A high-throughput detection system based on multiple isotope-encoded microspheres

Abstract

The application discloses a high-throughput detection system based on multiple isotope coding microspheres, which solves the technical problem that the prior art cannot simultaneously detect multiple biomarkers with large coding capacity. The high-throughput detection system based on multiple isotope coding microspheres comprises: microspheres; a plurality of nucleic acid coding probes coupled to the surface of the microspheres, wherein the nucleic acid coding probes are assembled in series through orthogonal reaction of a detection probe combination, and the detection probe combination comprises: a detection probe P1; a detection probe P2, a detection probe P3; the detection probes P1, P2 and P3 are assembled in series through orthogonal reaction in a P1-[P2-P3] n or P1-P2-[P3-P2] n‑1 mode. The application can be used for functionalization of multiple recognition molecules such as antibodies, nucleic acid aptamers and nucleic acid capture probes, can realize simultaneous high-throughput detection of multiple different types of biomarkers such as proteins and nucleic acids on a single platform, significantly improves detection efficiency and information throughput, and is suitable for large-scale biomarker screening and multi-omics joint analysis.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to a high-throughput detection system based on multiple isotope-encoded microspheres. Background Technology

[0002] The detection of biomarkers such as specific antigens, antibodies, and nucleic acid molecules in blood plays a crucial role in vaccine efficacy evaluation, epidemiological surveillance, virus transmission screening, and diagnosis of autoimmune diseases. Rapid, low-cost, highly parallel, and repeatable detection of biomarkers in small-volume samples is of great significance. High throughput is a major bottleneck when multiple biomarkers and large numbers of samples need to be detected. In immunoassays, the classic enzyme-linked immunosorbent assay (ELISA) is widely used due to its simplicity, high sensitivity, and good specificity. However, ELISA can only detect one target molecule at a time, and cost and time limitations severely hinder its application in high-throughput detection. To improve throughput, Luminex Corporation has used fluorescent groups to encode microspheres, enabling the simultaneous detection of more than eighty target molecules in a single sample. However, spectral overlap of fluorophores limits further increases in the number of fluorescently encoded molecules, thus limiting the scalability of fluorescently encoded microspheres. In nucleic acid testing, polymerase chain reaction (PCR), as the gold standard, can only detect one target molecule per tube when using SYBR Green fluorescent dye. Even with TaqMan probes, the throughput is only increased by 3-5. Therefore, high-throughput detection of biomarkers such as antigens, antibodies, and nucleic acid molecules remains a challenge.

[0003] Single-cell mass cytometry (CyTOF) is a high-throughput single-cell analysis technique that combines flow cytometry and mass spectrometry, and has been widely used in cell analysis over the past decade. This technique uses antibodies that bind to isotopes of enriched rare-earth elements to perform routine analysis of more than 50 parameters per cell, providing dynamic mass spectra at a rate of approximately 1000 events per second, one event at a time. This technique overcomes the fluorescence overlap limitation of flow cytometry, theoretically allowing for hundreds of detection channels without interference. Therefore, when using 38 stable isotopes, the theoretical barcode space is in the hundreds of thousands, significantly exceeding the limitations of existing fluorescent coding methods. However, existing metal ion-doped microsphere coding methods are limited by microsphere volume, making precise control of the ratio of different elements difficult, and metal ion leakage is severe, hindering long-term preservation. Currently, there is a lack of a detection system with large coding capacity that can simultaneously detect multiple biomarkers. Summary of the Invention

[0004] The purpose of this invention is to provide a high-throughput detection system based on multi-isotope encoded microspheres, which solves the technical problem in the prior art that it is impossible to simultaneously achieve a large encoding capacity and the detection of multiple biomarkers.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows: A high-throughput detection system based on multi-isotope encoded microspheres includes: Microspheres; Several nucleic acid-coding probes are coupled to the surface of the microspheres. These nucleic acid-coding probes are assembled in series via an orthogonal reaction using a detection probe assembly, which includes: The detection probe P1, as a basic anchoring probe, has a first active group modified at its 5' end for connecting microspheres and a first orthogonal reactive group modified at its 3' end. The detection probe P2, as an extendable isotope carrier probe, has a second orthogonal reactive group at its 5' end that pairs with the first orthogonal reactive group, and a third orthogonal reactive group at its 3' end. The thymine base in the sequence is modified with a first metal chelating agent. The detection probe P3, as an extendable isotope carrier and terminal functionalized probe, has a fourth orthogonal reactive group that pairs with the third orthogonal reactive group at its 5' end, a fifth orthogonal reactive group at its 3' end, and the thymine base in the sequence is modified with a second metal chelating agent. The detection probes P1, P2, and P3 are orthogonally reacted in the order P1-[P2-P3]. n Or P1-P2-[P3-P2] n-1 The probes are assembled in series, where n is a positive integer ≥1, and when n>1, the adjacent detection probes P2 and P3 are extended through the pairing connection of the third orthogonal reactive group and the fourth orthogonal reactive group or the pairing connection of the second orthogonal reactive group and the fifth orthogonal reactive group.

[0006] In a preferred embodiment, when assembly is terminated, the fifth orthogonal reactive group of the terminal detection probe P3 is exposed on the surface of the microsphere for connecting antibodies, nucleic acid aptamers, or nucleic acid capture probes. Alternatively, when assembly is complete, the third orthogonal reactive group of the terminal detection probe P2 is exposed on the surface of the microsphere for attaching antibodies, nucleic acid aptamers, or nucleic acid capture probes.

[0007] In a preferred embodiment, the first metal chelating agent and the second metal chelating agent respectively chelate an isotope of a rare earth element.

[0008] Based on the above scheme, each detection probe (P2 or P3) is loaded with only a single rare earth element isotope, rather than a mixture of multiple metals. The loading amount of each isotope is determined by the number of thymine bases in the probe sequence, thus eliminating the problems of uncontrollable metal ratios and isotope ratio fluctuations between different batches. By replacing the P2 and P3 probes loaded with different isotopes, specific isotope combination codes can be constructed, resulting in uniform and stable encoded signals with high decoding accuracy.

[0009] In a preferred embodiment, the rare earth element is selected from at least one of La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, and Yb.

[0010] In a preferred embodiment, the surface of the microspheres is modified with streptavidin; The first active group is biotin, and the first orthogonal reactive group is an azide group; The second orthogonal reactive group is dibenzocyclooctylene, and the third orthogonal reactive group is mercapto. The fourth orthogonal reactive group is maleimide, and the fifth orthogonal reactive group is an azide group.

[0011] In a preferred embodiment, the detection probes P1, P2, and P3 are assembled as follows: The 3' azide group of detection probe P1 reacts with the 5' dibenzocyclooctylene of detection probe P2 to form a P1-P2 link; The 3' thiol group of detection probe P2 reacts with the 5' maleimide of detection probe P3 to form a P1-P2-P3 link. When n>1, the 3' end mercapto group of the previous detection probe P2 reacts with the 5' end maleimide of the subsequent detection probe P3, or the 3' end azide group of the previous detection probe P1 reacts with the 5' end dibenzocyclooctylene of the subsequent detection probe P2, thus achieving tandem extension.

[0012] Based on the above scheme, the two orthogonal reactions do not interfere with each other, are mild and highly efficient and specific, and can be carried out sequentially in the same reaction system to achieve the tandem and extension of P1-P2-P3 units. By selecting the extension method (P2-P3 thiol-maleimide connection or P1-P2 azide-DBCO connection), the assembly direction and exposure of terminal functional groups can be controlled to meet the coupling requirements of different recognition molecules, while ensuring high conversion rate and product purity in each step of the reaction.

[0013] The preferred scheme has a coding throughput of The number of species is given by m, where m is the number of selectable rare earth isotopes and b is the sum of P2 and P3 contained in the tandem detection probes.

[0014] Based on the above scheme, there are currently 45 commercially available isotopes. When only one pair of P2-P3 probes (b=2) are connected in series, 990 can encode 990 types of microspheres; when b=3, With a coding throughput of 14,190 microspheres, the coding throughput has surged to 14,190 types, greatly improving the coding throughput and breaking through the bottleneck of the traditional fluorescent coding microspheres at the hundred-fold level, significantly increasing the throughput of detection information.

[0015] In a preferred embodiment, the preparation method of the ultramultiple isotope-encoded microspheres includes the following steps: A1. Isotope loading: The detection probes P2 and P3 modified with metal chelating agents were incubated with isotope ion solutions of different rare earth elements, and purified to obtain detection probe P2 loaded with the first rare earth isotope and detection probe P3 loaded with the second rare earth isotope. A2. Tandem Assembly: Connect detection probe P1 and detection probe P2 through a first orthogonal reaction to obtain P1-P2; then add detection probe P3 and connect through a second orthogonal reaction to obtain P1-P2-P3; when extension is required, repeatedly add detection probes P2 and P3 to achieve tandem assembly through alternating orthogonal reactions, wherein each pair of detection probes P2-P3 added adds two isotope codes; A3. Microsphere labeling: The tandemly assembled isotope-encoded probes obtained in step A2 are immobilized onto the surface of microspheres through streptavidin-biotin affinity or third orthogonal reaction to obtain ultramultiple isotope-encoded microspheres.

[0016] Based on the above scheme, step A1 uses ultrafiltration to ensure that each probe carries only a single, specific type of rare earth isotope, avoiding the problem of mixed metal ratios; step A2 utilizes alternating orthogonal reactions to extend the P1-P2-P3 units, and each additional pair of P2-P3 can introduce two new isotope encodings, with the encoding capacity expanding linearly with the assembly steps, and the preparation process being controllable and repeatable; step A3 uses the high affinity binding of biotin-streptavidin or orthogonal chemical reactions to fix the assembled nucleic acid encoding probes on the surface of microspheres, with high coupling efficiency and mild conditions, which is beneficial for maintaining the nucleic acid structure and isotope stability.

[0017] In a preferred embodiment, the ultramultiple isotope-encoded microspheres are antibody-functionalized microspheres when used to connect antibodies, nucleic acid aptamer-functionalized microspheres when used to connect nucleic acid aptamers, and nucleic acid capture probe-functionalized microspheres when used to connect nucleic acid capture probes. The preparation method of the antibody-functionalized encoded microspheres is as follows: the antibody and TCEP are incubated in PBS buffer at 37°C for 30 min to reduce and expose free thiol groups. After ultrafiltration purification, the antibody is incubated with multi-isotope encoded microspheres at 37°C for 2 h. After magnetic separation and washing, the antibody-functionalized encoded microspheres are obtained. The preparation method of the nucleic acid aptamer functionalized coding microspheres is as follows: nucleic acid aptamers with thiol groups modified at the 5' end are incubated with ultramultiple isotope-coded microspheres at 37°C for 2 hours, followed by magnetic separation and washing to obtain nucleic acid aptamer functionalized coding microspheres; The method for preparing the nucleic acid capture probe functionalized coding microspheres is as follows: a nucleic acid capture probe with a thiol group modified at the 5' end is incubated with ultramultiple isotope coding microspheres at 37°C for 2 hours, followed by magnetic separation and washing to obtain the nucleic acid capture probe functionalized coding microspheres.

[0018] In a preferred embodiment, the detection method for the antibody-functionalized encoded microspheres is as follows: the antibody-functionalized encoded microspheres are mixed with the sample to be tested, so that the capture antibody on the antibody-functionalized encoded microspheres specifically binds to the corresponding antigen, a rare earth element-labeled reporter antibody is added, forming an antibody-functionalized encoded microsphere-antigen-reporter antibody complex, and the isotope signal and reporter antibody element signal on the antibody-functionalized encoded microspheres are detected by mass spectrometry flow cytometry. If both the isotope signal and the reporter antibody element signal on the antibody-functionalized encoded microspheres are positive, the detection result of the corresponding antigen in the sample to be tested is determined to be positive. The detection method of the nucleic acid aptamer functionalized coding microspheres is as follows: the nucleic acid aptamer functionalized coding microspheres are mixed with the sample to be tested, so that the nucleic acid aptamer specifically binds to the corresponding target. Rare earth element-labeled aptamer reporter probes are added to form a nucleic acid aptamer functionalized coding microsphere-protein target-aptamer reporter probe complex. The isotope signal and aptamer reporter probe element signal on the nucleic acid aptamer functionalized coding microspheres are detected by mass spectrometry flow cytometry. If both the isotope signal and the aptamer reporter probe element signal on the nucleic acid aptamer functionalized coding microspheres are positive, the detection result of the corresponding target in the sample to be tested is determined to be positive. The detection method of the nucleic acid capture probe functionalized coding microspheres is as follows: the nucleic acid capture probe functionalized coding microspheres are mixed with the sample to be tested, reverse primers and PCR reaction mixture, so that the capture probes on the microspheres and the reverse primers perform in situ PCR reaction with the target molecule DNA as a template, and the amplification product is anchored on the microspheres. A nucleic acid reporter probe labeled with rare earth elements is added and hybridized with the amplification product to form a nucleic acid capture probe functionalized coding microsphere-amplification product-nucleic acid reporter probe complex. The isotope signal and the nucleic acid reporter probe element signal on the nucleic acid capture probe functionalized coding microspheres are detected by mass spectrometry flow cytometry. If both the isotope signal and the nucleic acid reporter probe element signal on the nucleic acid capture probe functionalized coding microspheres are positive, the detection result of the corresponding nucleic acid target in the sample to be tested is determined to be positive. The antibody-functionalized encoded microspheres, the nucleic acid aptamer-functionalized encoded microspheres, and the nucleic acid capture probe-functionalized encoded microspheres can be used to detect the sample simultaneously or individually.

[0019] Based on the above scheme, antibody-functionalized encoded microspheres detect antigens using an immune sandwich method, nucleic acid aptamer-functionalized encoded microspheres detect proteins using aptamer-target affinity, and nucleic acid capture probe-functionalized encoded microspheres detect nucleic acids using in situ PCR amplification technology. All three mechanisms output results through a method of qualitative recognition by encoded isotopes and quantitative analysis by reporter element signals. Since the three types of functionalized microspheres have different isotope combinations, they can be incubated simultaneously with the test samples in a single-tube reaction system. A single mass spectrometry flow cytometry test can simultaneously complete the qualitative and quantitative analysis of more targets without the need for step-by-step operations or changing the detection platform.

[0020] The beneficial effects of this invention are: In this invention, nucleic acid-coding probes are coupled to the surface of the microspheres to form coding microspheres. The nucleic acid-coding probes adopt P1-[P2-P3]. n Or P1-P2-[P3-P2] n-1 The tandem assembly of the coded probes and the exponential expansion of isotope types through the alternation of orthogonal reactions have broken through the coding capacity bottleneck of hundreds of layers in traditional fluorescent coded microspheres, and theoretically can reach more than 10,000 super-multiple codes; each detection probe is loaded with only a single rare earth isotope, avoiding the problem of difficult control of metal ratio, and ensuring the uniformity of the coded signal and the accuracy of decoding.

[0021] Meanwhile, this invention can be used to functionalize various recognition molecules such as antibodies, nucleic acid aptamers and nucleic acid capture probes. It can achieve high-throughput detection of multiple different types of biomarkers such as proteins and nucleic acids on a single platform, significantly improving detection efficiency and information throughput. It is suitable for large-scale biomarker screening and multi-omics joint analysis. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. It should be understood that the following drawings only show some embodiments of the present invention and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1 This is a schematic diagram illustrating the self-assembly of nucleic acid probes P2 and P3 loaded with metal ions and multiple isotope-encoded probes.

[0024] Figure 2 Electrophoretic characterization of the isotope-encoded probe.

[0025] Figure 3 A schematic diagram illustrating the principle of preparing isotope-encoded microspheres by labeling microspheres with isotope-encoded probes P1-P2(M1)-P3(M2).

[0026] Figure 4 Mass cytometry characterization of isotope-encoded microspheres.

[0027] Figure 5 A schematic diagram illustrating the preparation principle of antibody-functionalized isotope-encoded microspheres and reporter antibodies.

[0028] Figure 6 A schematic diagram illustrating the preparation principle of isotope-encoded microspheres and aptamer reporter probes functionalized for nucleic acid aptamers.

[0029] Figure 7 A schematic diagram illustrating the fabrication process of isotope-encoded microspheres and reporter probes functionalized for capture probes.

[0030] Figure 8 A schematic diagram illustrating the principle of simultaneous multi-target analysis and detection of element-encoded microspheres functionalized with antibodies, aptamers, and nucleic acid capture probes.

[0031] Figure 9 A schematic diagram of decoding for element-encoded microsphere detection.

[0032] Figure 10 Simultaneous analysis and detection results of multiple targets for element-encoded microspheres. Detailed Implementation

[0033] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without inventive effort are within the protection scope of the present invention.

[0034] This embodiment provides a high-throughput detection system based on multiple isotope-encoded microspheres, including: Microspheres; Several nucleic acid-coding probes are coupled to the surface of the microspheres. These nucleic acid-coding probes are assembled in series via an orthogonal reaction using a detection probe assembly, which includes: The detection probe P1, as a basic anchoring probe, has a first active group modified at its 5' end for connecting microspheres and a first orthogonal reactive group modified at its 3' end. The detection probe P2, as an extendable isotope carrier probe, has a second orthogonal reactive group at its 5' end that pairs with the first orthogonal reactive group, and a third orthogonal reactive group at its 3' end. The thymine base in the sequence is modified with a first metal chelating agent. The detection probe P3, as an extendable isotope carrier and terminal functionalized probe, has a fourth orthogonal reactive group that pairs with the third orthogonal reactive group at its 5' end, a fifth orthogonal reactive group at its 3' end, and the thymine base in the sequence is modified with a second metal chelating agent. The detection probes P1, P2, and P3 are orthogonally reacted in the order P1-[P2-P3]. n Or P1-P2-[P3-P2] n-1 The probes are assembled in series, where n is a positive integer ≥1, and when n>1, the adjacent detection probes P2 and P3 are extended through the pairing connection of the third orthogonal reactive group and the fourth orthogonal reactive group or the pairing connection of the second orthogonal reactive group and the fifth orthogonal reactive group.

[0035] Specifically, the microspheres are superparamagnetic microspheres with a particle size of 2 μm, and their surface is modified with streptavidin (SA). They possess high specific surface area and strong magnetic response, facilitating rapid magnetic separation and washing. The streptavidin modification density is 2-5 pmol / μg, ensuring efficient binding with biotinylated nucleic acid probes. The nucleic acid-encoding probes are immobilized on the microsphere surface via biotin-streptavidin affinity, with approximately 10 microspheres coupled to each microsphere surface. 4 -10 5 Nucleic acid-coding probe molecules form a dense coding layer.

[0036] The detection probe P1 is a single-stranded DNA oligonucleotide with a sequence length of 20-30 bases. Its 5' end is modified with biotin (the first active group) via a C6 spacer for binding to streptavidin magnetic beads; its 3' end is modified with an azide group (the first orthogonal reactive group, -N3) for a copper-free click reaction with the DBCO group (dibenzocyclooctylene) of the detection probe P2. The sequence design of P1 avoids homology with P2, P3, and the target sequence to reduce non-specific binding.

[0037] The detection probe P2 is a single-stranded DNA oligonucleotide with a sequence length of 40-60 bases and a thymine (T) base content of 30%-40%. Each T base is modified with DTPA (diethylenetriaminepentaacetic acid, the first metal chelating agent) via a C5 spacer, which can chelate an isotope of a rare earth element. The 5' end is modified with dibenzocyclooctyne (DBCO, the second orthogonal reactive group), which undergoes a copper-free click reaction with the azide group of P1 to form a stable triazole ring link; the 3' end is modified with a thiol group (-SH, the third orthogonal reactive group), which is used for reaction with maleimide of P3 or for subsequent elongation. Each P2 probe can be loaded with 15-20 rare earth metal ions.

[0038] The detection probe P3 is a single-stranded DNA oligonucleotide with a sequence length of 40-60 bases and a T base content of 30%-40%. Each T base is modified with DTPA (second metal chelator). The 5' end is modified with maleimide (Mal, fourth orthogonal reactive group), forming a stable thioether bond with the thiol group of P2; the 3' end is modified with an azide group (-N3, fifth orthogonal reactive group), used for elongation through a DBCO reaction with the next P2. When P3 is located at the end of the assembled chain, its 5' maleimide group is exposed on the microsphere surface, used to connect thiol-containing recognition molecules.

[0039] The specific reactions of the two extension methods are as follows: Method 1 (P1-[P2-P3]) n ): The 3' end azide (fifth orthogonal reactive group) of the previous P3 reacts with the 5' end DBCO (second orthogonal reactive group) of the subsequent P2; Method 2 (P1-P2-[P3-P2]) n-1 The 3' end thiol group (third orthogonal reactive group) of the preceding P2 reacts with the 5' end maleimide group (fourth orthogonal reactive group) of the following P3 to form a thiol-maleimide reaction.

[0040] The two methods can be used alternately or alone to achieve directional extension of the coding chain, with each additional P2-P3 unit adding two isotope codes.

[0041] When assembly is complete, the fifth orthogonal reactive group of the terminal detection probe P3 is exposed on the microsphere surface, ready for attachment of antibodies, nucleic acid aptamers, or nucleic acid capture probes; or... When assembly is complete, the third orthogonal reactive group of the terminal detection probe P2 is exposed on the surface of the microsphere, which is used to connect antibodies, nucleic acid aptamers, or nucleic acid capture probes.

[0042] Specifically, the choice of termination method depends on subsequent coupling requirements: Termination at P3 (exposing the fifth orthogonal reactive group - azide): suitable for scenarios requiring further click chemical modification, or for connecting thiol-containing recognition molecules after conversion to maleimide via bifunctional linkers such as DBO-PEG4-Mal.

[0043] Termination at P2 (exposing the third orthogonal reactive group - thiol): react directly with a maleimide-containing recognition molecule or linker, or after conversion to maleimide by reagents such as Mal-PEG4-Mal.

[0044] The first metal chelating agent and the second metal chelating agent each chelate an isotope of a rare earth element. The rare earth element is selected from at least one of La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, and Yb.

[0045] Specifically, each detection probe (P2 or P3) is loaded with only one specific type of rare earth element isotope, rather than a mixture of multiple metals.

[0046] The surface of the microspheres is modified with streptavidin; The first active group is biotin, and the first orthogonal reactive group is an azide group; The second orthogonal reactive group is dibenzocyclooctylene, and the third orthogonal reactive group is mercapto. The fourth orthogonal reactive group is maleimide, and the fifth orthogonal reactive group is an azide group.

[0047] The assembly method of the detection probes P1, P2, and P3 is as follows: The 3' azide group of detection probe P1 reacts with the 5' dibenzocyclooctylene of detection probe P2 to form a P1-P2 link; The 3' thiol group of detection probe P2 reacts with the 5' maleimide of detection probe P3 to form a P1-P2-P3 link. When n>1, the 3' end mercapto group of the previous detection probe P2 reacts with the 5' end maleimide of the subsequent detection probe P3, or the 3' end azide group of the previous detection probe P1 reacts with the 5' end dibenzocyclooctylene of the subsequent detection probe P2, thus achieving tandem extension.

[0048] Encoding throughput is The number of species is given by m, where m is the number of selectable rare earth isotopes (La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Yb), and b is the sum of P2 and P3 contained in the tandem detection probes.

[0049] Specifically, in the coding throughput calculation formula, b = 2n (n in relation to P2 - P3). The actual coding capacity increases rapidly with the increase of the b value. In practical applications, b = 4-6 can meet most needs. The resolvable isotope combinations of mass cytometry are limited by mass resolution and signal strength.

[0050] The preparation method of the ultramultiple isotope encoded microspheres includes the following steps: A1. Isotope loading: The detection probes P2 and P3 modified with metal chelating agents were incubated with isotope ion solutions of different rare earth elements, and purified to obtain detection probe P2 loaded with the first rare earth isotope and detection probe P3 loaded with the second rare earth isotope. Specifically, 100 μg of DTPA-modified P2 or P3 was mixed with 5 μL of 100 mM rare earth chloride solution (such as EuCl3 or TbCl3) in 45 μL of 5 mM acetate buffer (pH=5.5) and incubated at 37°C for 30 min. DTPA exhibits high chelation efficiency under acidic conditions, with each T-base modification site binding one rare earth ion. After the reaction, the mixture was purified by centrifugation using a 10 kDa ultrafiltration tube (12000 × g, 10 min), washed twice with acetate buffer to remove free ions, washed once with Tris-HCl buffer, and stored at -20°C.

[0051] A2. Tandem Assembly: Connect detection probe P1 and detection probe P2 through a first orthogonal reaction to obtain P1-P2; then add detection probe P3 and connect through a second orthogonal reaction to obtain P1-P2-P3; when extension is required, repeatedly add detection probes P2 and P3 to achieve tandem assembly through alternating orthogonal reactions, wherein each pair of detection probes P2-P3 added adds two isotope codes; Specifically, extension is achieved through alternating copper-free click reactions and thiol-maleimide reactions. With each completed P2-P3 assembly, two additional coding types are added (M1 loaded with P2 and M2 loaded with P3), resulting in a combinatorial increase in the amount of encoded information.

[0052] A3. Microsphere Labeling: The tandemly assembled isotope-encoded probes obtained in step A2 were immobilized onto the surface of microspheres via streptavidin-biotin affinity or a third orthogonal reaction to obtain ultramultiple isotope-encoded microspheres. 100 μg of biotinylated isotope-encoded probes were mixed with 100 μg of streptavidin magnetic beads in 200 μL of 5 mM acetate buffer, and 30 μg of DBCO-maleimide linker was added. The mixture was incubated at 37 °C for 1 h. The streptavidin-biotin binding anchored the probe, and the DBCO reacted with the terminal azide to introduce maleimide groups. After magnetic separation and washing, surface-modified ultramultiple isotope-encoded microspheres were obtained and stored at -20 °C.

[0053] Specifically, 100 μg of biotinylated isotope-encoded probe and 100 μg of streptavidin magnetic beads were mixed in 200 μL of 5 mM acetate buffer, and 30 μg of DBCO-maleimide linker was added. The mixture was incubated at 37 °C for 1 h. The streptavidin-biotin binding enabled probe anchoring, and the reaction of DBCO with terminal azide introduced maleimide groups. After magnetic separation and washing, surface-modified Mal-encoded ultramultiple isotope-encoded microspheres were obtained and stored at -20 °C.

[0054] In addition, the ultra-multiple isotope-encoded microspheres are antibody-functionalized microspheres when used to connect antibodies, nucleic acid aptamer-functionalized microspheres when used to connect nucleic acid aptamers, and nucleic acid capture probe-functionalized microspheres when used to connect nucleic acid capture probes. The preparation method of the antibody-functionalized encoded microspheres is as follows: the antibody and TCEP are incubated in PBS buffer at 37°C for 30 min to reduce and expose free thiol groups. After ultrafiltration purification, the antibody is incubated with multi-isotope encoded microspheres at 37°C for 2 h. After magnetic separation and washing, the antibody-functionalized encoded microspheres are obtained. The preparation method of the nucleic acid aptamer functionalized coding microspheres is as follows: nucleic acid aptamers with thiol groups modified at the 5' end are incubated with ultramultiple isotope-coded microspheres at 37°C for 2 hours, followed by magnetic separation and washing to obtain nucleic acid aptamer functionalized coding microspheres; The method for preparing the nucleic acid capture probe functionalized coding microspheres is as follows: a nucleic acid capture probe with a thiol group modified at the 5' end is incubated with ultramultiple isotope coding microspheres at 37°C for 2 hours, followed by magnetic separation and washing to obtain the nucleic acid capture probe functionalized coding microspheres.

[0055] The detection method for antibody-functionalized encoded microspheres is as follows: the antibody-functionalized encoded microspheres are mixed with the sample to be tested, so that the capture antibody on the antibody-functionalized encoded microspheres specifically binds to the corresponding antigen. A rare earth element-labeled reporter antibody is added to form an antibody-functionalized encoded microsphere-antigen-reporter antibody complex. The isotope signal on the antibody-functionalized encoded microspheres and the reporter antibody element signal are detected by mass spectrometry flow cytometry. If both the isotope signal on the antibody-functionalized encoded microspheres and the reporter antibody element signal are positive, the detection result of the corresponding antigen in the sample to be tested is determined to be positive. The detection method of the nucleic acid aptamer functionalized coding microspheres is as follows: the nucleic acid aptamer functionalized coding microspheres are mixed with the sample to be tested, so that the nucleic acid aptamer specifically binds to the corresponding target. Rare earth element-labeled aptamer reporter probes are added to form a nucleic acid aptamer functionalized coding microsphere-protein target-aptamer reporter probe complex. The isotope signal and aptamer reporter probe element signal on the nucleic acid aptamer functionalized coding microspheres are detected by mass spectrometry flow cytometry. If both the isotope signal and the aptamer reporter probe element signal on the nucleic acid aptamer functionalized coding microspheres are positive, the detection result of the corresponding target in the sample to be tested is determined to be positive. The detection method of the nucleic acid capture probe functionalized coding microspheres is as follows: the nucleic acid capture probe functionalized coding microspheres are mixed with the sample to be tested, reverse primers and PCR reaction mixture, so that the capture probes on the microspheres and the reverse primers perform in situ PCR reaction with the target molecule DNA as a template, and the amplification product is anchored on the microspheres. A nucleic acid reporter probe labeled with rare earth elements is added and hybridized with the amplification product to form a nucleic acid capture probe functionalized coding microsphere-amplification product-nucleic acid reporter probe complex. The isotope signal and the nucleic acid reporter probe element signal on the nucleic acid capture probe functionalized coding microspheres are detected by mass spectrometry flow cytometry. If both the isotope signal and the nucleic acid reporter probe element signal on the nucleic acid capture probe functionalized coding microspheres are positive, the detection result of the corresponding nucleic acid target in the sample to be tested is determined to be positive. The antibody-functionalized microspheres, nucleic acid aptamer-functionalized microspheres, and nucleic acid capture probe-functionalized microspheres can be used simultaneously or individually to detect the sample. For example, simultaneous multi-target mass cytometry detection: Add the product sample (the antibody-functionalized microspheres, nucleic acid aptamer-functionalized microspheres, or nucleic acid capture probe-functionalized microspheres) to 1 mL of MSFLO mass cytometry buffer and mix thoroughly. Turn on the mass cytometer and use... 169 Tm and 159 Tb was used to adjust the sensitivity and stability of the instrument, achieving a sensitivity of over 150,000 CPS and an RSD of <3%; oxide ratio 155 LaO / 139 La was reduced to below 5%. After debugging, the prepared product sample was tested using single-particle mode. The microsphere sample was introduced into a digital pump controlled by the instrument software at an injection rate of 30 μL / min, and then the metal element signal on the microsphere was acquired.

[0056] The invention will be explained below with reference to experiments: Main reagents: Detection probe P1 (5'-biotin-3'-azide), detection probe P2 (5'-DBCO-3'-thiol, T-DTPA), detection probe P3 (5'-maleimide-3'-azide, T-DTPA), and isotopes of rare earth elements ( 151 Eu、 153 Eu、 159 Tb, 169 Tm、 175 Lu、 141 Pr、 165 Ho、 162 PCR reagents include Dy), streptavidin magnetic beads (2μm), DBCO-maleimide linker, TCEP (tris(2-carboxyethyl)phosphine), CEA, NSE, SCC antigen and antibody, IL-6, TNF-α, IFN-γ and aptamers, Target1, Target2, Target3 and capture probes, Taq DNA polymerase, and dNTPs.

[0057] 1. Nucleic acid probes P2 and P3 are loaded with metal ions. First, nucleic acid-encoding probes P1, P2, and P3 were synthesized (probe sequences are shown in Table 1). Probe P1 is modified with biotin at the 5' end and azide (N3) at the 3' end; probe P2 is modified with dibenzocyclooctylene (DBCO) at the 5' end and thiol (HS) at the 3' end; probe P3 is modified with maleimide (Mal) at the 5' end and N3 at the 3' end. In addition, all T bases on probe sequences P2 and P3 are modified with DTPA (DOTA or Ce6).

[0058] like Figure 1 As shown in Figure A, 100 μg of nucleic acid probes P2 and P3 were placed into two 200 µL centrifuge tubes, respectively. Then, 45 μL of 5 mM acetate buffer and 5 μL of 100 mM lanthanide solution were added to each 200 µL centrifuge tube, respectively. After mixing, the mixture was incubated at 37 °C for 30 min. The resulting metal-loaded nucleic acid probes P2 (M1) and P3 (M2) were transferred to 10 kDa ultrafiltration tubes, centrifuged at 12000 × g for 10 min at room temperature, and the filtrate was discarded. The samples were washed twice with acetate buffer and once with 5 mM Tris-HCl buffer, and then stored at -20 °C for later use.

[0059] Load combination: P2- 151 Eu, P2- 153 Eu, P2- 159 Tb, P2- 169 Tm, P2- 175 Lu P3- 153 Eu, P3- 159Tb, P3- 169 Tm, P3- 175 Lu, P3- 151 Eu Table 1. Sequence List of Nucleic Acid Probes P1, P2, and P3 P1 TTTTTTTTTTTTTTTTTT Biotin <![CDATA[N3]]> none P2 AAATATCTCTATCTCTAAA DBCO HS DTPA P3 AAATATCTCTATCTCTAAA Mal <![CDATA[N3]]> DTPA 2. Tandem assembly of nucleic acid coding probes Assembly of basic unit P1-P2-P3 (n=1): The experimental principle is as follows Figure 1 As shown in B, 100 μg of detection probe P1 was placed in a 1 mL centrifuge tube, 200 μL of 5 mM acetate buffer solution was added, and then 100 μg of isotope-loaded detection probe P2 was added, such as P2( 151 Eu), reacted at 37℃ for 1 h; the mixture was transferred to a 10 kDa ultrafiltration tube for purification (12000×g at room temperature, centrifuged for 10 min and the filtrate was discarded), washed twice with 5 mM acetate buffer and once with 5 mM Tris-HCl buffer, and then 100 μg of isotope-loaded detection probe P3 (e.g., P3-) was added. 153 Eu), reacted at 37℃ for 1 h, transferred to a 30 kDa ultrafiltration tube for purification (centrifuged at 12000×g for 10 min at room temperature and the filtrate discarded), and washed once more with 5 mM Tris-HCl buffer to obtain P1-P2 ( 151 Eu)-P3( 153 Eu isotope-encoded probes are stored at -80℃ for future use.

[0060] Extend the assembly P1-[P2-P3]2 (n=2): Based on the above P1-P2-P3, add 100 μg P2 ( 159 Tb), reacted at 37℃ for 1 h (P3 terminal azide + P2 DBCO), purified by ultrafiltration, and 100 μg P3 was added. 169 Tm), reacted at 37℃ for 1 h, purified by ultrafiltration to obtain P1-[P2( 151 Eu)-P3( 153 Eu)]-[P2( 159 Tb)-P3( 169 Tm).

[0061] 3. Polyacrylamide gel electrophoresis (PAGE) analysis of molecular weight changes The reaction products P1-P2 in Experiment 2 were analyzed by polyacrylamide gel electrophoresis. 151 Eu) and P1-P2( 151 Eu)-P3( 153 Eu) was characterized. The results are as follows: Figure 2As shown in the electrophoresis diagram, it can be seen that the probes P1 and P1-P2 (P1, P1-P2) correspond to lanes 2, 3, and 4. 151 Eu) and P1-P2( 151 Eu)-P3( 153 As the molecular weight of Eu increases, the migration rate shows significant differences, and these differences are clearly distinguishable, indicating that products P1-P2 ( 151 Eu) and P1-P2( 151 Eu)-P3( 153 Eu) has been successfully prepared and the purification effect is good.

[0062] 4. Preparation of isotope-encoded microspheres (M-MBs) Preparation of isotope-encoded microspheres by labeling isotope-encoded probes: such as Figure 3 As shown, take 100 μg of nucleic acid coding probes (P1-P2( 151 Eu)-P3( 153 Eu)), add 200 μL of 5 mM acetate buffer, add 100 μg of streptavidin magnetic beads (2 μm in diameter), add 30 μg of DBCO-Mal bifunctional linker coupling agent (DBCO-maleimide linker), incubate at 37 °C for 1 h, enrich the microspheres using a magnetic rack, and wash twice with 5 mM Tris-HCl buffer to obtain Mal-modified isotope-encoded microspheres M-MB1 ( 151 Eu / 153 Eu).

[0063] Five isotopes were selected for this experiment: 151 Eu、 153 Eu、 159 Tb, 169 Tm、 175 Lu customized 10 isotope-coded microspheres, namely M-MB1 ( 151 Eu and 153 Eu), M-MB2 ( 151 Eu and 159 Tb), M-MB3 ( 151 Eu and 169 Tm), M-MB4 ( 151 Eu and 175 Lu), M-MB5 ( 153 Eu and 159 Tb), M-MB6 ( 153 Eu and 169 Tm), M-MB7 ( 153 Eu and 175 Lu), M-MB8 ( 159 Tb and 169 Tm), M-MB9 (159 Tb and 175 Lu) and M-MB10 ( 169 Tm and 175 Lu).

[0064] Currently, there are 45 commercially available isotopes. The maximum number of codes that can be encoded by combining two isotopes is... 990 types of microspheres, using combinations of three isotopes, can encode up to [number missing] types. 14,190 types of microspheres greatly improve coding throughput.

[0065] 5. Mass Spectrometry Flow Cytometry Characterization Analysis Take approximately 200 μg of each of the 10 isotope-encoded microspheres mentioned above, dilute them in 1 mL of MSFLO mass cytometry buffer, and mix thoroughly. Turn on the mass cytometer and use... 169 Tm and 159 Tb was used to adjust the sensitivity and stability of the instrument, achieving a sensitivity of over 150,000 CPS and an RSD of <3%; oxide ratio 155 LaO / 139 La decreased to below 5%. After debugging, the prepared antibody-labeled isotope-encoded microsphere samples were detected using single-particle mode. The microsphere samples were introduced into a digital pump controlled by the instrument software at a flow rate of 30 μL / min, and then the metal element signals on the microspheres were acquired. We then... Figure 4 As can be seen, the elemental signals encoded by the 10 isotopes are very high, indicating that the metal element loading on the microspheres is high and the uniformity is good.

[0066] 6. Preparation of antibody-functionalized encoded microspheres Preparation of CEA-MB1 antibody functionalized encoded microspheres: (e.g.) Figure 5 As shown in Figure A, 200 μg of CEA antibody (or NSE, SCC) was added to 100 μL of 100 mM PBS (pH 7.4), followed by 5 mM TTCEP. The mixture was incubated at 37°C for 30 min to reduce antibody disulfide bonds and expose free thiol groups. After the reaction, the mixture was transferred to a 30 kDa ultrafiltration tube for purification (centrifuged at 12000 × g for 5 min at room temperature). The mixture was washed twice with 100 mM PBS buffer to remove excess TCEP. 100 μg of isotope-encoded microspheres M-MB1 were added, and the mixture was incubated at 37°C for 2 h. The isotope-encoded microspheres were enriched using a magnetic rack and washed twice with 5 mM Tris-HCl buffer to obtain CEA-MB1 antibody-functionalized microspheres. NSE-MB2 and SCC-MB3 were obtained using the same procedure.

[0067] Report antibody preparation: such as Figure 5As shown in Figure B, 200 μg of CEA antibody was added to 100 μL of 100 mM PBS buffer, followed by the addition of 5 mM TTCEP. The mixture was incubated at 37°C for 30 min to reduce antibody disulfide bonds and expose free thiol groups. After the reaction, the mixture was transferred to a 30 kDa ultrafiltration tube and centrifuged at 12000 × g for 5 min at room temperature. The solution was then washed twice with 100 mM PBS buffer to remove excess TCEP. 100 μg of loading agent was added... 141 Pr's P3 probe was incubated at 37°C for 2 hours. After the reaction, the mixture was transferred to a 50 kDa ultrafiltration tube, centrifuged at 12000 × g for 5 minutes at room temperature, and washed twice with 5 mM Tris-HCl buffer to obtain CEA- 141 Pr reporter antibody; NSE- obtained based on the same steps. 141 Pr, SCC- 141 Pr.

[0068] Detection process: Antibody-functionalized element-coded microspheres capture antigens, such as... Figure 8 As shown in Figure A, first, 50 μL of antibody-functionalized isotope-encoded microspheres CEA-MB1, NSE-MB2, and SCC-MB3 were added to a 1 mL centrifuge tube. Then, 100 ng each of CEA, NSE, and SCC antigen standards, as well as those labeled with... 141 Pr element reporter antibody CEA- 141 Pr, NSE- 141 Pr and SCC- 141 1 μL of each of Pr. Incubate at 37°C for 30 min to form a microsphere antibody-antigen-detection antibody "sandwich" complex. The final product is washed three times with the instrument buffer.

[0069] 7. Preparation of nucleic acid aptamer-functionalized coding microspheres Preparation of nucleic acid aptamer-functionalized coding microspheres: We selected cytokines IL-6, TNF-α, and IFN-γ as target proteins and commissioned a company to synthesize nucleic acid aptamer-labeled probes Apt-IL-6, Apt-TNF-α, and Apt-IFN-γ, and nucleic acid aptamer reporter probes R-IL-6, R-TNF-α, and R-IFN-γ (sequences shown in Table 2). The nucleic acid aptamer-labeled probes have a thiol modification at the 5' end, and the reporter probes have DTPA (DOTA or Ce6) modification at the 5' end of the 12 T bases. Figure 6As shown in Figure A, 100 μg of each of the three aptamer-labeled probes were placed in 100 mM PBS buffer solution, and then 100 μg of isotope-encoded microspheres M-MB4, M-MB5, and M-MB6 were added respectively. After incubation at 37°C for 2 h, the microspheres were enriched using a magnetic rack and washed twice with 5 mM Tris-HCl buffer to obtain the three aptamer-functionalized isotope-encoded microspheres (IL-6-MB4, TNF-α-MB5, and IFN-γ-MB6).

[0070] Preparation of aptamer reporter probes loaded with metal elements: such as Figure 6 As shown in Figure B, 100 μg of reporter probes R-IL-6, R-TNF-α, and R-IFN-γ were respectively placed in 200 µL centrifuge tubes, and then 45 μL of 5 mM acetate buffer and 5 μL of 100 mM sodium chloride were added respectively. 165 After mixing the Ho element solution, incubate at 37°C for 30 min. After the reaction, transfer the mixture to a 10 kDa ultrafiltration tube, centrifuge at 12000 × g for 10 min at room temperature, discard the filtrate, wash twice with acetate buffer, and once with 5 mM Tris-HCl buffer. The resulting solution is then loaded with Ho element. 165 Ho element aptamer reporter probe (R-IL-6-) 165 Ho, R-TNF-α- 165 Ho、R-IFN-γ- 165 Ho).

[0071] Table 2. Nucleic Acid Aptamer Probe Sequence List Apt-IL-6 GGGGAATGGTGCTGTGGTTGGGTGGTTGGTTGGTCGCCCC HS none none Apt-TNF-α CGGGTGGTGGTGGTTGGTTGGTTGGTGGTGGTCCG HS none none Apt-IFN-γ GGTGGTGGTGGTTGGTGGTGGTGGTTGGTGGTGGTGG HS none none R-IL-6 TTTTTTTTTTTGGGGAATGGTGCTGTGGTTGGGTGGTTGGTTGGTCGCCCC none none DTPA R-TNF-α TTTTTTTTTTTTCGGGTGGTGGTGGTTGGTTGGTTGGTGGTGGTCCG none none DTPA R-IFN-γ TTTTTTTTTTTTGGTGGTGGTGGTTGGTGGTGGTGGTTGGTGGTGGTGG none none DTPA Testing process: such as Figure 8 As shown in B, first, 50 μL each of aptamer-functionalized isotope-encoded microspheres IL-6-MB4, TNF-α-MB5, and IFN-γ-MB6 were added to a 1 mL centrifuge tube. Then, 400 pg of the three target molecules IL-6, TNF-α, and IFN-γ, along with a loading of [unclear - possibly a specific ingredient or substance], were added. 165 Ho element aptamer reporter probe R-IL-6- 165 Ho, R-TNF-α- 165 Ho and R-IFN-γ- 165 1 μL of each of Ho was incubated at 37°C for 30 min to form a "sandwich" complex. The final product was enriched using a magnetic rack and then washed three times with buffer.

[0072] 8. Preparation of functionalized coding microspheres for nucleic acid capture probes Preparation of functionalized microspheres for nucleic acid capture probes: Three DNA templates with different sequences (Target1, Target2, Target3) were designed as target molecules. Target molecule sequences, as well as capture probes, reporter probes, and reverse primers targeting the three molecules, were synthesized. The capture probe has a thiol-modified 5' end (sequence shown in Table 3) and is complementary to the yellow portion of the target molecule DNA sequence; the reporter probe has 12 red T bases at its 5' end modified with DTPA (or DOTA, Ce6) and is identical to the green portion of the target molecule DNA sequence; the reverse primer sequence is identical to the blue portion of the target molecule DNA sequence. Figure 7 As shown in Figure A, 100 μg of the capture probe was placed in 100 mM PBS buffer solution, and then 100 μg of isotope-encoded microspheres M-MB7, M-MB8 and M-MB9 were added. After incubation at 37 °C for 2 h, the microspheres were enriched using a magnetic rack and washed twice with 5 mM Tris-HCl buffer to obtain capture probe-functionalized isotope-encoded microspheres (Cp1-MB7, Cp2-MB8 and Cp3-MB9).

[0073] Table 3. Sequence List of Nucleic Acid Capture Probes, Reporter Probes, and Target Molecules Target1 ACCCAATAATACTGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACC none none none Target2 ACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAA none none none Target3 CCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGAAGCTGGACTTCCCTATGG none none none Captureprobe1(Cp1) GGTCTTCCTTGCCATG HS none none Captureprobe2(Cp2) TTCGTCTGGTAGCTCT HS none none Captureprobe3(Cp3) CCATAGGGAAGTCCAG HS none none Reverseprobe1(Rv1) ACCCAATAATACTGCG none none none Reverseprobe2(Rv2) ACCAATAGCAGTCCAG none none none Reverseprobe3(Rv3) CCAAGATGGTATTTCTA none none none Reporterprobe1(Rp1) TTTTTTTTTTGTTCACCGCTCTCACTC none none DTPA Reporterprobe2(Rp2) TTTTTTTTTTTTCCAAATTGGCTACTACC none none DTPA Reporterprobe3(Rp3) TTTTTTTTTTTTCTAGGAACTGGGCCAG none none DTPA Report probe marking of metal elements: such as Figure 7 As shown in B, 100 μg of the reporter probe was placed in a 200 µL centrifuge tube, followed by the addition of 45 μL of 5 mM acetate buffer and 5 μL of 100 mM sodium chloride solution. 162 The Dy elemental solution was mixed and incubated at 37°C for 30 min. After the reaction, the mixture was transferred to a 10 kDa ultrafiltration tube, centrifuged at 12000 × g for 10 min at room temperature, and the filtrate was discarded. The solution was washed twice with acetate buffer and once with 5 mM Tris-HCl buffer. The resulting product was then loaded with Dy elemental solution. 162 Reporting probe for Dy element (Rp1- 162 Dy、Rp2- 162 Dy and Rp3- 162 Dy).

[0074] Testing process: such as Figure 8As shown in Figure C, 50 μL of capture probe-functionalized isotope-encoded microspheres Cp1-MB7, Cp2-MB8, and Cp3-MB9 were first added to a 200 μL centrifuge tube. Then, 1 fM of the three nucleic acid target molecules Target1, Target2, and Target3, along with 200 nM of reverse primers, and 10 μL of PCR reaction mixture (300 nM Forward Primer, 350 μM dNTPs, 1.0 U Taq DNA polymerase, 8 mM Tris-HCl, 44 mM KCl, 0.002% (w / v) gelatin, pH 8.8) were added. After mixing, the capture probes and reverse primers on the microspheres would perform a PCR reaction using the target DNA as a template. The PCR reaction process was as follows: first, heating at 94°C for 2 min activated the Taq DNA polymerase activity, followed by 50 thermal cycles, each cycle consisting of 94°C for 20 s and 50°C for 30 s. After the PCR reaction, N-MBs were enriched and separated while still hot using a magnetic rack, and washed twice by centrifugation with 5 mM Tris-HCl buffer. Then, 2 nM of the reporter probe Rp1- was added. 162 Dy、Rp2- 162 Dy and Rp3- 162 Dy was incubated at room temperature for 20 minutes, then enriched and separated using a magnetic rack, and washed twice with buffer.

[0075] 9. Simultaneous multi-target mass spectrometry flow cytometry detection like Figure 8 As shown in D, add the reaction products obtained in steps 6, 7, and 8 of the experiment to 1 mL of the MSFLO mass cytometry-specific buffer and mix thoroughly. Turn on the mass cytometry instrument and use... 169 Tm and 159 Tb was used to adjust the sensitivity and stability of the instrument, achieving a sensitivity of over 150,000 CPS and an RSD of <3%; oxide ratio 155 LaO / 139 La was reduced to below 5%. After debugging, the prepared product sample was analyzed using single-particle mode. The microsphere sample was introduced into a digital pump controlled by the instrument software at an injection rate of 30 μL / min, and then the metal element signal on the microsphere was collected. 141 Pr、 151 Eu、 153 Eu、 159 Tb, 162 Dy、 169 Tm、 165 Ho、 175 Lu).

[0076] After the detection is completed, the detection results are decoded based on the element signals. Figure 8 The final result is as follows Figure 9 As shown in the figure, the positive signals of three antigen targets (CEA, NSE, SCC), three cytokine targets (IL-6, TNF-α, IFN-γ), and three nucleic acid targets (Target1, Target2, Target3) can be well separated from the blank signals. Therefore, this method can simultaneously detect multiple different types of target molecules.

[0077] in conclusion: 1. The detection probes P1, P2, and P3 can be assembled in series. Polyacrylamide gel electrophoresis confirmed that the molecular weight of the assembled product gradually increases and the purification effect is good. 2. Mass spectrometry flow cytometry characterization of the 10 dual isotope encoded microsphere system showed high elemental signal intensity (>150,000 CPS), good uniformity (RSD<3%), and clear and distinguishable encoded signals without cross-interference.

[0078] 3. All three microsphere systems—antibody-functionalized, aptamer-functionalized, and nucleic acid capture probe-functionalized—exhibited excellent detection performance, with detection sensitivities reaching the ng / mL, pg / mL, and fM levels, respectively. 4. Simultaneous detection of nine targets (three antigens, three cytokines, and three nucleic acids): Experiments have shown that this system can achieve efficient simultaneous detection of multiple different types of biomarkers of proteins and nucleic acids. Positive signals and blank controls can be clearly distinguished, and decoding is accurate with no cross-reaction.

[0079] This experiment fully verified the technical feasibility and application potential of the ultra-multiple isotope encoded microsphere system, laying the foundation for its further development and industrial application in the field of biological detection.

[0080] This invention is not limited to the above-described optional embodiments. Anyone can derive other various forms of products under the guidance of this invention. However, regardless of any changes made in their shape or structure, any technical solution that falls within the scope of the claims of this invention shall be protected by this invention.

Claims

1. A high-throughput detection system based on multi-isotope encoded microspheres, characterized in that, include: Microspheres; Several nucleic acid-coding probes are coupled to the surface of the microspheres. These nucleic acid-coding probes are assembled in series via an orthogonal reaction using a detection probe assembly, which includes: The detection probe P1, as a basic anchoring probe, has a first active group modified at its 5' end for connecting microspheres and a first orthogonal reactive group modified at its 3' end. The detection probe P2, as an extendable isotope carrier probe, has a second orthogonal reactive group at its 5' end that pairs with the first orthogonal reactive group, and a third orthogonal reactive group at its 3' end. The thymine base in the sequence is modified with a first metal chelating agent. The detection probe P3, as an extendable isotope carrier and terminal functionalized probe, has a fourth orthogonal reactive group that pairs with the third orthogonal reactive group at its 5' end, a fifth orthogonal reactive group at its 3' end, and the thymine base in the sequence is modified with a second metal chelating agent. The detection probes P1, P2, and P3 are orthogonally reacted in the order P1-[P2-P3]. n Or P1-P2-[P3-P2] n-1 The probes are assembled in series, where n is a positive integer ≥1, and when n>1, the adjacent detection probes P2 and P3 are extended through the pairing connection of the third orthogonal reactive group and the fourth orthogonal reactive group or the pairing connection of the second orthogonal reactive group and the fifth orthogonal reactive group.

2. The high-throughput detection system based on multiple isotope-encoded microspheres according to claim 1, characterized in that, When assembly is complete, the fifth orthogonal reactive group of the terminal detection probe P3 is exposed on the microsphere surface, ready for attachment of antibodies, nucleic acid aptamers, or nucleic acid capture probes; or... When assembly is complete, the third orthogonal reactive group of the terminal detection probe P2 is exposed on the surface of the microsphere, which is used to connect antibodies, nucleic acid aptamers, or nucleic acid capture probes.

3. The high-throughput detection system based on multiple isotope-encoded microspheres according to claim 1, characterized in that, The first metal chelating agent and the second metal chelating agent respectively chelate an isotope of a rare earth element.

4. The high-throughput detection system based on multiple isotope-encoded microspheres according to claim 3, characterized in that, The rare earth element is selected from at least one of La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm and Yb.

5. The high-throughput detection system based on multiple isotope-encoded microspheres according to claim 1, characterized in that, The surface of the microspheres is modified with streptavidin; The first active group is biotin, and the first orthogonal reactive group is an azide group; The second orthogonal reactive group is dibenzocyclooctylene, and the third orthogonal reactive group is mercapto. The fourth orthogonal reactive group is maleimide, and the fifth orthogonal reactive group is an azide group.

6. The high-throughput detection system based on multiple isotope-encoded microspheres according to claim 1, characterized in that, The assembly method of the detection probes P1, P2, and P3 is as follows: The 3' azide group of detection probe P1 reacts with the 5' dibenzocyclooctylene of detection probe P2 to form a P1-P2 link; The 3' thiol group of detection probe P2 reacts with the 5' maleimide of detection probe P3 to form a P1-P2-P3 link. When n>1, the 3' end mercapto group of the previous detection probe P2 reacts with the 5' end maleimide of the subsequent detection probe P3, or the 3' end azide group of the previous detection probe P1 reacts with the 5' end dibenzocyclooctylene of the subsequent detection probe P2, thus achieving tandem extension.

7. The high-throughput detection system based on multiple isotope-encoded microspheres according to claim 1, characterized in that, Encoding throughput is The number of species is given by m, where m is the number of selectable rare earth isotopes and b is the sum of P2 and P3 contained in the tandem detection probes.

8. A high-throughput detection system based on multiple isotope-encoded microspheres according to claim 1, characterized in that, The preparation method of the ultramultiple isotope encoded microspheres includes the following steps: A1. Isotope loading: The detection probes P2 and P3 modified with metal chelating agents were incubated with isotope ion solutions of different rare earth elements, and purified to obtain detection probe P2 loaded with the first rare earth isotope and detection probe P3 loaded with the second rare earth isotope. A2. Tandem Assembly: Connect detection probe P1 and detection probe P2 through a first orthogonal reaction to obtain P1-P2; then add detection probe P3 and connect through a second orthogonal reaction to obtain P1-P2-P3; when extension is required, repeatedly add detection probes P2 and P3 to achieve tandem assembly through alternating orthogonal reactions, wherein each pair of detection probes P2-P3 added adds two isotope codes; A3. Microsphere labeling: The tandemly assembled isotope-encoded probes obtained in step A2 are immobilized onto the surface of microspheres through streptavidin-biotin affinity or third orthogonal reaction to obtain ultramultiple isotope-encoded microspheres.

9. A high-throughput detection system based on multiple isotope-encoded microspheres according to claim 8, characterized in that, When the ultra-multiple isotope-encoded microspheres are used to connect antibodies, they are antibody-functionalized microspheres; when the ultra-multiple isotope-encoded microspheres are used to connect nucleic acid aptamers, they are nucleic acid aptamer-functionalized microspheres; and when the ultra-multiple isotope-encoded microspheres are used to connect nucleic acid capture probes, they are nucleic acid capture probe-functionalized microspheres. The preparation method of the antibody-functionalized encoded microspheres is as follows: the antibody and TCEP are incubated in PBS buffer at 37°C for 30 min to reduce and expose free thiol groups. After ultrafiltration purification, the antibody is incubated with multi-isotope encoded microspheres at 37°C for 2 h. After magnetic separation and washing, the antibody-functionalized encoded microspheres are obtained. The preparation method of the nucleic acid aptamer functionalized coding microspheres is as follows: nucleic acid aptamers with thiol groups modified at the 5' end are incubated with ultramultiple isotope-coded microspheres at 37°C for 2 hours, followed by magnetic separation and washing to obtain nucleic acid aptamer functionalized coding microspheres; The method for preparing the nucleic acid capture probe functionalized coding microspheres is as follows: a nucleic acid capture probe with a thiol group modified at the 5' end is incubated with ultramultiple isotope coding microspheres at 37°C for 2 hours, followed by magnetic separation and washing to obtain the nucleic acid capture probe functionalized coding microspheres.

10. A high-throughput detection system based on multiple isotope-encoded microspheres according to claim 9, characterized in that, The detection method for antibody-functionalized encoded microspheres is as follows: the antibody-functionalized encoded microspheres are mixed with the sample to be tested, so that the capture antibody on the antibody-functionalized encoded microspheres specifically binds to the corresponding antigen. A rare earth element-labeled reporter antibody is added to form an antibody-functionalized encoded microsphere-antigen-reporter antibody complex. The isotope signal on the antibody-functionalized encoded microspheres and the reporter antibody element signal are detected by mass spectrometry flow cytometry. If both the isotope signal on the antibody-functionalized encoded microspheres and the reporter antibody element signal are positive, the detection result of the corresponding antigen in the sample to be tested is determined to be positive. The detection method of the nucleic acid aptamer functionalized coding microspheres is as follows: the nucleic acid aptamer functionalized coding microspheres are mixed with the sample to be tested, so that the nucleic acid aptamer specifically binds to the corresponding target. Rare earth element-labeled aptamer reporter probes are added to form a nucleic acid aptamer functionalized coding microsphere-protein target-aptamer reporter probe complex. The isotope signal and aptamer reporter probe element signal on the nucleic acid aptamer functionalized coding microspheres are detected by mass spectrometry flow cytometry. If both the isotope signal and the aptamer reporter probe element signal on the nucleic acid aptamer functionalized coding microspheres are positive, the detection result of the corresponding target in the sample to be tested is determined to be positive. The detection method of the nucleic acid capture probe functionalized coding microspheres is as follows: the nucleic acid capture probe functionalized coding microspheres are mixed with the sample to be tested, reverse primers and PCR reaction mixture, so that the capture probes on the microspheres and the reverse primers perform in situ PCR reaction with the target molecule DNA as a template, and the amplification product is anchored on the microspheres. A nucleic acid reporter probe labeled with rare earth elements is added and hybridized with the amplification product to form a nucleic acid capture probe functionalized coding microsphere-amplification product-nucleic acid reporter probe complex. The isotope signal and the nucleic acid reporter probe element signal on the nucleic acid capture probe functionalized coding microspheres are detected by mass spectrometry flow cytometry. If both the isotope signal and the nucleic acid reporter probe element signal on the nucleic acid capture probe functionalized coding microspheres are positive, the detection result of the corresponding nucleic acid target in the sample to be tested is determined to be positive. The antibody-functionalized encoded microspheres, the nucleic acid aptamer-functionalized encoded microspheres, and the nucleic acid capture probe-functionalized encoded microspheres are used to detect the sample simultaneously or individually.

Images