KASP molecular marker primer combination for identifying dioscin traits of yam and application thereof

Abstract

The application discloses a KASP molecular marker primer combination for identifying a Chinese yam saponin trait and application thereof, and belongs to the technical field of Chinese yam agronomic trait molecular marker development and molecular marker assisted breeding. The KASP molecular marker primer combination comprises a forward primer as shown in SEQ ID NO. 1 and SEQ ID NO. 2 and a reverse primer as shown in SEQ ID NO. 3. The application provides a novel and simple molecular marker and assisted selection method based on the obtained KASP marker of a Chinese yam saponin trait regulating gene, and the method is suitable for rapid screening of Chinese yam saponin content and molecular marker assisted breeding. The molecular marker can detect the genotypes of different saponin abundance materials in a natural population, and can also be used for molecular marker assisted selection breeding of different saponin Chinese yam materials, replaces large-scale sample detection screening, reduces field work load, and greatly improves the screening accuracy and efficiency.

Description

Technical Field

[0001] This invention relates to the field of molecular marker development for agronomic traits of yam and molecular marker-assisted breeding technology, specifically to a KASP molecular marker primer combination for identifying saponin traits in yam and its application. Background Technology

[0002] Yam (Dioscorea spp.) is an annual or perennial twining vine belonging to the Dioscoreaceae family and the Dioscorea genus. It is one of the four major tuber crops in my country, possessing both edible and medicinal properties. my country has over 5 million mu (approximately 333,333 hectares) of yam cultivation area, spanning more than 30 provinces (autonomous regions and municipalities), with an annual output exceeding 10 million tons. The net profit per mu can reach tens of thousands of yuan, and the annual output value exceeds 100 billion yuan. It has become an important tool for developing distinctive industries and contributing to rural revitalization in various regions.

[0003] Diosgenin is the most important active ingredient in Dioscorea plants. As a core precursor for the industrial synthesis of steroid hormone drugs, it is widely used in the synthesis of various drugs. It also possesses multiple pharmacological activities, including anti-inflammatory, antioxidant, regulation of glucose and lipid metabolism, immune modulation, and anti-tumor effects, resulting in extremely high demand and playing a vital role in the health industry. To further elucidate the synthetic mechanism of diosgenin, researchers studied the synthesis of diosgenin from Dioscorea peltata (…). Dioscorea zingiberensisThe following genes were cloned from CH Wright: squalene synthase (SQS), sterol C24-methyltransferase (SMT), 4-hydroxy-3-methyl-2-butenyl diphosphate reductase (HDR), 4-hydroxy-3-methyl-2-butenyl-1-pyrophosphate synthase (HDS), 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR), and 4-(cytidine 5'-diphosphate)-2-C-methyl-D-erythritol kinase. The gene CMK, the gene 2-C-methyl-D-erythritol-2,4-cyclodiphosphate synthase (MDS), and the gene 3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR) were discovered. HDR Gene, CMK Gene, HDS Gene, DXR Genes and MDS Genes can be expressed in *E. coli*, providing information for exploring the mechanism of action and expression regulation of saponin synthesis in *Dioscorea* plants. Feng Yumei et al. cloned *Dioscorea chuanxiong* (…). Dioscorea nipponica Makino. SQS gene The differential expression of this gene in different tissues was found to be consistent with the differential content of diosgenin, based on which it is inferred that... SQS Genes play an important role in the synthesis of diosgenin in Dioscorea opposita. Xu Wali et al. studied the effects of genes on Dioscorea opposita (also known as chrysanthemum-leaved Dioscorea opposita). Dioscoreacomposita Hemsl.) SQS Genes, squalene epoxidase (SE) gene and HMGR Research on differential gene expression has been conducted to prove HMGR The gene was expressed at the highest levels in leaves, stems, and roots, and only in these areas was expression highest. HMGRGene expression levels differ significantly in different tissues.

[0004] In summary, significant progress has been made in the theoretical research and molecular mechanism studies of yam saponins. However, due to the multi-gene control and susceptibility to environmental factors, the regulatory pathways of yam saponins still require further refinement. Therefore, in-depth exploration of the genetic mechanisms of yam saponins and large-scale mining and identification of key gene resources are of great significance for promoting the breeding of high-quality functional yam varieties and accelerating the high-quality development of modern agriculture in my country. Summary of the Invention

[0005] To address the aforementioned technical problems, the present invention aims to provide a KASP molecular marker primer combination for identifying the characteristics of yam saponins and its application, thereby solving the problem of the lack of existing methods for early, rapid, and accurate identification of yam saponin characteristics.

[0006] The technical solution of the present invention to solve the above-mentioned technical problems is as follows: In a first aspect, the present invention provides a KASP molecular marker primer combination for identifying the saponin properties of yam, the KASP molecular marker primer combination comprising the forward primers shown in SEQ ID NO.1 and SEQ ID NO.2 and the reverse primer shown in SEQ ID NO.3; Forward primer F1: 5'-GAAGGTGACCAAGTTCATGCTTAGTACGTCCTCCCGTCCAATG-3' (SEQ ID NO. 1); Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTTAGTACGTCCTCCCGTCCAATA-3' (SEQ ID NO. 2); Reverse primer R: 5'-CACGGGTTTGATTACCAGTCAATT-3' (SEQ ID NO. 3).

[0007] Furthermore, the KASP molecular marker primer combination was developed from the KASP molecular marker located at 32435157 bp on chromosome 5 of the yam genome (PRJNA695139) GCF_009730915.1; the genotype of the KASP molecular marker is C or T.

[0008] Furthermore, when the genotype of the KASP molecular marker is C, the saponin trait of yam is low saponin content, and the sequence of the KASP molecular marker 50 bp before and after it is shown in SEQ ID NO.4; when the genotype of the KASP molecular marker is T, the saponin trait of yam is high saponin content, and the sequence of the KASP molecular marker 50 bp before and after it is shown in SEQ ID NO.5. SEQ ID NO.4: GATGCCCATCGGGTACGTCACGCTGCCGGTGGGGATCGCGGGGCCCTTGTCATTGGACGGGAGGACGTACTACTTGCCATGGCAACCACCGAGGGGTGCT; SEQ ID NO.5: GATGCCCATCGGGTACGTCACGCTGCCGGTGGGGATCGCGGGGCCCTTGTTATTGGACGGGAGGACGTACTACTTGCCATGGCAACCACCGAGGGGTGCT.

[0009] In a second aspect, the present invention provides a kit for identifying the properties of yam saponins, comprising the above-described KASP molecular marker primer combination.

[0010] A third aspect of the present invention provides the application of the above-described KASP molecular marker primer combination or kit in the identification or auxiliary identification of yam saponin properties.

[0011] A fourth aspect of the present invention provides a method for identifying the properties of yam saponins, comprising the following steps: S1. Extract genomic DNA from the yam sample to be tested; S2. Using the KASP molecular marker primer combination or kit described above, PCR amplification was performed using the DNA obtained in S1 as a template, and the genotype of the KASP molecular marker was detected. S3. Based on the genotype results obtained in S2, if the genotype of the KASP molecular marker in the yam sample is TT, then the sample is judged to have a high saponin content trait; if the genotype of the KASP molecular marker in the yam sample is CC, then the sample is judged to have a low saponin content trait.

[0012] Furthermore, the PCR amplification reaction system consisted of 1.25 μL of DNA template, 2.5 μL of KASP master mix, and 1.25 μL of KASP molecular marker primer combination, for a total volume of 5 μL.

[0013] Furthermore, the PCR amplification reaction program was as follows: 95℃ pre-denaturation for 10 minutes; 95℃ denaturation for 20 seconds; 61-55℃ annealing for 60 seconds, 10 cycles; 95℃ denaturation for 20 seconds; 55℃ extension for 60 seconds, 27 cycles; fluorescence signal reading at 25℃ for 30 seconds.

[0014] In a fifth aspect, the invention provides the application of the above-described KASP molecular marker primer combination or kit or method for identifying yam saponin traits in yam-assisted selection breeding.

[0015] The beneficial effects of adopting the above-mentioned further technical solutions are as follows: This invention utilizes a KASP molecular marker, which is designed and developed and is closely linked to the saponin trait of yam, to screen varieties of yam with different saponin contents, thereby realizing marker-assisted breeding and accelerating the breeding process. In production, this molecular marker can also be used to detect seedlings, screen plants with high saponin content, increase yam saponin accumulation, and thus improve the quality of yam products.

[0016] The present invention has the following beneficial effects: This invention provides a KASP molecular marker for identifying saponin traits in yam and a primer combination for detecting the KASP molecular marker. This molecular marker can detect the genotype of materials with different saponin contents in natural yam populations, and can also be used for marker-assisted selection breeding of yams with different saponin contents. It can replace large-scale sample testing and screening, reduce field workload, and greatly improve the accuracy and efficiency of screening. Attached Figure Description

[0017] Figure 1 This is a graph showing the molecular marker gene typing and phenotypic association verification results of natural populations of yam with different saponins according to the present invention. Detailed Implementation

[0018] The principles and features of the present invention are described below with reference to the accompanying drawings. The examples given are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified in the examples, conventional conditions or conditions recommended by the manufacturer should be followed. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0019] Example 1: Development of KASP molecular markers and primer combinations for identifying yam saponin traits This embodiment provides a method for developing KASP molecular markers for identifying yam saponin traits, including the following steps: S1. Resequencing was performed using Fujian sweet potato (a yam with high saponin content) and Jinggangshan cypress yam (a yam with low saponin content).

[0020] S2. By combining the saponin content data with correlation analysis, SNP variant sites closely linked to the saponin properties of yam were identified.

[0021] S3. Primers were designed using SNP site information of high and low saponin yam materials and the screened SNP sites. Molecular markers related to yam saponin traits were screened using the Kompetitive Allele Specific Polymerase Chain Reaction (KASP) method.

[0022] S4. Primer combinations were designed for the KASP molecular markers closely linked to the yam saponin traits obtained from S3 screening. The primers consisted of forward primers F1 and F2 and reverse primer R. The primers were synthesized by Beijing Jiacheng Biotechnology Co., Ltd. and amplified on an ABI QuantStudio PCR instrument.

[0023] The PCR reaction system consisted of: 1.25 μL of yam genomic DNA, 2.5 μL of KASP master mix, and 1.25 μL of primer combination mixture, for a total volume of 5 μL.

[0024] The PCR reaction program was as follows: 95℃ pre-denaturation for 10 minutes; 95℃ denaturation for 20 seconds; 61-55℃ annealing for 60 seconds, 10 cycles; 95℃ denaturation for 20 seconds; 55℃ extension for 60 seconds, 27 cycles; fluorescence signal reading at 25℃ for 30 seconds.

[0025] After amplification, fluorescence signals are detected and genotyping is analyzed. If genotyping is insufficient, amplification can continue, with fluorescence signals read every three cycles to check genotyping results, until complete genotyping is achieved.

[0026] By screening molecular markers, this invention successfully developed a KASP molecular marker and primer combination closely linked to the saponin trait of yam. This molecular marker is an SNP mutation marker, with two genotypes, C and T, located at 32435157 bp on chromosome 5 of the yam genome (PRJNA695139) GCF_009730915.1. When the genotype of the KASP molecular marker is C, the yam exhibits a low saponin content, and the sequence of the 50 bp before and after the KASP molecular marker is shown in SEQ ID NO.4. When the genotype of the KASP molecular marker is T, the yam exhibits a high saponin content, and the sequence of the 50 bp before and after the KASP molecular marker is shown in SEQ ID NO.5.

[0027] SEQ ID NO.4: GATGCCCATCGGGTACGTCACGCTGCCGGTGGGGATCGCGGGGCCCTTGTCATTGGACGGGAGGACGTACTACTTGCCATGGCAACCACCGAGGGGTGCT; SEQ ID NO.5: GATGCCCATCGGGTACGTCACGCTGCCGGTGGGGATCGCGGGGCCCTTGTTATTGGACGGGAGGACGTACTACTTGCCATGGCAACCACCGAGGGGTGCT.

[0028] This primer combination consists of forward primers as shown in SEQ ID NO.1 and SEQ ID NO.2 and a reverse primer as shown in SEQ ID NO.3: Forward primer F1: 5'-GAAGGTGACCAAGTTCATGCTTAGTACGTCCTCCCGTCCAATG-3' (SEQ ID NO. 1); Forward primer F2: 5'-GAAGGTCGGAGTCAACGGATTTAGTACGTCCTCCCGTCCAATA-3' (SEQ ID NO. 2); Reverse primer R: 5'-CACGGGTTTGATTACCAGTCAATT-3' (SEQ ID NO. 3).

[0029] Example 2: Identification method of yam saponins based on KASP molecular markers A method for identifying the phenotypic properties of yam saponins based on KASP molecular markers includes the following steps: S1, DNA extraction: Genomic DNA was extracted from natural populations of yam using the CTAB method and used as template DNA.

[0030] PCR amplification of S2 and KASP molecular markers: The primer combination of the KASP molecular marker obtained in Example 1 was used to amplify the template DNA obtained in S1 by PCR. The fluorescence signal was detected using an ABI QuantStudio PCR instrument, and the genotype was analyzed.

[0031] The PCR reaction system consisted of: 1.25 μL of yam genomic DNA, 2.5 μL of KASP master mix, and 1.25 μL of primer combination mixture, for a total volume of 5 μL.

[0032] The PCR reaction program was as follows: 95℃ pre-denaturation for 10 minutes; 95℃ denaturation for 20 seconds; 61-55℃ annealing for 60 seconds, 10 cycles; 95℃ denaturation for 20 seconds; 55℃ extension for 60 seconds, 27 cycles; fluorescence signal reading at 25℃ for 30 seconds.

[0033] The 5' ends of forward primers F1 and F2 are connected to FAM / VIC fluorescent reporter groups (displayed as different colors on the genotyping map: red for CC genotype, blue for TT genotype, and green for CT genotype). If the material being tested is homozygous, only one corresponding primer will be selected for amplification. The fluorescence difference indicates whether the tested material is homozygous CC or TT genotype. If the material being tested is heterozygous, both primers will amplify, producing a third fluorescent signal, thus distinguishing heterozygous genotypes.

[0034] S3. Judgment of saponin properties: Based on the genotyping results obtained in S2, when the genotype of the KASP molecular marker in a yam sample is TT, the sample is judged to have a high saponin content trait; when the genotype of the KASP molecular marker in a yam sample is CC, the sample is judged to have a low saponin content trait.

[0035] Example 3: Type identification of natural saponin content in yam In this embodiment, the yam saponin trait identification method in Example 2 was used to detect molecular markers in 159 natural yam germplasm resources and to determine the saponin content.

[0036] Test results as follows Figure 1 As shown in Table 1. Figure 1 In red, the CC genotype is consistent with the low-saponin material; in blue, the TT genotype is consistent with the high-saponin material; in green, the CT genotype is consistent with the heterozygous material; and in black, the cross represents the negative control with no fluorescent signal.

[0037] Table 1. Genotyping and saponin content data of natural populations of yam

[0038] The results showed that the saponin content of yam with the homozygous TT genotype (13.611 mg / g dry weight) was significantly higher than that of yam with the CC genotype (8.495 mg / g dry weight). The genotyping results were basically consistent with the measured saponin content results. Therefore, molecular markers can detect different genotypes of materials with different saponin contents in natural yam populations, further clarifying that this molecular marker can be used for marker-assisted selection breeding of yam materials with different saponin contents, enabling rapid early screening of high- and low-saponin yam varieties to achieve the purpose of marker-assisted breeding.

[0039] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A KASP molecular marker primer combination for identifying the properties of yam saponins, characterized in that, The KASP molecular marker primer combination includes forward primers as shown in SEQ ID NO.1 and SEQ ID NO.2 and reverse primers as shown in SEQ ID NO.

3.

2. The KASP molecular marker primer combination for identifying yam saponin properties according to claim 1, characterized in that, The KASP molecular marker primer combination was developed from the KASP molecular marker located at 32435157 bp on chromosome 5 of the yam genome (PRJNA695139) GCF_009730915.1; the genotype of the KASP molecular marker is C or T.

3. The KASP molecular marker primer combination for identifying yam saponin properties according to claim 2, characterized in that, When the genotype of the KASP molecular marker is C, the saponin trait of yam is low saponin content, and the sequence of the KASP molecular marker 50 bp before and after it is shown in SEQ ID NO.4; when the genotype of the KASP molecular marker is T, the saponin trait of yam is high saponin content, and the sequence of the KASP molecular marker 50 bp before and after it is shown in SEQ ID NO.

5.

4. A kit for identifying the properties of yam saponins, characterized in that, Contains the KASP molecular marker primer combination as described in any one of claims 1-3.

5. The use of the KASP molecular marker primer combination according to any one of claims 1-3 or the kit according to claim 4 in the identification or auxiliary identification of yam saponin properties.

6. A method for identifying the properties of yam saponins, characterized in that, Includes the following steps: S1. Extract genomic DNA from the yam sample to be tested; S2. Using the KASP molecular marker primer combination according to any one of claims 1-3 or the kit according to claim 4, PCR amplification is performed using the DNA obtained in S1 as a template, and the genotype of the KASP molecular marker is detected. S3. Based on the genotype results obtained in S2, if the genotype of the KASP molecular marker in the yam sample is TT, then the sample is judged to have a high saponin content trait; if the genotype of the KASP molecular marker in the yam sample is CC, then the sample is judged to have a low saponin content trait.

7. The method for identifying the properties of yam saponins according to claim 6, characterized in that, The PCR amplification reaction system consisted of 1.25 μL of DNA template, 2.5 μL of KASP master mix, and 1.25 μL of KASP molecular marker primer combination, for a total volume of 5 μL.

8. The method for identifying the properties of yam saponins according to claim 6, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 10 minutes; 95℃ denaturation for 20 seconds; 61-55℃ annealing for 60 seconds, 10 cycles; 95℃ denaturation for 20 seconds; 55℃ extension for 60 seconds, 27 cycles; fluorescence signal reading at 25℃ for 30 seconds.

9. The application of the KASP molecular marker primer combination according to any one of claims 1-3, the kit according to claim 4, or the method for identifying yam saponin traits according to any one of claims 6-8 in yam-assisted selection breeding.

Images