCR test results were consistent with the laboratory identification results of each plant sample, indicating that Lh_1F and Lh_1R can distinguish between Leymus chinensis and rice, barnyard grass and foxtail grass under the above test conditions.

[0036] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A specific primer pair for identifying Rhes oryzae, characterized in that, The specific primer pair consists of a forward primer Lh_1F and a reverse primer Lh_1R. The nucleotide sequence of the forward primer Lh_1F is shown in SEQ ID NO.

1. The nucleotide sequence of the reverse primer Lh_1R is shown in SEQ ID NO.

2.

2. An application of the specific primer pair as described in claim 1, characterized in that, Applications selected from any one of the following m1)-m6): m1) Preparation of products for species identification of Leymus chinensis; m2) to prepare products for auxiliary identification of Rhizophora species; m3) Products for tracing the source of physical evidence; m4) Identification of *Leymus chinensis* species; m5) Auxiliary identification of *Leymus chinensis* species; m6) Tracing the source of physical evidence.

3. A kit containing the specific primer pair as described in claim 1.

4. A method for preparing the reagent kit as described in claim 3, characterized in that, This includes the step of packaging the forward primer Lh_1F and the reverse primer Lh_1R separately.

5. The application of the reagent kit as described in claim 3, characterized in that, Applications selected from any one of the following m1)-m6): m1) Preparation of products for species identification of Leymus chinensis; m2) to prepare products for auxiliary identification of Rhizophora species; m3) Products for tracing the source of physical evidence; m4) Identification of *Leymus chinensis* species; m5) Auxiliary identification of *Leymus chinensis* species; m6) Tracing the source of physical evidence.

6. A DNA fragment, characterized in that, The DNA fragment was amplified using the psbM-psbZ intergenic region of Rhizophora leuciscus as a template and the specific primer pair as described in claim 1.

7. The application of the DNA fragment as described in claim 6, characterized in that, Applications selected from any one of the following m1)-m6): m1) Preparation of products for species identification of Leymus chinensis; m2) to prepare products for auxiliary identification of Rhizophora species; m3) Products for tracing the source of physical evidence; m4) Identification of *Leymus chinensis* species; m5) Auxiliary identification of *Leymus chinensis* species; m6) Tracing the source of physical evidence.

8. A method for identifying or assisting in the identification of *Leymus chinensis* species, characterized in that, The process includes the following steps: using the genomic DNA of the plant to be tested as a template, performing PCR amplification using the specific primer pair as described in claim 1 to obtain PCR amplification products; detecting the PCR amplification products by gel electrophoresis; and analyzing and judging based on the band size of the PCR amplification products. If the band size of the PCR amplification product is 174 bp, then the plant to be tested is Rhes oryzae.

9. The method according to claim 8, characterized in that, The PCR amplification reaction system consisted of: 0.5 μL template DNA, 1 μL upstream primer Lh_1F, 1 μL downstream primer Lh_1R, 5 μL ddH2O, 7.5 μL Taq DNA polymerase, and a total reaction volume of 15 μL.

10. The method according to claim 8, characterized in that, The PCR amplification reaction program was as follows: 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, 30 cycles; 72℃ for 5 min; 4℃ for 5 min.

Images