Targeted capture probe library for detecting influenza virus in sewage and application thereof

Abstract

The application discloses a targeted capture probe library for detecting influenza virus in sewage and application, and belongs to the technical field of virus detection. The application provides a targeted capture probe library suitable for detecting influenza virus in sewage, which is suitable for clinical samples and sewage samples, has strong anti-interference capability, and can target to acquire whole genome information of the influenza virus. Based on the probe library, a gene library can be constructed to perform high-throughput sequencing on the influenza virus, so as to acquire mutation and typing information of the influenza virus in the sample. The technical scheme provided by the application can realize detection of the influenza virus in the sewage sample at a low concentration of 10 2 copies / L of the influenza virus nucleic acid, and covers mainstream subtypes such as H1N1, H3N2, Victoria / Yamagata of type B.

Description

Technical Field

[0001] This invention belongs to the field of virus detection technology, specifically relating to a targeted capture probe library for detecting influenza virus in sewage and its application. Background Technology

[0002] Influenza virus belongs to the Orthomyxoviridae family and is a single-stranded, negative-sense RNA virus. It is classified into four types: A, B, C, and D. Types A and B are the main strains causing human influenza outbreaks, characterized by rapid transmission, high mutation rate, and strong pathogenicity. Influenza virus is primarily transmitted through respiratory droplets. Infected individuals shed viral particles in their feces and urine after becoming ill, and these particles are discharged into the aquatic environment via sewage. Therefore, sewage serves as a "biomonitoring medium" for influenza virus transmission among humans. Monitoring influenza virus in sewage allows for early warning and analysis of epidemic characteristics.

[0003] In influenza virus surveillance, there are significant differences between clinical case samples and sewage samples, with sewage testing being far more challenging than human clinical samples. Human clinical samples (pharyngeal swabs, nasal swabs) have simpler matrices, fewer impurities, lower inhibitor content, and typically higher viral loads (10T). 4 -10 8 The virus can be reliably detected using existing methods such as multiplex amplicon assays and RT-qPCR. However, wastewater samples have a complex composition, containing large amounts of humic acid, heavy metals, bacteria, and exogenous nucleic acids, which strongly inhibit enzymatic reactions. Furthermore, the concentration of influenza virus in wastewater is extremely low (typically 10⁻¹⁰ copies / mL). 3 Furthermore, nucleic acids are easily degraded and fragmented, making them difficult to detect stably using conventional methods, resulting in a high false negative rate.

[0004] Currently, the existing technologies and characteristics for detecting influenza viruses in wastewater are as follows:

[0005] (1) RT-qPCR technology

[0006] This method is currently the mainstream method for detecting influenza viruses in sewage, but its limitations are also quite obvious, mainly manifested in the following aspects: 1) It can only detect single or a few gene fragments, and cannot obtain whole genome information, making it difficult to monitor viral mutations; 2) It is easily affected by sewage matrix. Humus, heavy metals, surfactants, etc. in sewage can inhibit the activity of reverse transcriptase and Taq enzyme, leading to false negatives; 3) It cannot distinguish between infectious viruses and inactive viral nucleic acids, which may overestimate the risk of an epidemic; 4) It has limited ability to detect variant strains. After viral genes mutate, primer binding is prone to failure, leading to missed detections.

[0007] (2) Amplicon multiplex detection technology

[0008] This method is currently widely used for influenza virus detection in human samples (such as throat swabs and nasal swabs) and is one of the supplementary methods for routine testing. Its limitations are mainly: 1) Poor sample adaptability; it is only applicable to human samples (throat swabs, nasal swabs, etc.), and its detection effect on environmental samples such as sewage is extremely poor. Sewage contains a large amount of bacterial nucleic acid, human host nucleic acid, and inhibitors, which will seriously interfere with the multiplex PCR amplification reaction, leading to false negatives or amplification failure; 2) Limited detection sensitivity; it is insufficient for detecting low-load samples (such as low concentrations of influenza virus in sewage), especially when the virus concentration is below 10... 3 When the number of copies / L is low, the detection rate decreases significantly; 3) Incomplete genomic information is obtained, only the target gene fragment can be amplified, and the whole genome sequence of the influenza virus cannot be obtained, making it difficult to comprehensively detect variant sites (especially variants in non-target gene regions); 4) Strong primer dependence, if the influenza virus undergoes a mutation in the primer binding region, it will lead to amplification failure and the detection cannot be completed; 5) It cannot be adapted to both human samples and sewage samples at the same time, and different primer systems need to be designed for different sample types, resulting in poor universality.

[0009] (3) Metatranscriptome sequencing technology

[0010] As an RNA sequencing technology without pre-defined targets, its advantages lie in "unbiasedness" and "information richness," but it has many limitations in wastewater sample detection: 1) Low-load detection is difficult. The proportion of influenza virus nucleic acid in wastewater is usually less than 0.01% of the total nucleic acid, which is easily masked by host nucleic acid and microbial nucleic acid. A large amount of sequencing data (usually >20Gb / sample) is required to capture the target sequence, resulting in low detection efficiency; 2) High cost. The cost of a single test exceeds 2,000 yuan, making it difficult to apply to large-scale, routine monitoring; 3) High data analysis threshold. A professional bioinformatics team is required to perform data filtering, virus sequence assembly, and mutation analysis, which is difficult for grassroots laboratories to carry out; 4) RNA in wastewater is easily degraded, and the sequencing success rate is low without specific enrichment.

[0011] (4) Virus isolation and culture method

[0012] Although this method is the gold standard for virus detection, it is almost impossible to apply in wastewater testing because: 1) the viral load in wastewater is low and there are a large number of inhibitors, resulting in a virus isolation success rate of less than 10%; 2) it takes a very long time, requiring 7-14 days from sample processing to obtaining the isolation result, which cannot meet the needs of early warning of an epidemic; 3) the operation is cumbersome and requires a biosafety level 2 or higher laboratory, with high requirements for experimental conditions.

[0013] The shortcomings of the aforementioned influenza virus detection technologies in wastewater will lead to delayed epidemic early warning, missed detection of low-load samples, lack of mutation monitoring, distorted test results, and difficulties in promoting large-scale monitoring. Therefore, providing a highly sensitive, highly specific, genome-wide covered, and easy-to-operate method for detecting influenza virus in wastewater is an urgent technical problem to be solved. Summary of the Invention

[0014] Based on this, the present invention provides a targeted capture probe library suitable for detecting influenza virus in wastewater. This probe library is compatible with both clinical and wastewater samples, exhibits strong anti-interference capabilities, and can target and acquire the whole genome information of the influenza virus. Furthermore, the present invention provides a kit containing the targeted capture probe library, which can be used to construct an influenza virus gene library, facilitating the detection and analysis of influenza virus in wastewater. In addition, the present invention also provides a method for constructing an influenza virus gene library in wastewater and a method for detecting influenza virus. The gene library is constructed using this method, and high-throughput sequencing analysis is further performed on the gene library to determine the influenza virus infection status in the sample. This method can detect influenza virus in wastewater samples as low as 10... 2 The test can detect influenza virus nucleic acid at a rate of 1 copy / L, covering major subtypes such as H1N1 and H3N2 influenza A and the Victoria / Yamagata lineage of influenza B.

[0015] This invention includes the following technical solutions:

[0016] In a first aspect, the present invention provides a probe library for targeted capture of influenza virus genes in wastewater, characterized in that the probe library consists of biotin-modified capture probes, the capture probe sequences being designed in a shingled manner to cover the genomic sequences of the genes shown in Table 1.

[0017] In some embodiments of the present invention, the capture probe is 100-120 bp in length and the overlap between probes is 10-20 bp.

[0018] In a specific embodiment of the present invention, the capture probe is 100 bp in length and the overlap area between probes is 20 bp.

[0019] Table 1 Influenza virus genes

[0020]

[0021] The capture probe can be composed of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), and the probe can be bound to magnetic beads, glass slides, or thin films.

[0022] In this invention, the capture probe for targeting and capturing influenza virus genes in wastewater has the following characteristics:

[0023] (1) Length 100 bp;

[0024] (2) Tm value 60-65℃;

[0025] (3) GC content 45-55%;

[0026] (4) No self-complementary sequences or cross-probe homologous sequences;

[0027] (5) Targets the entire genome of influenza A, B, C, and D viruses, 13.5-15 kb;

[0028] (6) The cross-reactivity rate with common viruses and bacteria in sewage is less than 0.1%.

[0029] In one specific embodiment of the present invention, the probe library for targeted capture of influenza virus genes in sewage consists of 2036 capture probes as shown in Table 2.

[0030] The wastewater referred to in this invention refers to water discharged during residential activities, including domestic sewage, industrial wastewater, and wastewater from sewage treatment plants. Importantly, the wastewater in this invention originates from urban sewage, specifically water generated during a human production or daily life process that has lost its value or is unusable.

[0031] Secondly, the present invention provides an application of the probe library described in the first aspect of the present invention in the preparation of products for detecting influenza viruses in wastewater.

[0032] The products include, but are not limited to, reagent kits, test strips, membrane strips, chips, or detection platforms.

[0033] Thirdly, the present invention provides a kit for detecting influenza virus in sewage, characterized in that the kit includes the probe library described in the first aspect of the present invention.

[0034] The kit also includes other standard reagents required for high-throughput sequencing.

[0035] Furthermore, the kit also includes conventional reagents for constructing gene libraries based on next-generation gene sequencing, including but not limited to nucleic acid fragmentation reagents, reverse transcriptase, universal adapters, and nucleic acid amplification primers.

[0036] Furthermore, the kit also includes conventional reagents for liquid-phase hybridization capture, including but not limited to hybridization capture mixtures, streptavidin magnetic beads, capture binding buffers, capture washing buffers, nucleic acid amplification mixtures for library amplification, and magnetic bead purification reagents.

[0037] Unless otherwise specified in this invention, the above-mentioned conventional reagents can all be obtained through commercial purchases.

[0038] Fourthly, the present invention provides a method for constructing an influenza virus gene library from wastewater, the method comprising the following steps:

[0039] (1) RNA was extracted from sewage samples and cDNA was obtained by reverse transcription;

[0040] (2) Fragment the cDNA to obtain DNA fragments;

[0041] (3) Repair the ends of the DNA fragments, add dA tails, ligate adapters to obtain ligation products, and amplify by PCR to obtain the initial library;

[0042] (4) Using the probe library described in the first aspect of the present invention, the initial library is hybridized and captured to obtain the target fragment;

[0043] (5) Perform PCR amplification and purification on the target fragment to obtain a gene library.

[0044] The method for extracting RNA in step (1) is a conventional method used by those skilled in the art, including extraction using a commercially available kit. Preferably, the cDNA concentration in step (1) is ≥1 ng / μL.

[0045] Preferably, the connector described in step (3) is a universal connector, which also includes a label.

[0046] In some embodiments of the present invention, when the concentration of the probe library in step (4) is 10-15 μM, the mixing ratio of the initial library and the probe library is (500-600) ng: (4-5) μL, preferably 500 ng: 4 μL.

[0047] Preferably, the hybridization capture system in step (4) further includes a blocking agent. In a specific embodiment of the present invention, the blocking agent includes a host blocking agent, a microbial blocking agent, and a universal adapter blocking agent. The host blocking agent and the microbial blocking agent are gene sequences targeting repetitive sequences in the human host genome and conserved sequences in microorganisms in wastewater. Their function is to prevent the probe from binding to non-target nucleic acids, and they are commercially available products. The universal adapter blocking agent is a synthetically produced short oligonucleotide whose sequence is complementary to the complete adapters (P5 / P7, Index tag regions) at both ends of the sequencing library. It often carries LNA / phosphate modification and has no 3' extension activity; it is also a commercially available product.

[0048] Unless otherwise specified, the primers used for PCR amplification in steps (3) and (4) of this invention are universal standard amplification primers, which can be purchased commercially.

[0049] The purification and amplification product method described in step (5) is selected from magnetic bead purification, purification column purification, or 2% agarose gel electrophoresis purification.

[0050] Fifthly, the present invention provides a method for detecting influenza virus in wastewater, the method comprising the following steps:

[0051] (1) An influenza virus gene library is constructed using the method described in the fourth aspect of the present invention;

[0052] (2) Perform high-throughput sequencing on the gene library to obtain sequencing results;

[0053] (3) Perform data analysis on the sequencing results to determine whether the sewage contains influenza virus and perform subtype classification.

[0054] In a sixth aspect, the present invention provides a system for detecting influenza virus in sewage, characterized in that the system comprises: a gene library construction module, a high-throughput sequencing module, and a gene analysis module;

[0055] The gene library construction module adds tags to the sample DNA and uses the probe library described in the first aspect of the present invention to capture the target fragment.

[0056] The high-throughput sequencing module is connected to the gene library construction module and is used to sequence the captured target fragments to obtain influenza virus sequence information.

[0057] The gene analysis module is connected to the high-throughput sequencing module and is used to perform data analysis on the sequence information obtained by the high-throughput sequencing module to obtain influenza virus mutation and / or typing information.

[0058] Compared with the prior art, the technical solution provided by the present invention has the following beneficial effects:

[0059] (1) High sensitivity: The detection capability of low-load samples is improved by 10-100 times.

[0060] Detectable as low as 10 2 The detection limit for influenza virus nucleic acid is 10 times lower than that of traditional RT-qPCR and 100 times lower than that of metagenomic sequencing. For partially degraded viral nucleic acid in sewage, the detection rate is over 90% through whole-genome probe enrichment, while the detection rate of traditional RT-qPCR is less than 30%, meeting the "whole-area monitoring" needs of sewage pipe network end and low infection rate areas.

[0061] (2) High specificity: It eliminates interference from complex substrates in wastewater and significantly increases the proportion of target sequences.

[0062] The probe library is designed with specific conserved regions of influenza virus, and the cross-reactivity rate with common novel coronaviruses, respiratory syncytial virus, adenovirus, norovirus and bacterial nucleic acids in sewage is <0.1%. In complex sewage samples, the proportion of target sequence (influenza virus cDNA) is increased by more than 50% (the proportion of target sequence in traditional metatranscriptome sequencing is usually <0.01%, and RT-qPCR is prone to false negatives due to matrix interference), while the false negative / false positive rate is <1%, and the detection results can be directly used for epidemic risk assessment.

[0063] (3) Whole genome coverage: Simultaneously achieve subtype classification and variation monitoring

[0064] The probe library covers the entire influenza virus genome of 13.5-15 kb, with a genome coverage rate of over 98% after sequencing. It can simultaneously perform: ① subtyping, accurately identifying influenza A, B, and specific subtypes; ② mutation site analysis, detecting mutation sites in key genes such as HA and NA; ③ evolutionary analysis, constructing a viral evolutionary tree, tracing the source of transmission, solving the problem of "information fragmentation" in existing technologies, and achieving comprehensive virus monitoring.

[0065] (4) Simple operation and high throughput: The database construction time is shortened, which is suitable for large-scale routine monitoring.

[0066] Process integration: The "viral nucleic acid extraction-reverse transcription-library preparation-hybridization capture" process is integrated into a single workflow, reducing library preparation time to 6-8 hours; Platform compatibility: No special instruments are required, and the library can be directly used on mainstream sequencing platforms such as Illumina and MGI without additional adaptation or modification; Sample compatibility: It can handle various types of samples, such as urban domestic sewage, hospital sewage, and inbound aircraft, without the need for complex sample pretreatment.

[0067] (5) Cost-effectiveness: Costs are reduced by more than 40% for large-scale applications.

[0068] ① Redundant probe library design: Through a "simplified probe library" covering core genes and the entire genome, it covers the mainstream subtypes of type A, B, C, and D, avoiding over-design and reducing the cost of a single probe by 30%; ② Optimized sequencing cost: The proportion of target sequences is increased by more than 50%, and the sequencing data volume is only 1-2Gb / sample. The total cost of a single test is 40% lower than that of metagenomic sequencing and 25% lower than that of the traditional "RT-qPCR + gene sequencing" combination test, making it suitable for large-scale, routine wastewater monitoring by disease control centers and environmental monitoring departments. Attached Figure Description

[0069] Figure 1 This is a flowchart of a targeted capture and sequencing method for influenza viruses in wastewater.

[0070] Figure 2 Flowchart for probe capturing target fragments. Detailed Implementation

[0071] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0072] Example 1: Design of a probe for targeted capture of influenza virus in wastewater

[0073] Probe design concept as follows Figure 2 As shown, based on the 13.5-15 kb complete genomes of influenza viruses A, B, C, and D, the study covers influenza A virus (including common human subtypes: H1N1, H3N2); important zoonotic subtypes: H5N1, H5N6, H7N9, H9N2, H1N1, H1N2, H3N2, H3N8, H7N7, etc.; influenza B virus (including two lineages, Victoria and Yamagata); influenza C virus; and influenza D virus. The sequences of all strains have been fully analyzed and are searchable in NCBI.

[0074] The probes shown in this invention are represented by a GenBank accession number and a specific genomic location. For example, NC_026431.1:0-100 represents the sequence of A / California / 07 / 2009(H1N1): ATGAGTCTTCTAACCGAG GTCGAAACGTACGTTCTTTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTGGAAAGTGTCTTTGCAG (SEQ ID NO.1). This invention designs probes based on the following three core regions:

[0075] 1) Conserved structural genes: HA (hemagglutinin gene, containing antigenic determinant region), NA (neuraminidase gene, anti-influenza drug target region), M (matrix protein gene, viral core structural region), NP (nucleoprotein gene, viral typing core region), ensuring subtype specificity and conservation.

[0076] 2) Replication-related genes: PB1, PB2, PA (polymerase genes, which determine viral replication capacity and pathogenicity), covering key functional sites.

[0077] 3) Whole genome coverage: Probes are designed for the whole genome ORF region of influenza virus to cover all coding regions. The coverage density is "one probe every 60 bp with 20 bp overlap between probes" to ensure that each ORF region is covered by at least 2 probes. The strategy to fill the gaps in the sequence of conserved genes is to identify the gap regions between conserved genes through whole genome sequence alignment, and design probes for these regions to form a full-coverage probe pool of "core genes + gap filling" to ensure that no part of the whole genome is missed.

[0078] The probe parameters required for this invention are as follows:

[0079] 1) Length: 100 bp; avoid non-specific binding caused by being too short (<60bp, fewer hydrogen bonds, easy dissociation) or too long (>150bp, easy to form stem-ring secondary structure).

[0080] 2) Calculate the Tm value using the Nearest-Neighbor method. Tm value: 60-65℃ (matching the hybridization temperature).

[0081] 3) GC content: 45-55% (to avoid the formation of secondary structures); at the same time, exclude extreme regions in the genome with GC content <30% or >60% to ensure uniform hybridization efficiency.

[0082] 4) No self-complementary sequences or cross-probe homologous sequences (homology <80%).

[0083] 5) The probe blocking component is the same length as the probe, targeting non-target sequences that may exist in the wastewater (specifically, nucleic acids of other viruses such as enteroviruses, adenoviruses, and noroviruses, as well as nucleic acid fragments bound to bacterial nucleic acids, human host nucleic acids, and environmental humic substances in the wastewater), reducing background interference.

[0084] 6) The cross-reactivity rate with common viruses and bacteria in wastewater is less than 0.1%. During the probe design stage, all candidate probe sequences are compared with the whole genome sequences of enteroviruses, adenoviruses, noroviruses, Escherichia coli, and Salmonella in the NCBI database using BLAST, and probes with homology <80% are screened. In the in vitro validation stage, the probes are hybridized with the nucleic acids of the pure cultures of the above-mentioned non-target viruses and bacteria, and the hybridization signal intensity is detected. Probes with a hybridization signal ratio >0.1% are removed. Hybridization conditions are optimized by strictly controlling the Tm value (60-65℃) to match the hybridization temperature and inhibiting non-specific binding with high-specificity buffer components, ultimately ensuring that the cross-reactivity rate is less than 0.1%.

[0085] Based on the above strategy, the present invention designed the biotin-labeled DNA probes shown in the table below as a probe library for targeted capture of influenza viruses in sewage.

[0086] Table 2. Probe library obtained by screening in this invention

[0087]

[0088] Example 2: Targeted capture and sequencing method for influenza virus in wastewater

[0089] (1) Preparation of sewage samples

[0090] Urban wastewater from a wastewater treatment plant covering a population of over 300,000 was collected in 500 mL. After filtration and concentration through a 0.22 μm filter membrane, total RNA was extracted using a viral RNA extraction kit. An RNase inhibitor was added to prevent RNA degradation, and the RNA was reverse transcribed into cDNA. The cDNA was purified using a magnetic bead method with an elution volume of 30 μL. The purified cDNA was mixed with Qubit reagent, and the fluorescence intensity was measured using a Qubit fluorometer. The cDNA concentration was calculated based on the standard curve to ensure that the concentration was ≥1 ng / μL.

[0091] (2) Constructing a gene library

[0092] The library was constructed using the FocusPath™ RNA Pathogen Capture Library Construction Kit (Illumina), catalog number FPR21003, developed by MicroFocus Technology (Beijing) Co., Ltd.

[0093] The database creation process is as follows: Figure 1As shown, random fragments were reverse transcribed into cDNA, with fragment lengths concentrated between 200-250 bp, resulting in blunt ends for all fragments. Polynucleotide kinase was used to phosphorylate 5'-OH to 5'-P, providing substrate for subsequent adapter ligation. dNTP Mix was used as a polymerase substrate to fill in the ends, adding an "A" tail to the 3' end of the blunt-ended fragments to form a 3'-A overhang. Universal adapters were ligated to both ends of the above fragment sequences, and the sequences were purified using magnetic beads to remove free adapters, enzymes, and salts. Washing with 80% ethanol removed PEG, ATP, and proteins, keeping the cDNA on the magnetic beads. Elution followed by low-salt desorption yielded an initial library with adapters. The initial library was amplified by PCR, purified with magnetic beads, with precise control of the main peak. Primer dimers were removed to obtain the initial library at a concentration of 20 ng / μL.

[0094] (3) Hybrid capture

[0095] 500 ng of the initial library (25 μL) was mixed with 4 μL of the 10 μM influenza virus probe library shown in Table 2, and then mixed with Micro Probe hybridization capture mixture. Pre-hybridization was performed after mixing to obtain the probe-library complex. The initial library provides the target cDNA molecule to be captured. The influenza virus probe hybridizes complementaryly with conserved regions (structural genes / replication genes / whole genome) of the influenza virus in the library, forming a biotin-probe-target ternary complex, providing a "hook" for subsequent streptavidin magnetic bead capture. The blocking factor binds to non-target sequences in the initial library, preventing non-specific binding of the probe to non-target sequences and reducing background signal.

[0096] Micro Probe hybridization capture mixture is premixed with various blocking agents required for hybridization, specifically including:

[0097] ① Universal Blockers (10 μM): These are fully complementary to the universal adapter sequences used in library construction, preventing non-specific binding of the probe to the library adapter sequences. (IDT xGen, catalog number 1075475).

[0098] P5 blocker (SEQ ID NO.2): 5′-AATGATACGGCGACCACCGAGATCTACAC-3′ (containing locked nucleotide / hypoxanthine modification)

[0099] P7 blocker (SEQ ID NO.3): 5′-CAAGCAGAAGACGGCATACGAGAT-3′ (3′ end MGB modification)

[0100] ② Host blocking agent (COT DNA, concentration 100 ng / μL): Targets repetitive sequences of the human host genome in wastewater, preventing the probe from binding to non-target nucleic acids. (Cot-1 DNA (Human Cot-1 DNA) catalog number 15279011, Invitrogen).

[0101] ③ Pathogen Blocking Oligo Mix: Conserved microbial sequences, mixed oligonucleotide fragments, targeting a broad spectrum of conserved microbial homologous sequences: 16S rRNA, 23S rRNA, housekeeping genes, and bacterial universal repeat elements. (Catalog No.: 5190-8811 (Pathogen Blocking Oligo Mix, broad-spectrum bacterial / fungal 16S / 23S blocking), Agilent)

[0102] Three volumes of DNA purification magnetic beads were added for binding and purification, allowing the magnetic beads to bind to the library. Magnetic bead separation technology was used to separate the library-bound magnetic beads from the unbound material, followed by elution to obtain the purified library-probe complex.

[0103] The hybridization capture system was denatured at 85°C and then hybridized at 60°C for 2 hours.

[0104] After hybridization, 100 μL of streptavidin magnetic beads and 200 μL of capture-binding buffer were added. The probe-library complex was captured by magnetic beads at 25 °C for 30 min to enrich the target sequence. The capture-binding buffer accelerated the binding reaction, shortened the capture time, and improved the experimental efficiency.

[0105] The influenza virus enriched library was obtained after washing at 65 °C to remove non-specific bindings; washing at 65 °C also removed non-specific sequences that bound at lower temperatures.

[0106] (4) Capture amplification and purification

[0107] The probe capture library was amplified using nucleic acid amplification buffer (high-fidelity enzyme). After amplification, the library was purified by adding 90 μL of magnetic beads. The purified library was separated from the unbound material using magnetic bead separation technology to obtain a purified enriched library. The purified enriched library was mixed with Qubit reagent, and the fluorescence intensity was measured using a Qubit fluorometer. The concentration of the library was calculated according to the standard curve, and the final library concentration was 5 ng / μL.

[0108] (5) Sequencing and analysis

[0109] Sequencing parameters: The library was sequenced at both ends (2×150 bp) on the Illumina NovaSeq platform, with a single sample sequencing data volume of 1.5 Gb and a sequencing quality requirement of Q30≥85%.

[0110] Bioinformatics analysis workflow:

[0111] 1) Raw data filtering: Use Trimmomatic software to remove low-quality reads (Q<20), adapter sequences, and contaminated sequences;

[0112] 2) Target sequence enrichment: The filtered data is compared with the probe sequence to capture homologous sequences (comparison threshold identity≥95%).

[0113] 3) Genome assembly: The entire influenza virus genome was assembled using SPAdes 3.15.5 software to obtain scaffolds sequences;

[0114] 4) Gene annotation and variation analysis: Influenza virus genes are annotated using the FLUDB database, and mutation sites of key genes such as HA and NA are detected;

[0115] 5) Subtype classification: Based on the HA and NA gene sequences, the virus subtype is determined by comparison with the NCBI influenza virus database.

[0116] Reference settings:

[0117] ① Blank control: Nuclease-free water was used to replace the sample. The entire experimental procedure was followed to verify that the reagents and operations were free from contamination.

[0118] ② Negative control: Wastewater samples known to be free of influenza virus (verified negative by traditional RT-qPCR) were used to verify capture specificity and avoid false positives.

[0119] In the detection of a specific sample (sewage sample from a key location) in this invention, the bioinformatics analysis results are as follows:

[0120] ① Genome coverage: 99.5% (ORF region coverage 100%, no gaps).

[0121] ② Sequencing depth: Average depth 620× (HA gene depth 780×, NA gene depth 720×).

[0122] ③ Target sequence percentage: 52.3% (Influenza virus cDNA accounts for the proportion of total sequencing data, while non-target sequences account for 47.7%, of which human host sequences account for 18.5%, bacterial sequences for 22.3%, and other viral sequences for 6.9%).

[0123] ④ Detection of mutation sites: The HA gene G158E mutation (nucleotide mutation: G→A) was detected, suggesting that the viral antigenicity may have changed.

[0124] ⑤ Subtype classification results: Based on the comparison of HA and NA gene sequences, the virus was identified as subtype A H3N2.

[0125] ⑥ Evolutionary analysis: This strain shares 99.8% homology with the H3N2 strain isolated clinically in the local area, suggesting that the virus in the sewage originated from local human infection.

[0126] Example 3: Kit for detecting influenza virus in wastewater

[0127] (1) Kit components

[0128] The kit for detecting influenza virus in wastewater provided by this invention has the following composition as shown in the table below.

[0129] Table 3 Reagent Kit

[0130]

[0131] Note: UDI primers are index primers for library PCR amplification, used to distinguish different samples (adapted to multiplex sequencing). Their sequences are not homologous to the influenza virus genome and are only responsible for introducing sequencing adapters and sample tags. The influenza virus probes mentioned in Table 3 are the 2036 capture probes targeting the influenza virus genome in Table 2, which are responsible for specifically binding to the target sequence. The two are functionally independent and work together to complete the "library construction-capture" process.

[0132] (2) Kit preparation method

[0133] ① Preparation of influenza virus probe mixture: Dissolve 2036 core probes in probe preservation solution, adjust the concentration to 10μM, aliquot into 4μL / tube, and store at -20℃ in the dark.

[0134] ② Reagent dispensing and sterilization: Dispense and store each reagent according to the contents shown in Table 3.

[0135] ③ Quality control verification: Take one tube of influenza virus standard and perform library preparation and sequencing analysis according to the method described in Example 1. The following conditions must be met: cDNA concentration after extraction ≥1 ng / μL, initial library concentration ≥20 nM, target sequence ratio of enriched library after hybridization capture ≥40%, genome coverage ≥98%, and ensure that the kit is qualified.

[0136] ④ Assembly and Packaging: Pack the reagents, instructions and quality control reports of each module into the reagent kit box in sequence, transport at 4℃ and store at -20℃ for long-term storage (enzyme reagents should be stored separately at -80℃, and streptavidin magnetic beads should be stored at 4℃).

[0137] Example 4: Sensitivity Comparison

[0138] Sample preparation: The standard strain of influenza A H1N1 virus (A / California / 07 / 2009 (H1N1)pdm09) was serially diluted with PBS buffer to 10⁻⁶.6 10 5 10 4 10 3 10 2 Simulated samples were prepared by adding 10 copies / L of sterile wastewater matrix, with three replicates for each concentration. The method of this invention was used to construct libraries and sequence samples of each concentration, while traditional RT-qPCR (target gene M) and metagenomic sequencing were used as controls. The results of the detection of samples of each concentration are shown in the table below.

[0139] Table 4 Quantitative Table of Detection Results for Samples of Different Concentrations

[0140]

[0141] Conclusion: The method provided by this invention works at an influenza virus concentration of 10... 2 It can detect concentrations of copies / L and above, with a genome coverage of ≥90% and 100% consistency in duplicate samples; its sensitivity is significantly better than traditional RT-qPCR (10-fold) and metagenomic sequencing (100-fold).

[0142] Example 5: Interference detection of complex substrates in wastewater

[0143] Simulated sample preparation: Take 500 mL of urban domestic sewage (without influenza virus), add influenza A H3N2 virus (A / Hong Kong / 1 / 1968 (H3N2)) (10 3 (Copy / L), Enterovirus (EV-A71 BrCr strain) (10) 6 (Copy / L), adenovirus (strain Adenoid 75) (10) 5 (Copy / L), Escherichia coli (E. coli K-12 MG1655) (10) 8 (CFU / L), prepare mixed contaminated samples, set up 3 replicates; detection comparison: use the method of this invention, traditional RT-qPCR, and metatranscriptome sequencing respectively for detection.

[0144] The results show:

[0145] The method of this invention: the target sequence of influenza virus accounted for 50.2%±2.6%, the genome coverage was 97.5%±1.3%, and the HA, NA, M, and PB2 genes were all detected completely, and the T215N mutation of the HA gene was detected; the proportion of non-target sequences was 49.8% (enterovirus 12.5%±1.3%, adenovirus 7.8%±0.6%, Escherichia coli 22.6%±1.8%, human host sequence 6.9%±0.5%), and there were no false negatives / false positives.

[0146] Traditional RT-qPCR: Two replicate samples had Ct values ​​>38 (false negatives) due to the inhibition of enzyme activity by sewage matrix and bacteria, and one sample had a Ct value of 32.1 (positive). It could only confirm the presence of influenza virus and could not detect mutation sites.

[0147] Metatranscriptome sequencing: Influenza virus sequence accounted for 0.3%±0.1%, sequencing depth 10×, unable to assemble the genome completely (coverage 58%), key genes HA and NA were not completely detected; non-target sequences accounted for 99.7% (enterovirus 35.2%, adenovirus 28.5%, Escherichia coli 25.8%, human host sequence 10.2%).

[0148] Conclusion: The method provided by this invention has strong anti-interference ability in complex sewage samples and its information integrity is significantly better than the control method.

[0149] Example 6: Comparison with multiplex amplicon assay in human and wastewater samples

[0150] 1. Sample preparation

[0151] 1.1 Collection of Human Samples: 150 pharyngeal swab samples were collected from influenza-like illness cases, of which 90 were confirmed positive for influenza A by RT-qPCR, 30 were positive for influenza B, and 30 were negative controls; the viral load gradient of the positive samples covered 10... 2 10 3 10 4 10 5 10 6 Copy / mL, 24 cases per gradient. Total RNA was extracted from all samples using the same magnetic bead-based viral nucleic acid extraction kit, and cDNA was synthesized by reverse transcription. The samples were then divided into two aliquots for testing.

[0152] 1.2 Wastewater Sample Collection: 500 mL of wastewater from the inlet of a municipal wastewater treatment plant was collected, filtered through a 0.45 μm filter membrane, and enriched by ultracentrifugation to prepare simulated wastewater samples. A gradient concentration of influenza A / B virus (10...) was added to these samples. 2 10 3 10 4 10 5 10 6 (Copies / mL), 16 cases per gradient; an additional 20 cases were included as a negative control from natural sewage. RNA was extracted using the same method and reverse transcribed into cDNA, and each sample was divided into two portions for testing.

[0153] 1.3 Detection Methods

[0154] Experimental group: The liquid-phase probe capture method provided by this invention was used. The probes were the 2036 influenza virus-specific probes shown in Table 2 of this invention. Library preparation, hybridization capture and sequencing analysis were completed according to the steps provided in Example 2.

[0155] Control group: A commercially available influenza A / B virus multiplex amplicon detection kit (multiplex PCR-sequencing method, Beijing Zhuocheng Huisheng) was used. Multiplex PCR amplification, library preparation, product purification and sequencing analysis were performed strictly according to the instructions.

[0156] 2. Results show

[0157] 2.1 Results of human sample testing

[0158] High load capacity (≥10) 4 (Copies / mL): Both methods had a positive detection rate of 100%, and the subtype classification was consistent.

[0159] Medium load (10) 3 (Copies / mL): The detection rate of this invention is 97.2%, while that of multiplex amplicon assay is 86.1%.

[0160] Low load (10) 2 (Copies / mL): The detection rate of this invention is 91.7%, while that of multiplex amplicon assay is only 29.2%.

[0161] Genome coverage: The whole genome coverage of this invention is ≥95%, while that of multiplex amplicon methods is only 15-20%, covering only the primer-targeted fragment.

[0162] 2.2 Wastewater sample test results

[0163] High load capacity (≥10) 5 (Copy / L): The detection rate of this invention is 100%, while that of multiplex amplicon assay is 68.8%.

[0164] Medium load (10) 4 (Copy / L): The detection rate of this invention is 93.8%, while that of multiplex amplicon assay is 25.0%.

[0165] Low load (≤10) 3 (Copy / L): The detection rate of this invention is 81.3%, while the multiplex amplicon assay has a detection rate of 0% (all false negatives).

[0166] Interference resistance: Inhibitors such as humic acid, heavy metals, and miscellaneous bacteria in sewage lead to a false negative rate of 56.3% in the multiple amplicon method; the present invention has a false negative rate of only 3.1%, demonstrating extremely strong interference resistance.

[0167] Time efficiency: The entire process of this invention takes 12 hours (including 8 hours of hybridization, which can be overnight), with 3 hours of manual operation; the multiplex amplicon method takes 8 hours, with 4 hours of manual operation, and requires full monitoring of the amplification cycle.

[0168] 3. Conclusion

[0169] Multiplex amplicon assays can only obtain partial conserved viral sequences, failing to cover the entire genome and thus hindering viral mutation monitoring and tracing. Furthermore, they exhibit strong primer dependence and poor tolerance to wastewater substrates, failing to meet the needs of wastewater environmental monitoring. The liquid-phase probe capture method provided in this invention is significantly superior to multiplex amplicon assays in terms of compatibility with human and wastewater samples. Specific analysis follows:

[0170] Human samples: This invention has a significantly higher detection rate for low-load samples, can obtain the complete genome sequence, and supports variant analysis; the multiplex amplicon method has a weak detection capability for low-load samples and can only obtain fragment information.

[0171] Wastewater samples: Multiplex amplicon assays are severely affected by the complex matrix of wastewater, and low-load samples cannot be detected at all, which has serious limitations; this invention has strong anti-interference ability, can still stably detect low-load wastewater samples, and has extremely strong adaptability.

[0172] Versatility: This invention can be adapted to both human clinical samples and wastewater environmental samples, achieving the integration of "clinical diagnosis + environmental monitoring"; multiplex amplicon assay is only applicable to high-load human samples and cannot be used for wastewater monitoring, limiting its application scenarios.

[0173] Example 7: Time Comparison with Traditional Methods

[0174] The time difference between the method provided by this invention and traditional detection / library construction methods is shown in the table below.

[0175] Table 5. Time difference between the method of this invention and traditional detection / library construction methods

[0176]

[0177] Comparison of time consumption: The total time for library construction using the multiple amplicon method is similar to that of the method of this invention, but the process has extremely high requirements for the sample matrix. Due to the interference of inhibitors, sewage samples often need to be repeatedly amplified and optimized, and the actual time consumption often exceeds the nominal time.

[0178] Differences in information acquisition: Multiplex amplicon assays can only obtain conserved fragments targeted by primers and cannot obtain whole genome information; while the method of this invention can directly complete whole genome capture and library construction in a similar time, and is compatible with human and sewage samples.

[0179] As can be seen from the examples, the detection method adopted in this invention achieves a balance between detection performance and application cost compared with traditional methods. It can accurately detect low-load influenza viruses in wastewater, analyze whole-genome information, and perform high-throughput detection, providing key technical support for early warning of influenza outbreaks, monitoring of viral mutations, and tracing the source of transmission. It is suitable for large-scale, routine applications in disease control centers, public health, and water environment monitoring. The detection method provided by this invention is a universal influenza virus detection technology that is adaptable to both clinical and wastewater samples, has strong anti-interference capabilities, and can obtain whole-genome information.

[0180] The above specific embodiments are merely illustrative of the invention and do not represent a limitation thereof. Those skilled in the art will recognize that other variations of the specific structure of this invention are possible.

Claims

1. A probe library for targeted capture of influenza virus genes in wastewater, characterized in that, The probe library consists of capture probes, which are designed in a shingled pattern to cover the genomic sequences of the genes shown in Table 1. The capture probes are 100-120 bp in length and have an overlap of 10-20 bp between them.

2. The probe library according to claim 1, characterized in that, The capture probe is 100 bp in length, and the overlap between probes is 20 bp.

3. The use of the probe library of claim 1 or 2 in the preparation of products for detecting influenza viruses in wastewater, said products comprising reagent kits, test strips, membrane strips, chips, or detection platforms.

4. A kit for detecting influenza virus in wastewater, characterized in that, The kit includes the probe library as described in claim 1 or 2.

5. The reagent kit according to claim 4, characterized in that, The kit also includes standard reagents for high-throughput sequencing, gene library construction, and liquid-phase hybridization capture.

6. A method for constructing an influenza virus gene library from wastewater, the method comprising the following steps: (1) RNA was extracted from sewage samples and cDNA was obtained by reverse transcription; (2) Fragment the cDNA to obtain DNA fragments; (3) Repair the ends of the DNA fragments, add dA tails, ligate adapters to obtain ligation products, and amplify by PCR to obtain the initial library; (4) Using the probe library described in claim 1 or 2, hybridize and capture the initial library to obtain the target fragment; (5) Perform PCR amplification and purification on the target fragment to obtain a gene library.

7. The method according to claim 6, characterized in that, In step (4), when the concentration of the probe library is 10-15 μM, the mixing ratio of the initial library and the probe library is (500-600) ng: (4-5) μL.

8. The method according to claim 6, characterized in that, The hybridization capture system in step (4) also includes blocking components, which include host blocking components, microbial blocking components and universal adapter blocking components.

9. A method for detecting influenza virus in wastewater, the method comprising the following steps: (1) An influenza virus gene library is constructed using the method described in any one of claims 6-8; (2) Perform high-throughput sequencing on the gene library to obtain sequencing results; (3) Perform data analysis on the sequencing results to determine whether the sewage contains influenza virus and perform subtype classification.

10. A system for detecting influenza virus in wastewater, characterized in that, The system includes: a gene library construction module, a high-throughput sequencing module, and a gene analysis module; The gene library construction module adds tags to the sample DNA and captures the target fragment using the probe library described in claim 1 or 2. The high-throughput sequencing module is connected to the gene library construction module and is used to sequence the captured target fragments to obtain influenza virus sequence information. The gene analysis module is connected to the high-throughput sequencing module and is used to perform data analysis on the sequence information obtained by the high-throughput sequencing module to obtain influenza virus mutation and / or typing information.

Images